ID: 1015123374

View in Genome Browser
Species Human (GRCh38)
Location 6:129725414-129725436
Sequence AAGGATAAACAGATGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015123374_1015123376 -6 Left 1015123374 6:129725414-129725436 CCTGGATTCATCTGTTTATCCTT No data
Right 1015123376 6:129725431-129725453 ATCCTTTGTCACCTTTAGGAAGG No data
1015123374_1015123379 14 Left 1015123374 6:129725414-129725436 CCTGGATTCATCTGTTTATCCTT No data
Right 1015123379 6:129725451-129725473 AGGTTTGTCACCTTTCCGACTGG No data
1015123374_1015123375 -10 Left 1015123374 6:129725414-129725436 CCTGGATTCATCTGTTTATCCTT No data
Right 1015123375 6:129725427-129725449 GTTTATCCTTTGTCACCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015123374 Original CRISPR AAGGATAAACAGATGAATCC AGG (reversed) Intergenic
No off target data available for this crispr