ID: 1015134242

View in Genome Browser
Species Human (GRCh38)
Location 6:129849890-129849912
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015134237_1015134242 19 Left 1015134237 6:129849848-129849870 CCAGCAGAGAATGGGTGGGTTAT No data
Right 1015134242 6:129849890-129849912 TCCGTGCACGTGTGTGAAGGGGG 0: 1
1: 1
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type