ID: 1015144260

View in Genome Browser
Species Human (GRCh38)
Location 6:129967984-129968006
Sequence GAAAACTGCCAGGGTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015144260_1015144267 27 Left 1015144260 6:129967984-129968006 CCTATGGGACCCTGGCAGTTTTC No data
Right 1015144267 6:129968034-129968056 AGAGTTTGCAAGGTGTACCTTGG No data
1015144260_1015144265 -2 Left 1015144260 6:129967984-129968006 CCTATGGGACCCTGGCAGTTTTC No data
Right 1015144265 6:129968005-129968027 TCTCAGAGGAGGTGAAAGTCTGG No data
1015144260_1015144268 28 Left 1015144260 6:129967984-129968006 CCTATGGGACCCTGGCAGTTTTC No data
Right 1015144268 6:129968035-129968057 GAGTTTGCAAGGTGTACCTTGGG No data
1015144260_1015144266 17 Left 1015144260 6:129967984-129968006 CCTATGGGACCCTGGCAGTTTTC No data
Right 1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015144260 Original CRISPR GAAAACTGCCAGGGTCCCAT AGG (reversed) Intergenic
No off target data available for this crispr