ID: 1015118945

View in Genome Browser
Species Human (GRCh38)
Location 6:129680469-129680491
Sequence GAGGTTATTATTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015118945 Original CRISPR GAGGTTATTATTGAGGAGGA AGG (reversed) Intronic
900850010 1:5135398-5135420 GAGGTGAATAATGAGGAGGGTGG - Intergenic
901137062 1:7004681-7004703 GTGGTTGTCTTTGAGGAGGATGG - Intronic
901989452 1:13100866-13100888 GAGGGTATTGATGAGGATGAGGG - Intergenic
901992361 1:13125898-13125920 GAGGGTATTGATGAGGATGAGGG + Intergenic
902408923 1:16201781-16201803 GAGGTCATCAGTGAGGGGGAAGG - Exonic
904920581 1:34004905-34004927 GAGGTAATTGCTGAGGAAGAAGG - Intronic
906200260 1:43955672-43955694 GAGGTTATACTGGAGTAGGATGG - Intronic
906533701 1:46539439-46539461 GGGGTTCTTGTTGAGGGGGAGGG + Intergenic
908341364 1:63183294-63183316 GCGGCTATTATTGAACAGGATGG - Intergenic
908958600 1:69667803-69667825 AATGTTATTATTGATGAGTAAGG + Intronic
910094000 1:83499157-83499179 AAGGTTCTTGTTAAGGAGGATGG - Intergenic
910565028 1:88633935-88633957 AAGGTTATTATTGATAAGTAAGG + Intergenic
911086330 1:93980445-93980467 GAGCTTAGTTTAGAGGAGGAAGG - Intergenic
912316659 1:108673362-108673384 AATGTTATTATTGGTGAGGAGGG - Intergenic
913670741 1:121095331-121095353 GAGATTGTTGGTGAGGAGGAGGG - Intronic
914022504 1:143882754-143882776 GAGATTGTTGGTGAGGAGGAGGG - Intergenic
914660990 1:149790696-149790718 GAGATTGTTGGTGAGGAGGAGGG - Intronic
915140381 1:153764205-153764227 GAGGAGATTACTGAGGAGTAAGG + Exonic
915157339 1:153889082-153889104 GAGGTGATTATTAAAGTGGAGGG - Intronic
915632864 1:157165311-157165333 GAGGTTATCCTTGAGGAGAGGGG - Intergenic
916509181 1:165456042-165456064 GAGCTTCCTATTGTGGAGGAAGG - Intergenic
917583595 1:176401887-176401909 AATGTTATTATTGATGAGTAAGG + Intergenic
918450226 1:184650455-184650477 GAGGTTTTGATGGAGGAGGAGGG - Intergenic
918952459 1:191157010-191157032 GAGGTTATTATTGATGGGTCAGG - Intergenic
920035654 1:203063786-203063808 GAGGCTATTATGGGGGAGGAAGG - Intronic
921334867 1:214075961-214075983 GAGGTGATTAGGGAGGAGGAGGG + Intergenic
921381511 1:214529551-214529573 GAGGTTGTTTATAAGGAGGATGG - Intronic
922067020 1:222154231-222154253 GAGGATCTCACTGAGGAGGAGGG - Intergenic
923454454 1:234151132-234151154 GAGGTCAGAATTGAGCAGGATGG + Intronic
1064211692 10:13365367-13365389 GAGGAAATAATTGAGGAAGACGG - Intergenic
1064244802 10:13659857-13659879 GAGGTTTTTTTTGGGGGGGAAGG - Intronic
1064601977 10:17003209-17003231 GAGGTTACTTTGGAGGCGGATGG + Intronic
1068393041 10:56423932-56423954 GTGGTTATAATTGACAAGGATGG - Intergenic
1069431235 10:68336365-68336387 GAGGTTATTTTGGAGGGGAAGGG + Intronic
1069512301 10:69051563-69051585 GAGGTAATAATGGATGAGGATGG - Intergenic
1069739967 10:70681232-70681254 GAGGTGAGTACTGAGAAGGAGGG + Intronic
1072107716 10:92290643-92290665 GAGGTTCTTCTTGAGGGGGCGGG - Intronic
1072468661 10:95691776-95691798 GAGGTTATTATTATTGGGGATGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073192387 10:101660991-101661013 AAGGTGGGTATTGAGGAGGAAGG + Intronic
1073998967 10:109348330-109348352 CATGTTATTATTGTGGTGGAGGG - Intergenic
1076299185 10:129411852-129411874 GAGCTTAGGGTTGAGGAGGATGG + Intergenic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1077936876 11:6797454-6797476 GAGGTAGGTATTGAGGAGAAAGG - Intergenic
1079508560 11:21183439-21183461 GAGAATATTATTCAGGAGAAGGG + Intronic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1083016474 11:59459296-59459318 GAGGTGAGTATAGAGGAAGAAGG - Intergenic
1083036051 11:59638658-59638680 GAAGTTATGATTGGGGTGGAGGG - Intronic
1083637414 11:64128110-64128132 GAGGTGAGGATGGAGGAGGAGGG - Intronic
1084941412 11:72615276-72615298 GAGGTCATTTTGGAGGAGGCAGG - Intronic
1086410403 11:86539117-86539139 GGGGTTGTTAATAAGGAGGAAGG + Intronic
1086634398 11:89064218-89064240 AAGGTTAGCATTGAGGAAGAAGG - Intronic
1087548651 11:99617290-99617312 TAAGTTATTATTGAAGGGGATGG + Intronic
1088566410 11:111177574-111177596 AATGTTATTATTGAGGAAGTGGG - Intergenic
1088891912 11:114051245-114051267 AATGTTATTTTGGAGGAGGAGGG + Intergenic
1089477196 11:118774179-118774201 GGGGTTATGATTGAGAAAGATGG - Intronic
1089578623 11:119466531-119466553 GATGTTATTATTGATAAGTAAGG + Intergenic
1090326614 11:125892321-125892343 AAAATTATTATTGAGGAAGAAGG + Intronic
1091898680 12:4124829-4124851 GATGGTATTATTCGGGAGGAAGG - Intergenic
1092020190 12:5195740-5195762 GATGATAATATTGAAGAGGAAGG - Intergenic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1092996994 12:13959849-13959871 GATATTATTATTCAGGATGATGG + Intronic
1094112202 12:26873813-26873835 GAGATTAATATTGAGGGGGTGGG + Intergenic
1094169416 12:27476849-27476871 AAGGTTATTATTGATAAGTAAGG + Intronic
1096001794 12:48136186-48136208 GAGGTTAAGAATGAGGAGGGAGG - Intronic
1098514711 12:71360619-71360641 AAGGTTATTACTGACAAGGAAGG - Intronic
1099449281 12:82789334-82789356 GAGGTTATTAATAAAGAGGGAGG + Intronic
1100392511 12:94156382-94156404 GAGGTTATTTGGTAGGAGGATGG - Intronic
1101416427 12:104512618-104512640 TAGGCTATTATTGAGGTAGAGGG + Intronic
1102792348 12:115657936-115657958 GATGATAGTAATGAGGAGGAGGG - Intergenic
1103895262 12:124269043-124269065 GAGGGTATTAGTGGGGATGACGG - Intronic
1105897271 13:24726951-24726973 GAGGTTCTGATTCAGGAGGTTGG - Intergenic
1106348075 13:28899160-28899182 GATATTATTATTGAGGAAAACGG - Intronic
1107180765 13:37456273-37456295 GAGGTCATATTTGAGTAGGATGG + Intergenic
1107287507 13:38812295-38812317 AAGGTTATTATTGATAAGTAGGG + Intronic
1109662211 13:65476318-65476340 GAGGTGATTTTTGAGGATGTGGG + Intergenic
1110135307 13:72060992-72061014 AATGTTATTATTGATGAGTAAGG - Intergenic
1110895121 13:80740631-80740653 GATTCTATTATTGAGGAGGTTGG - Intergenic
1111300212 13:86339913-86339935 AAGGTTATTATTGATAAGTAAGG + Intergenic
1111658510 13:91180595-91180617 GGGGTTGATTTTGAGGAGGAGGG - Intergenic
1111722300 13:91961840-91961862 GAGTTTGTGATTGATGAGGAGGG + Intronic
1112346124 13:98591381-98591403 GAGGTTATCTTTGAGCAGTATGG + Intergenic
1114614847 14:24062861-24062883 CAGGTTATTAAGGAGGAGCAGGG - Intronic
1123166686 14:106331687-106331709 GAGCTTGCTATAGAGGAGGAGGG - Intergenic
1124856411 15:33393520-33393542 GAGCTTATTATTGATAGGGAGGG + Intronic
1125821112 15:42632430-42632452 AAAGTTATTATTGATGAGTAAGG + Intronic
1126290900 15:47077293-47077315 TAGATTATTACTGAGGAAGAAGG + Intergenic
1127044474 15:55011383-55011405 GCTGTTAGTATTGAGGAGTAGGG - Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1129999073 15:80031799-80031821 GAGCTCATTATGGAGGAGGAGGG - Intergenic
1131553089 15:93374670-93374692 GAGGATATTATAGGGGATGAGGG + Intergenic
1131662665 15:94535223-94535245 GAGGTTCTTACTGAGGACAAAGG - Intergenic
1135538811 16:23314601-23314623 GAGGTGAGTGTGGAGGAGGAGGG + Intronic
1137368944 16:47886972-47886994 AGTGTTATTATTGAGAAGGAAGG + Intergenic
1138606620 16:58094067-58094089 GAGGTGATTTTTGGGGAAGATGG - Intergenic
1138653599 16:58476220-58476242 GGGATTATTATTAAGGAAGAAGG + Intronic
1138745479 16:59358316-59358338 GAAGTTATCATTGGGGAAGAAGG - Intergenic
1138990622 16:62386833-62386855 GAGGGTATCTTTGAAGAGGAGGG + Intergenic
1139647153 16:68339625-68339647 GAGGTTCTTTTTGAGTGGGAAGG + Intronic
1143498437 17:7325379-7325401 GTGGTTGTTATTGTGGACGATGG + Exonic
1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG + Intergenic
1149817611 17:59741547-59741569 TACGTTATTATGGAGGAAGAAGG + Intronic
1151954178 17:77372580-77372602 GAGGCCCTTATTGTGGAGGAAGG + Intronic
1154386304 18:13895521-13895543 GAGGTTTTTATTCAGCAGGAAGG + Intronic
1155162255 18:23205642-23205664 GAGGTTATACTGGAGTAGGACGG + Intronic
1155177578 18:23314140-23314162 GAGGCTATTCTTGTGGAGGCTGG - Intronic
1155338600 18:24791395-24791417 GAGGCTATGACTGAGGAAGATGG - Intergenic
1155731872 18:29170206-29170228 AATGTTATTATTGAGAAGTAAGG + Intergenic
1155996380 18:32335002-32335024 GTGGCTATATTTGAGGAGGAAGG - Intronic
1159020068 18:63136051-63136073 GAGGAAATTCTTCAGGAGGAAGG - Intronic
1159969760 18:74634968-74634990 GAATTTATTTTGGAGGAGGATGG + Exonic
1160299854 18:77669654-77669676 GAGGTTAGACTTGAGTAGGATGG + Intergenic
1161836296 19:6649356-6649378 GAGGTGAAGAGTGAGGAGGAGGG - Intergenic
1164403356 19:27918993-27919015 GTGATTGTTACTGAGGAGGATGG + Intergenic
1165501864 19:36195862-36195884 GAGGTTAAAATTGATGAGTAGGG + Intronic
1166036881 19:40174962-40174984 GAGGTGATTAGTGATGAGGGTGG - Intergenic
1166668414 19:44695462-44695484 GAGGTTGTTCTTGGGGAGAAAGG - Intergenic
926510497 2:13771409-13771431 GAAGTAATTATTGACAAGGAGGG + Intergenic
926638046 2:15205402-15205424 AAGGTTATTATTGATAAGTAAGG - Intronic
927900068 2:26812641-26812663 GCAGTTATTATTTAGGAGAATGG - Intergenic
927991883 2:27453865-27453887 GAGGTTAGTATTGGGGAGTGGGG - Intronic
929304479 2:40345266-40345288 GATGTTGTTATTGATGAGGTAGG - Intronic
931240573 2:60448868-60448890 GAGGTTAACATTGACGAAGATGG - Intergenic
931809801 2:65843913-65843935 CACGTTATTATTGAGAAGGCGGG - Intergenic
932446028 2:71782204-71782226 GGGGTTATTTCTGAGGTGGAAGG - Intergenic
934123251 2:88860942-88860964 GAGGTTTTTGTTGAGGGGAAAGG - Intergenic
934948326 2:98558267-98558289 GAGCTTATGAATGAGGAGGAAGG - Intronic
936260414 2:110955654-110955676 GAGGTGATGAGTGAGGGGGAGGG - Intronic
937050669 2:118885954-118885976 GAGGTTATGATTGAGCTGGATGG - Intergenic
937370084 2:121291237-121291259 GAGGTTCTTACTGAGGAAGATGG + Intergenic
939073175 2:137568188-137568210 GAGGTAATAATTGGGGAGGCGGG + Intronic
939132029 2:138246952-138246974 GTGGTTATTTTTGTTGAGGATGG + Intergenic
939132347 2:138251475-138251497 GTGGTTATTTTTGTTGAGGATGG - Intergenic
939279762 2:140047916-140047938 GTGGATATTTTTGAGGATGATGG + Intergenic
940387631 2:153091649-153091671 GAGGTGATTGTTTGGGAGGATGG - Intergenic
943737719 2:191375393-191375415 AAGCTTATAATTGAAGAGGAAGG + Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945577238 2:211547154-211547176 GATGTTATTATTGGGGAAAATGG + Intronic
947062865 2:226186219-226186241 AAGGTTATTATTGCAGAGAATGG + Intergenic
947955298 2:234184679-234184701 GAGGTTATAATGGATTAGGATGG + Intergenic
1171266626 20:23776473-23776495 GAGGAGAGTAGTGAGGAGGAGGG - Intergenic
1171276175 20:23858109-23858131 GAGGAGAGTAGTGAGGAGGAGGG - Intergenic
1175671476 20:60906827-60906849 GAGGCTAATAATGATGAGGATGG + Intergenic
1179512340 21:41881504-41881526 AAGGTTGTTATTGAGGAAAATGG + Intergenic
1180880720 22:19201820-19201842 ACGGTTTTTATTGAGGAGGAAGG - Intronic
1181933343 22:26420881-26420903 GTGGTTATTTCTGAGGAGGAAGG - Intergenic
1182574761 22:31265812-31265834 GATGTTATTATTGGGGAACAGGG - Intronic
950755711 3:15170259-15170281 GAGGTTTTCATTCAGGAGAAGGG - Intergenic
955684203 3:61533712-61533734 GAGGTTAGGATTGAGCAGGATGG + Intergenic
956476348 3:69624286-69624308 AATGTTATTATTGATGAGTAAGG - Intergenic
957006700 3:74956777-74956799 GATATTAGTATTGAGGAGGAAGG - Intergenic
957590367 3:82189384-82189406 GAGGGAATGATAGAGGAGGAGGG + Intergenic
958840182 3:99193972-99193994 AATGTTATTATTGAGAAGTAAGG - Intergenic
960236942 3:115294135-115294157 TACTTTATTATTGGGGAGGATGG + Intergenic
961416544 3:126763024-126763046 AAAGTAATTATTGAGAAGGAAGG + Intronic
961828009 3:129608557-129608579 GAGGATGTGAGTGAGGAGGAGGG - Intergenic
963043368 3:141084955-141084977 GGGGTTGTAATTGAGCAGGAAGG + Intronic
963650724 3:147976700-147976722 GAGGTTAGTGTGGAGGAGGATGG + Intergenic
963692493 3:148521834-148521856 GATGTTATTATTGATAAGTAAGG - Intergenic
964359249 3:155877494-155877516 GAGGTTTTTTTTTGGGAGGAGGG - Intronic
965344449 3:167530946-167530968 GAAGTTGGAATTGAGGAGGATGG - Intronic
966584128 3:181602514-181602536 AAGGTTATTATGTAAGAGGATGG + Intergenic
967175046 3:186855218-186855240 GAGGTTTTAATTCATGAGGAAGG - Exonic
968421080 4:485353-485375 GTGAATATTATTGTGGAGGAAGG - Intronic
970210809 4:13708079-13708101 GAGATTATTGATGAGGAGTATGG + Intergenic
974690824 4:65295565-65295587 GAGGTCATCATTGAAGAAGAAGG - Intergenic
975094930 4:70446572-70446594 GAGGTCATATTTGAGTAGGATGG - Intronic
977341722 4:95766569-95766591 AATGTTATTATTGAGAAGTAAGG - Intergenic
979204861 4:118026325-118026347 GATGCTATTATTGTAGAGGAAGG + Intergenic
980850190 4:138372302-138372324 GATGTTATTATTGATAAGTAAGG - Intergenic
981290064 4:143064442-143064464 GAGATTATAAGTGTGGAGGAGGG - Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
983151177 4:164283331-164283353 GTGTTTAATATTGAGGAGGGAGG - Intronic
986757303 5:10850099-10850121 GAGGGTATACTTGAGGAAGATGG + Intergenic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
989396106 5:40958525-40958547 GAGGTAATTACAGAGGATGAAGG - Intronic
989397623 5:40975166-40975188 GATGTTAATATTAAGGAAGATGG - Intronic
990810824 5:59720966-59720988 GAGGTTCTCATTTAGTAGGATGG + Intronic
993045196 5:82858521-82858543 GAGGGTATTGATGGGGAGGAAGG + Intergenic
993432808 5:87852640-87852662 GTAGTAATTATTGAGGAGAAAGG + Intergenic
997610613 5:135213197-135213219 TAGGTTGTTGCTGAGGAGGAAGG + Intronic
997764001 5:136480943-136480965 GAGGTGGTTATGGAAGAGGAAGG + Intergenic
997839485 5:137226108-137226130 GAGATGATAATTGAGCAGGATGG - Intronic
998734300 5:145117949-145117971 GATGTTATTATTAAGAAGCAGGG - Intergenic
999037767 5:148372875-148372897 GGAGTAATTATTTAGGAGGAGGG - Intergenic
999441400 5:151603896-151603918 GAGGTGAGGATTGAGGAGAAGGG - Intergenic
1001349101 5:170939277-170939299 AAGGTTATTTTCGAGGAAGAAGG + Intronic
1002164489 5:177336028-177336050 GAGCTTACAATTGAGCAGGAGGG + Intronic
1003377672 6:5594572-5594594 GAGGTTATCATGGAGGTAGATGG + Intronic
1003994364 6:11523823-11523845 GAGGTTATAATGGAGAAGGGTGG + Intergenic
1005403727 6:25463043-25463065 AAAGTTATTCATGAGGAGGATGG - Intronic
1006957666 6:37889460-37889482 GATTTTATTAGTGAGAAGGATGG + Intronic
1008835397 6:55821239-55821261 GAGATTATTATGGAGGATGAAGG - Intronic
1009663393 6:66644954-66644976 AAGGTGATTATTGAGAAGTAAGG + Intergenic
1010567397 6:77432376-77432398 TAGGTTATTTTTTAAGAGGATGG - Intergenic
1010622554 6:78094056-78094078 GAGGATATTATTGGGGAGGTTGG + Intergenic
1011337542 6:86277743-86277765 GAGGATATTATTCAGGGAGAAGG - Intergenic
1012679169 6:102156568-102156590 AATGTTATTATTGATGAGTAAGG - Intergenic
1013251057 6:108333782-108333804 GTGGCTAATACTGAGGAGGAAGG + Intronic
1013998644 6:116339712-116339734 GAGTTTATAGTTGAGGAAGAAGG + Intronic
1014379139 6:120716814-120716836 GATGTTATTATTGATAAGTAAGG - Intergenic
1014959090 6:127660030-127660052 GAAGTTAGTATTAATGAGGATGG + Intergenic
1014960965 6:127684144-127684166 AAGGTTATTATTGATGAGTAAGG - Intergenic
1015118945 6:129680469-129680491 GAGGTTATTATTGAGGAGGAAGG - Intronic
1015862509 6:137695704-137695726 GAGAGTTTTATTTAGGAGGAGGG - Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1017318883 6:153064944-153064966 GATGTTATTATTGATAAGTAAGG - Intronic
1017790225 6:157791562-157791584 GAAGTATTTGTTGAGGAGGATGG - Intronic
1018346443 6:162904102-162904124 GAGGTTCTGAAGGAGGAGGAAGG - Intronic
1020199860 7:6071277-6071299 GAGGTGTTTGTTGAGGAGAACGG - Intergenic
1021114241 7:16730549-16730571 GAGGTTATAATGGAGTAGGATGG + Intergenic
1021455086 7:20821192-20821214 GATGTTATTATTTATGAGGTAGG + Intergenic
1022312710 7:29212281-29212303 CATGTTAGTATTGAGGAAGAGGG - Intronic
1023727469 7:43158963-43158985 GAGGTTCTGATTGAGTAGGTGGG + Intronic
1023784933 7:43696732-43696754 GTGGTTATTTCTGAGCAGGAAGG + Intronic
1025617287 7:63132037-63132059 AAGGTTATTATTGATAAGTAAGG - Intergenic
1025923978 7:65941583-65941605 GTGGTTATTCTGGGGGAGGAAGG + Intronic
1028299339 7:89178268-89178290 GAGGTTATTATCGATAAGCAAGG + Intronic
1034008088 7:147496954-147496976 GAGGAGATTATTTAGGTGGATGG - Intronic
1035349019 7:158230814-158230836 AATGTTATTATTGATGAGTAAGG - Intronic
1037397575 8:18459233-18459255 GAGGTGATTTTTGAGGTGTAGGG - Intergenic
1039248552 8:35635967-35635989 GAGGAAACTATTGAGGAAGAAGG + Intronic
1040031458 8:42827945-42827967 AAAGTAATTATTGATGAGGAGGG + Intergenic
1041828327 8:62123635-62123657 GAGGTCATCCTTGAGTAGGATGG - Intergenic
1042564678 8:70100136-70100158 GAGGTGATTGCTGAGGATGAGGG - Intergenic
1043245184 8:77990403-77990425 GAGGTTATTCTGGGGTAGGATGG + Intergenic
1044527233 8:93265671-93265693 TGGGTTATTATTAAGGAGAAAGG - Intergenic
1044945820 8:97388307-97388329 GAGGCTGTGATTGAGGGGGATGG - Intergenic
1045733600 8:105269010-105269032 AATGTTATTATTGATGTGGATGG + Intronic
1046145148 8:110148524-110148546 GAGGTTACAATGGAGGTGGAAGG - Intergenic
1047020925 8:120774412-120774434 GAGCTTTTTAAGGAGGAGGATGG + Intronic
1047775176 8:128064425-128064447 GAGGCAATTAGGGAGGAGGAAGG - Intergenic
1050953276 9:11624534-11624556 TTGGTTATCATTGAGGAGTAGGG - Intergenic
1051261989 9:15273637-15273659 GTGGTCTTCATTGAGGAGGAAGG - Intronic
1051598771 9:18851334-18851356 GAATTTATGATCGAGGAGGAAGG + Intronic
1052731646 9:32292660-32292682 GAAGATATTTTTGAGGAAGAAGG - Intergenic
1053242575 9:36508110-36508132 GTGGCTATTATTGAGGGGGTAGG + Intergenic
1053503911 9:38623573-38623595 GAGTTAATTTTTGAGGAGCAAGG + Intergenic
1054964431 9:71006331-71006353 AAGGTTATTATTGATAAGTACGG - Intronic
1055084625 9:72301337-72301359 GAGCTGATTATTGAAGAGTATGG + Intergenic
1055693835 9:78861544-78861566 CAGGTGATTTTTGGGGAGGAAGG - Intergenic
1055761840 9:79617226-79617248 CAGGTTATCTTTCAGGAGGAAGG + Intronic
1057270361 9:93646914-93646936 GGGGTTCTTACTGAGGAGGAGGG + Intronic
1057395983 9:94680805-94680827 GAGGTTATACTGGAGGAGGGAGG + Intergenic
1057920072 9:99090037-99090059 GAGGTTAGTTTTAGGGAGGAAGG + Intergenic
1058836943 9:108865595-108865617 GAGGGTCTTAATGAAGAGGAGGG + Intergenic
1058864461 9:109148833-109148855 AATGTTCTTATTGAGGAAGATGG - Intronic
1059874796 9:118622305-118622327 GAATTTATTTTTAAGGAGGAGGG - Intergenic
1060096119 9:120792256-120792278 CAGGTTCTGATAGAGGAGGAGGG - Intronic
1186301548 X:8204935-8204957 GAGGTGATTAGTGGGGAGCAGGG + Intergenic
1186902200 X:14068691-14068713 GAGGTTATACTGGAGTAGGATGG - Intergenic
1187096670 X:16156035-16156057 GAGCTTGTTAATGAGGCGGAAGG - Intergenic
1187316422 X:18199533-18199555 GATGTTATCATTGAGGAAAATGG + Intronic
1187674060 X:21698256-21698278 GGATTTATTATTGAGGAAGAAGG + Intergenic
1188501473 X:30831582-30831604 GAGGTTAGGATTAAGGGGGAGGG + Intronic
1188603011 X:31992630-31992652 TAGGTTATTTTAGTGGAGGAAGG - Intronic
1189079196 X:37951891-37951913 GATCATATTCTTGAGGAGGATGG + Intronic
1191811575 X:65195160-65195182 GATGTTATTATTGATGAGTAAGG + Intergenic
1192139245 X:68633546-68633568 GAGCTTAGTAGTGAGGAGAAAGG + Intergenic
1192271906 X:69588803-69588825 GGGGTTACTATTGAGGAGGAAGG - Intergenic
1193182668 X:78477111-78477133 GAGGTTAAAATGGAGTAGGATGG - Intergenic
1195958133 X:110356066-110356088 GAGGTTAGTGGGGAGGAGGAGGG + Intronic
1196537151 X:116860368-116860390 AATGTTATTATTGATAAGGAAGG + Intergenic
1197068468 X:122264496-122264518 AATGTTATTATTGATGAGTAAGG + Intergenic
1198027404 X:132720560-132720582 AATGTTATTATTGATGAGTAAGG - Intronic
1198775897 X:140178674-140178696 GCAGTAATTAATGAGGAGGATGG + Intergenic
1199997953 X:153038477-153038499 GAGGTTATAGTTGAGGGTGAGGG + Intergenic
1201733553 Y:17232111-17232133 GGGGTTATTATTGTGGGGAAAGG - Intergenic
1201759076 Y:17518501-17518523 GAGGGTATTAGCGAGGGGGAGGG + Intergenic
1201842479 Y:18387489-18387511 GAGGGTATTAGCGAGGGGGAGGG - Intergenic
1202535859 Y:25871622-25871644 GAGTTTATTACTGAGGAATATGG + Intergenic