ID: 1015128185

View in Genome Browser
Species Human (GRCh38)
Location 6:129777706-129777728
Sequence CACAGCAAAGGCTTTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015128179_1015128185 22 Left 1015128179 6:129777661-129777683 CCACTTATAGCTTATCTCTGCAT No data
Right 1015128185 6:129777706-129777728 CACAGCAAAGGCTTTGGGAATGG No data
1015128176_1015128185 25 Left 1015128176 6:129777658-129777680 CCCCCACTTATAGCTTATCTCTG No data
Right 1015128185 6:129777706-129777728 CACAGCAAAGGCTTTGGGAATGG No data
1015128177_1015128185 24 Left 1015128177 6:129777659-129777681 CCCCACTTATAGCTTATCTCTGC No data
Right 1015128185 6:129777706-129777728 CACAGCAAAGGCTTTGGGAATGG No data
1015128178_1015128185 23 Left 1015128178 6:129777660-129777682 CCCACTTATAGCTTATCTCTGCA No data
Right 1015128185 6:129777706-129777728 CACAGCAAAGGCTTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015128185 Original CRISPR CACAGCAAAGGCTTTGGGAA TGG Intergenic