ID: 1015141597

View in Genome Browser
Species Human (GRCh38)
Location 6:129940489-129940511
Sequence GTGCAGACCATTATTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015141597_1015141598 -7 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141598 6:129940505-129940527 TCTGCACTACTTGAGCTTTAAGG No data
1015141597_1015141601 0 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141601 6:129940512-129940534 TACTTGAGCTTTAAGGAGAGGGG No data
1015141597_1015141599 -2 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141599 6:129940510-129940532 ACTACTTGAGCTTTAAGGAGAGG No data
1015141597_1015141603 22 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141603 6:129940534-129940556 GAGCAGCAGGCACAAGCAGAAGG No data
1015141597_1015141602 9 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141602 6:129940521-129940543 TTTAAGGAGAGGGGAGCAGCAGG No data
1015141597_1015141600 -1 Left 1015141597 6:129940489-129940511 CCTGCTCTAATAATGGTCTGCAC No data
Right 1015141600 6:129940511-129940533 CTACTTGAGCTTTAAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015141597 Original CRISPR GTGCAGACCATTATTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr