ID: 1015142911

View in Genome Browser
Species Human (GRCh38)
Location 6:129955819-129955841
Sequence TCTGGCTCACTGAAGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015142903_1015142911 23 Left 1015142903 6:129955773-129955795 CCTTCTGGTGAGTGTTCTATGAT No data
Right 1015142911 6:129955819-129955841 TCTGGCTCACTGAAGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015142911 Original CRISPR TCTGGCTCACTGAAGGCCTG AGG Intergenic
No off target data available for this crispr