ID: 1015112337

View in Genome Browser
Species Human (GRCh38)
Location 6:129607478-129607500
Sequence AAGCACAAGGAGAAGTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015112337 Original CRISPR AAGCACAAGGAGAAGTGGTA GGG (reversed) Intronic
901470587 1:9453784-9453806 AAGCACACAGAGACGTGGAAAGG + Intergenic
903902899 1:26661441-26661463 GAGCTCAAGGAAAAGAGGTAAGG + Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904979789 1:34489486-34489508 AAACACAATCAGAAGTGATAAGG + Intergenic
905514515 1:38552288-38552310 AAACACATGGAGAAGGTGTATGG - Intergenic
907621285 1:55983443-55983465 AAGGACAAGGCGAAGGGGAAGGG + Intergenic
908195855 1:61745060-61745082 AAGCCCAAGAAGATGGGGTAGGG - Intronic
909273450 1:73654381-73654403 AGGCAGCAGGAGGAGTGGTATGG - Intergenic
911835169 1:102609769-102609791 AAGCACAAAGAGAAAAGGTCAGG + Intergenic
912114514 1:106388638-106388660 AAGGAGAAGGAGAAGTAGTAGGG + Intergenic
912848532 1:113100737-113100759 AAGCATAAGGAGCAGTGCTGAGG - Intronic
914416241 1:147485241-147485263 AGGCATTAGGAGGAGTGGTATGG - Intergenic
915910720 1:159913626-159913648 AGGCCCAAGGAGCAGTGGAATGG - Intergenic
915920000 1:159969048-159969070 AAGAAGAAGAAGAAGAGGTAGGG + Intergenic
916977442 1:170096234-170096256 AACCACAAGGAGAAGTAACAAGG - Intergenic
917069514 1:171134973-171134995 AAGTACAAGGAGACATGGAAAGG + Intergenic
917290161 1:173464017-173464039 AAACACAATCAGAAGTGATAAGG + Intergenic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
920773435 1:208912221-208912243 AAGCATAGGGAGGAGTAGTATGG - Intergenic
920847875 1:209608711-209608733 AAGTATAAGGAGAGGTGGCAAGG + Intronic
921061460 1:211588668-211588690 TGGCACCAAGAGAAGTGGTAGGG - Intergenic
922462029 1:225820772-225820794 GTGCACAAGCAGAAGTGGTTAGG - Intronic
922975416 1:229779728-229779750 AAGGAGAAGGTGAAGTGGTGGGG + Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923663155 1:235976435-235976457 AAGCCCAAGAGGAAGTGGTAGGG - Exonic
923866136 1:237941506-237941528 AAGCAGAAGGAGGAGTAGTATGG + Intergenic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1065139324 10:22705127-22705149 AAGTTCAAGGAGAAGTGAAAAGG + Intronic
1066070780 10:31808594-31808616 TAGCACAAGGGGAAGCGGGAAGG - Intronic
1067152484 10:43748314-43748336 AAGCACAAGGAGAAATGAGTTGG + Intergenic
1068399910 10:56515093-56515115 AAGCCCAAGGTCAAGTGGTGAGG + Intergenic
1069834273 10:71299021-71299043 GGGCACAAGGGGAAGTGGGAAGG - Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074890848 10:117735562-117735584 AAGTACAAGGGGAAGTGGTCAGG - Intergenic
1075456694 10:122589512-122589534 AAGCAGAGGGAGAAGAGGAAAGG + Intronic
1078598988 11:12714265-12714287 TGGCACAAGGAGAAGTGGAAAGG + Intronic
1079317702 11:19423189-19423211 AAGCTCAAAGAGATTTGGTATGG - Intronic
1079528187 11:21415745-21415767 AAGCAAAAGGAGAAGGGCTGGGG + Intronic
1079556309 11:21761874-21761896 AAAGACAAGGAGAAGGGGCAAGG + Intergenic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1083305762 11:61761276-61761298 AAGCACAAGGAGGGGCGGAAGGG + Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083789736 11:64976792-64976814 AAGCCCAAAGGGAGGTGGTAGGG - Intergenic
1085153066 11:74267696-74267718 AAACAGAAAGAGAAGTGGAAGGG - Intronic
1085667566 11:78428499-78428521 AAACATTAGGAGAAGTGGTGGGG + Intergenic
1086931414 11:92697282-92697304 AAGGAAAAGCAAAAGTGGTATGG - Intronic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1089739974 11:120575724-120575746 AAGCACAAGGAGAAGAGAGGAGG - Intronic
1090043525 11:123311333-123311355 AAGGAGAATGAGAATTGGTAGGG - Intergenic
1090114697 11:123956137-123956159 AGGCACAGGGAGAAGAGGCAGGG + Intergenic
1090805887 11:130201876-130201898 AACCTCAAAGAGAAGTGGTTGGG - Intronic
1091691328 12:2599364-2599386 TAGCACAAGGAACAGTGGAAGGG + Intronic
1093412546 12:18884066-18884088 AGAAACAATGAGAAGTGGTAGGG - Intergenic
1095435391 12:42181305-42181327 AAGCAGTAGGAGAAGTAGTAAGG - Intronic
1096051439 12:48612430-48612452 AAACACAATCAGAAGTGATAAGG - Intergenic
1097543544 12:60970395-60970417 ATGCACAGGGAGACCTGGTAGGG + Intergenic
1098287588 12:68923466-68923488 AAGCACAAAGAGAGCTGTTAAGG - Intronic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099764101 12:86960548-86960570 AAGGAGAGGGAGAAGTGGGAAGG - Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101013723 12:100477516-100477538 AAAGAAAAGGAGAAATGGTATGG + Intronic
1101279469 12:103237726-103237748 AAGCACAAGGAGGAGAGCCAAGG - Intronic
1101871647 12:108570726-108570748 AATCACAAAGAAAAGTGGTGGGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102585620 12:113920732-113920754 AAGCACAAGGCCAAGTGCAAGGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1104091471 12:125521314-125521336 AAGGAAAAGGAGAAGGGGAAGGG - Intronic
1105636560 13:22221053-22221075 AATTAAAAGGAGAACTGGTAGGG + Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1107176847 13:37409222-37409244 AGGAACAAGGAGAAATGCTAAGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1108579868 13:51819169-51819191 ATGCACAAGGAGAGGTGCGAGGG + Intergenic
1109690233 13:65878519-65878541 AAGAAGAGGGAGAAGAGGTAGGG - Intergenic
1109958171 13:69596209-69596231 ATGCACAAATATAAGTGGTATGG + Intergenic
1110365562 13:74681061-74681083 AGGTACAAGTAGAAGTGGAAAGG - Intergenic
1110536956 13:76661656-76661678 ATGAACAAAGAAAAGTGGTAAGG + Intergenic
1113313711 13:109157130-109157152 AAGCAGAAGGAGGAGTGGAAAGG - Intronic
1114852904 14:26401849-26401871 AAGCACTATTAGAAGTGCTAAGG - Intergenic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115601494 14:34959929-34959951 GAACAAAAGGAGAAGTGATAAGG + Intergenic
1116169197 14:41377198-41377220 AAGGACATGTAGAAGTGGCAGGG - Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116790765 14:49337519-49337541 AAGCAAAGGAAGAAGTGGTCAGG - Intergenic
1117014391 14:51504080-51504102 AAACACAATCAGAAATGGTAAGG - Intronic
1118539046 14:66802491-66802513 AAGCAGAAGGAAAAGTGAAAGGG - Intronic
1118924716 14:70181607-70181629 AAGAACAAGGACAAGTCTTAGGG + Intronic
1119826781 14:77663431-77663453 AAGTACAAGGTGTAGTGGGAGGG - Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120655856 14:87189132-87189154 AAGCAGAAGGAGAATTTGGATGG - Intergenic
1121171642 14:91859450-91859472 AAGCTTCAGGAGAAGTGGAATGG - Intronic
1121495312 14:94388130-94388152 AAGCAGTAGGAGAGGTGGTGAGG + Intronic
1121911067 14:97793037-97793059 TAGCACAGGGAGAAGAGTTAGGG - Intergenic
1123765119 15:23470620-23470642 AAGCCCCAGAAGAAGTGTTATGG + Intergenic
1124054553 15:26230302-26230324 AAGCAGAAGCAGAAGTGCTTAGG - Intergenic
1124139368 15:27063892-27063914 AGGCAAAAGGAGAAGGGGTGTGG - Intronic
1125316418 15:38437004-38437026 AAGTACAATCAGAAATGGTAAGG - Intergenic
1125999870 15:44198557-44198579 AAGCATAAGGAGAACTAGAAAGG + Intergenic
1128844343 15:70876814-70876836 TAGCACAAGAAGAATTGGAATGG - Intronic
1129804426 15:78443351-78443373 AAGGAAAGGGAGAAGTGGTTGGG + Intronic
1130042902 15:80419656-80419678 AAGCCCAAAGAGAAAAGGTAGGG - Intronic
1131253193 15:90844300-90844322 ATGGACAAGGAGAAGTAATAAGG - Intergenic
1132065749 15:98729585-98729607 AAGGACAATGAGATGTGGAAAGG - Intronic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1138150882 16:54655650-54655672 AAGAAAAAGCAGAAGTGGAAAGG + Intergenic
1139086884 16:63598051-63598073 AACCACATTGAGAAGAGGTAGGG - Intergenic
1139844379 16:69909229-69909251 AAGTTCAAGGAGAAGGGGTTTGG + Intronic
1140286592 16:73608237-73608259 AAGCACATGGGGAAATGGGAAGG - Intergenic
1141755215 16:85986493-85986515 AAGCAGATGGAGAACTGGAATGG + Intergenic
1143623412 17:8094272-8094294 GAGCAAAGGGAGAAGTGGTTTGG + Intergenic
1143850040 17:9804096-9804118 AAGGACAAGGAGAATTGGAGAGG + Intronic
1148207719 17:45790024-45790046 CATCAAAAGGAGAAGTGGTGAGG + Intronic
1149558964 17:57594521-57594543 AAGCCCAAAGAGAAGTGGCTTGG + Intronic
1149778942 17:59381017-59381039 AAGGCCAAGGAGGAGAGGTAGGG + Intronic
1150590505 17:66558353-66558375 AAAAACAAGGAGTACTGGTAAGG + Intronic
1151370415 17:73643754-73643776 GAGCCCAAGGTGAAGTGGGAGGG - Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1153551401 18:6265226-6265248 AAGCACAAAGAAAATTGGGAAGG - Intronic
1154000323 18:10477134-10477156 TAGCAGAAAGAAAAGTGGTATGG - Intronic
1155345842 18:24855830-24855852 AAGCAAAAGGAGTGGAGGTATGG + Intergenic
1156135154 18:34028814-34028836 CAGCAGAAGTAAAAGTGGTAGGG + Intronic
1157257034 18:46148776-46148798 AAACACAGAGAGAAGTGTTATGG + Intergenic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1159081507 18:63740675-63740697 GAGCACATGAAGAAGTGGTGAGG - Intergenic
1160218110 18:76951910-76951932 AGGCCCAAGGAGAGGTGGGATGG + Intronic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1162753713 19:12844498-12844520 TAGCACAAGGTGAGGTGATAGGG + Intronic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1164211927 19:23106145-23106167 AAGCAGAAGGAGAAGGAGAAGGG + Intronic
1165967703 19:39597300-39597322 AGGCTCAAGGAGAAGGTGTAGGG + Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166851183 19:45762080-45762102 AAGCCCAAGGAGAAGAAGAAAGG + Exonic
1167298133 19:48663770-48663792 AAGCACCAGGAGTAGTGGCAAGG + Exonic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168366124 19:55789153-55789175 AAGCACAAGAGGAAGTGGATTGG - Intronic
925181465 2:1819747-1819769 GAGGACAAGGAGCAGTGGAAGGG + Intronic
926222407 2:10944838-10944860 AAGCCCAAGGAGAACTGACAGGG + Intergenic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928438070 2:31268780-31268802 AAGCTGAAGGAGAAATGGGAAGG + Exonic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933904481 2:86876666-86876688 AAGCAGAGGGAGATGTGGAAGGG + Intergenic
936367758 2:111875485-111875507 AAGCAGAGGGAGATGTGGAAGGG - Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936951659 2:117983475-117983497 AAGGACAAGGAGAACTGTAAGGG + Intronic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
937495203 2:122411866-122411888 AAGCAGAAGGAGAAGTGGGTGGG - Intergenic
937704620 2:124905678-124905700 AGCCACATGGAGAAGTGCTAGGG + Intronic
937910435 2:127073083-127073105 AAACACAAGGAGCCCTGGTACGG - Intronic
938582703 2:132661570-132661592 AAACAAAAGTGGAAGTGGTATGG + Intronic
938976335 2:136481786-136481808 AATGACTAGGAGAAGTGGCAGGG + Intergenic
939756911 2:146125411-146125433 AAGCGCAAGGAAAAGTGCAAAGG - Intergenic
939918536 2:148079528-148079550 AGACACAAGTAGAAGTGGGATGG - Intronic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
941966342 2:171304595-171304617 AACCACAAGGAGTAATGGAAGGG + Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949027217 2:241771909-241771931 AAGCAGAAGGGCAAGTGGTTGGG + Intergenic
1170046668 20:12092635-12092657 AAGGGCAAGGAGAAGTGGATGGG + Intergenic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1172417852 20:34786193-34786215 AAGCACAATCAGAAATGATAAGG - Intronic
1173257459 20:41405054-41405076 AAGCACAACGAAAAGTGGTACGG - Exonic
1174702358 20:52621694-52621716 AATAACAAGAAGAAGTGGTTTGG - Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1177876614 21:26640621-26640643 AAGCACAAAGAGAAAAGGAATGG - Intergenic
1178003908 21:28195347-28195369 AAGCACAATAAGAAATGATAAGG + Intergenic
1178013046 21:28308646-28308668 GAGTACAAGGGGAAGTGGAATGG - Intergenic
1179502902 21:41821163-41821185 GTGCACAAGGAGAAGGGCTATGG - Exonic
1179965105 21:44799456-44799478 AAGCACAAGGTGAAGCAGCAAGG - Intronic
1180836246 22:18930984-18931006 GAGCACAAGGAGATGGAGTAAGG - Exonic
1182795077 22:32985985-32986007 AATGACAACGTGAAGTGGTAAGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1183576941 22:38697204-38697226 AAGCAAAGGGAGAAGAGGTGAGG - Intronic
1183694538 22:39414223-39414245 AAGGACCCGGAGAATTGGTAGGG + Intronic
1184964965 22:47965011-47965033 AAGCACAGGATGAAGTGGTCAGG - Intergenic
1203286338 22_KI270734v1_random:156283-156305 GAGCACAAGGAGATGGAGTAAGG - Intergenic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
950007627 3:9701694-9701716 AAGCACAAGGACAGGTGGTATGG + Intronic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951856308 3:27200926-27200948 AAACAGAAGGGGAAGTGGGAGGG + Intronic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
953249017 3:41226251-41226273 AAGCACTATGCGAAGTAGTAGGG + Intronic
954707889 3:52490743-52490765 AAGCACTGGGAGATGTGGAAAGG - Exonic
954968620 3:54633191-54633213 AAGCAAATGGATAGGTGGTAGGG - Intronic
956055588 3:65295249-65295271 TAGCACAAGGGTAAGTGGCAAGG + Intergenic
956289544 3:67647122-67647144 AAGCACAGGGAGAAATGGATGGG + Intronic
958529118 3:95302064-95302086 AAGAAGAAGAAGAAGAGGTATGG + Intergenic
958821904 3:98984634-98984656 GAGAACAAGGAGAAGAGGCAGGG - Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
961647843 3:128401896-128401918 AAGGACAGGGACAAGAGGTAAGG - Intronic
962930563 3:140032042-140032064 AAGCACAAGTAGAGGTGGGAAGG + Intronic
964025033 3:152062700-152062722 AGGCACAACGAGAAGTGTGATGG + Intergenic
964089423 3:152857029-152857051 AAGCACAAGGCCCAGTGATATGG + Intergenic
964835136 3:160929866-160929888 AAGCTGAAGGAGAGGTGGGAAGG - Intronic
965030824 3:163365352-163365374 GATCACAAGGAAAATTGGTAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967389317 3:188940059-188940081 AAGGACAAGGAGGAGGGGTTTGG + Intergenic
967794911 3:193589374-193589396 AACCACAAAGAGTAGTGTTAAGG + Intronic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
971105215 4:23517342-23517364 AAGGAGAAGGAGGAGTGGGAAGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
972311868 4:37890369-37890391 AAGGACGGGGAGAAGGGGTAAGG + Intergenic
973759303 4:54101773-54101795 AAGCACAAGAAGGAGGGGAAGGG + Exonic
974133701 4:57788449-57788471 AAGCACACTGAGAACTGGAAGGG + Intergenic
975398198 4:73902487-73902509 AACCACATTGAGGAGTGGTAAGG - Intergenic
976874966 4:89841864-89841886 AAGCTCAAGGAGCATTGATAGGG + Intergenic
978085953 4:104654990-104655012 AAGAACAAGGAGAAGAGAGATGG + Intergenic
978224303 4:106315953-106315975 AAGCACAAAGACAAGGGGGATGG + Intronic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
980200178 4:129646719-129646741 AAGGACAAGGTGAAATAGTATGG + Intergenic
980534285 4:134095717-134095739 TAGCTGAAGGAGAAGTGATAAGG - Intergenic
981220850 4:142232557-142232579 AGGCCCAAGGAGAAGAGGGAGGG - Intronic
981723145 4:147821383-147821405 AAGCATAAGGTGAAATGGGATGG - Intronic
982444313 4:155472119-155472141 AAGATCAAGGGGATGTGGTACGG + Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983392026 4:167144252-167144274 AAGCACAAAGATAATTGTTAGGG - Intronic
983926896 4:173412391-173412413 AAACAGAAGAAGAAATGGTAGGG - Intergenic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
986111891 5:4727489-4727511 ATGCTCAAAGACAAGTGGTATGG + Intergenic
986782305 5:11077709-11077731 AAGCACAGGGAGACTAGGTAAGG + Intronic
987373027 5:17210423-17210445 AAGTCAAAGGAGAAGTGCTAGGG + Intronic
990327722 5:54694615-54694637 AGGCAGAAGGAGGAGGGGTAAGG + Intergenic
990389908 5:55308098-55308120 AAGGACAAGGGGAAATGGAAGGG + Exonic
990695120 5:58407852-58407874 AAGCAGAAAGCCAAGTGGTATGG - Intergenic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
995247214 5:109948016-109948038 AAGCTCCTGGAGAAGGGGTAAGG - Intergenic
997364620 5:133318010-133318032 AAGCACAAGAAAAAGTGGTTGGG - Intronic
997658367 5:135571992-135572014 AACCCCCAGGAGAAGTGGGAGGG + Intronic
997825226 5:137100319-137100341 AGGGACAAGGAGAGGTGGAATGG - Intronic
998598765 5:143562633-143562655 AAGCACGTGGAGAAGTAGGAGGG - Intergenic
998642464 5:144026855-144026877 GAGCACATGGAGAAGTGCTGGGG + Intergenic
999272474 5:150304651-150304673 AAGCACAAAGAGAAGCAGCAAGG + Intronic
999517397 5:152314880-152314902 AAGCAAAAGGAGTCGGGGTAGGG + Intergenic
999526526 5:152412017-152412039 AAGCACAAGGAGAAGTCCCTTGG - Intronic
999659916 5:153850228-153850250 AAACACAATAAGAAATGGTAAGG - Intergenic
1000215219 5:159148921-159148943 AAGCCCAAGGAGGAGAGGAAAGG + Intergenic
1000253224 5:159514571-159514593 TTGCACAAGGAAAAGTGGGAGGG + Intergenic
1000748963 5:165071180-165071202 AAACACAATCAGAAATGGTAAGG - Intergenic
1001548688 5:172586797-172586819 AGGCACAGAGAGAAGTGGTGTGG + Intergenic
1003487537 6:6592531-6592553 AAGCATAAGGGAAAGTGCTATGG + Intronic
1004202159 6:13558820-13558842 AAGCAGTGGGAGAAGTGGTGTGG + Intergenic
1004462712 6:15853422-15853444 AAGCAGAAGGGGAAGGGGAAAGG - Intergenic
1006420547 6:33931244-33931266 GAGCACAGGGAGGAGTGCTAAGG + Intergenic
1008016386 6:46525258-46525280 AAGGGCAAGGAGACCTGGTAAGG - Intergenic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1008970864 6:57366433-57366455 AAGGACATGGAGATGTGGTTGGG + Intronic
1009159826 6:60268235-60268257 AAGGACATGGAGATGTGGTTGGG + Intergenic
1009722748 6:67495720-67495742 AAGGAGAAGGAGAAGTAGTATGG + Intergenic
1009783018 6:68294332-68294354 AAACACAATCAGAAGTGTTAAGG - Intergenic
1009799264 6:68512956-68512978 AGGTAAAAGGAGAAGTGTTATGG - Intergenic
1010487092 6:76427792-76427814 CAACACAAGGAGAAGAGGTTGGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1012322778 6:97871644-97871666 AAGCACAAGGAACAGTTTTAGGG + Intergenic
1013699250 6:112743671-112743693 AAGCATAAGGAGAGGTAGTAGGG - Intergenic
1014294198 6:119598401-119598423 AGGCACAAGGAGAAGGAGAAGGG + Intergenic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014405281 6:121043460-121043482 CATCACAAGGAGGATTGGTAGGG - Intergenic
1014585635 6:123194572-123194594 AAAAACAAGGAGATGTGGAAAGG - Intergenic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016865370 6:148760889-148760911 AAGCACAAAGAGAAATGAAATGG + Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017638104 6:156463219-156463241 ATGCCCAAGTGGAAGTGGTATGG - Intergenic
1018255314 6:161912570-161912592 CAGCACGTGGAGAGGTGGTATGG + Intronic
1018826336 6:167410176-167410198 AACCACCAGGAGAAGGGGAAAGG - Intergenic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021290767 7:18841793-18841815 AGACACAAGGAGAAGTGGCTTGG - Intronic
1021794966 7:24245310-24245332 AAGCTCAAGCAGAAGTTGCAAGG + Intergenic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1022289126 7:28984367-28984389 TAGCCCCAGGAGAAGTGGAAGGG - Intergenic
1022463325 7:30632912-30632934 AAGGAGAAGGATGAGTGGTAAGG + Intronic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1023248391 7:38231851-38231873 AAGCACAGATAGAAGTTGTAGGG - Intergenic
1029665436 7:101992210-101992232 AAGCACAGGGGAAAGTGGGACGG + Intronic
1031951629 7:127898591-127898613 AAACACAATGAGAAGTGCTTCGG + Intronic
1032767833 7:135016575-135016597 TAGCTAAAGGAGAAGTGGCAGGG + Intronic
1033462021 7:141555301-141555323 AGGCCAGAGGAGAAGTGGTAAGG + Intronic
1033602224 7:142896688-142896710 AAGAACAAGGAAAGGTGGCAGGG + Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1034354421 7:150441866-150441888 AAGCAGAAGGAGAAGGAGAAGGG - Intergenic
1036145520 8:6251277-6251299 AGGCACTAGAAGAGGTGGTAGGG + Intergenic
1036900539 8:12666164-12666186 GAGGCCAAGGAGAAGTGCTAGGG + Intergenic
1038661052 8:29497278-29497300 TAGCACAAGGAAAAGTGTGAAGG - Intergenic
1038801441 8:30753089-30753111 AAGCACAAGGAGAGAAGGTAAGG + Exonic
1040638306 8:49301819-49301841 AAGCGCATGGGGAAGTGGCAAGG - Intergenic
1041482273 8:58334886-58334908 AAACACAATCAGAAATGGTAAGG + Intergenic
1041667472 8:60459693-60459715 AAGCACAAGGTAAACTGGGAAGG + Intergenic
1041669103 8:60475354-60475376 AAGGAGAAGGAGAGGAGGTAAGG - Intergenic
1042262242 8:66871328-66871350 GAGCCCAAGGAGAAGTGTTAAGG - Intronic
1042653484 8:71069142-71069164 AAGCAAAAGTAGGGGTGGTAAGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043582063 8:81725582-81725604 TGGCAAAAGGAGAAATGGTAAGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1043936433 8:86147954-86147976 AAGCAATTGGAGAAGTGGGAAGG - Intronic
1044761558 8:95522893-95522915 AGGCACTAGGAGATGTGGAAAGG - Intergenic
1044890496 8:96830065-96830087 AGGTCCATGGAGAAGTGGTAAGG - Intronic
1045068759 8:98478144-98478166 GAGCACAAGGACAAGAGGAATGG + Intronic
1047200037 8:122757364-122757386 AAGGAGAAGGAGATGTGGTAAGG - Intergenic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048978302 8:139687809-139687831 AATCACATGGAGAAGTGGATGGG - Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051861119 9:21626059-21626081 ATGGACAAAGAGAATTGGTAAGG - Intergenic
1052678663 9:31659675-31659697 AAACACAATCAGAAATGGTAAGG - Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053602880 9:39628649-39628671 AAGCTCAAAGAGAAATGGTCTGG - Intergenic
1053800834 9:41763691-41763713 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1053860528 9:42382395-42382417 AAGCTCAAAGAGAAATGGTCTGG - Intergenic
1054144361 9:61551149-61551171 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054189265 9:61975841-61975863 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054250657 9:62713787-62713809 AAGCTCAAAGAGAAATGGTCTGG + Intergenic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1054564765 9:66748299-66748321 AAGCTCAAAGAGAAATGGTCTGG + Intergenic
1054649252 9:67612771-67612793 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054749136 9:68886737-68886759 AAGGACAAGGGGAAGATGTAGGG - Intronic
1055601850 9:77927641-77927663 AAAAAAAAGTAGAAGTGGTATGG - Intronic
1056430995 9:86527615-86527637 AAGAACAAGAAGAAGAGGTTGGG + Intergenic
1057682729 9:97205347-97205369 AAGCACAAGCACAAGGGGTCAGG + Intergenic
1057861867 9:98647017-98647039 AGGCACAATGAGAAGAGGCAGGG + Intronic
1058728788 9:107829416-107829438 AAGGAAAAGGAGAAAGGGTAGGG - Intergenic
1058952210 9:109914483-109914505 CAGCACAAGTAAAAGTGGAAAGG - Intronic
1059567235 9:115395135-115395157 AAGCTCAAAGAGAAGAGATAAGG + Intronic
1060030392 9:120209919-120209941 AAGAACAAGGATTAGAGGTAAGG + Intergenic
1060627151 9:125124046-125124068 AAGCAAAAGGAGAGGTGCTTGGG - Intronic
1060776638 9:126379566-126379588 AAGCTGAAGGAGGAATGGTATGG - Intronic
1061467415 9:130792559-130792581 TGGCACAAGGAGAAGAAGTACGG + Intronic
1187286588 X:17910630-17910652 AAGCACAATCAGAAATGATAAGG - Intergenic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188376296 X:29432774-29432796 AAGTAGAAGGAGAAGTATTATGG - Intronic
1188535713 X:31194640-31194662 AAGCACAAAGAGTAGTTGAAAGG - Intronic
1189530184 X:41872433-41872455 AAGCACAAGGAGCATAGGTAGGG - Intronic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1190524157 X:51311351-51311373 AAGCTAATAGAGAAGTGGTAGGG - Intergenic
1192931557 X:75811722-75811744 AAGCACAAGGAAGAGTGGGAAGG - Intergenic
1193643711 X:84042314-84042336 AAGCACAATCAGAAATGATAAGG - Intergenic
1193841073 X:86409293-86409315 AAGCACATGGAGTAGTAATATGG + Intronic
1193915534 X:87357734-87357756 AAGCAGAGGGAAAAGTGGGAAGG + Intergenic
1194081311 X:89468162-89468184 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1194473407 X:94326586-94326608 AAGCACAAGGTTATCTGGTATGG + Intergenic
1196513538 X:116543424-116543446 AAACACAATGAGAAATGATAAGG - Intergenic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1197425127 X:126287397-126287419 AAGCAAAAGGCTAAGTGATAGGG - Intergenic
1198187463 X:134267248-134267270 AAGGACAAGGGGAAGTGGCAGGG + Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1198886763 X:141347525-141347547 AAGCACAATCAGAAATGTTAAGG + Intergenic
1199250066 X:145650925-145650947 ATCCACAAGTAGAAGTGGCATGG + Intergenic
1199765402 X:150937593-150937615 AAGCAGAAGGAGAAGTGATGTGG - Intergenic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200433983 Y:3124359-3124381 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1201380490 Y:13371795-13371817 AAGCTGATGGAGAAGTTGTAGGG + Intronic