ID: 1015144262

View in Genome Browser
Species Human (GRCh38)
Location 6:129967993-129968015
Sequence CTCCTCTGAGAAAACTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015144262_1015144270 25 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144270 6:129968041-129968063 GCAAGGTGTACCTTGGGAGGAGG No data
1015144262_1015144267 18 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144267 6:129968034-129968056 AGAGTTTGCAAGGTGTACCTTGG No data
1015144262_1015144266 8 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG No data
1015144262_1015144268 19 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144268 6:129968035-129968057 GAGTTTGCAAGGTGTACCTTGGG No data
1015144262_1015144271 26 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144271 6:129968042-129968064 CAAGGTGTACCTTGGGAGGAGGG No data
1015144262_1015144269 22 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144269 6:129968038-129968060 TTTGCAAGGTGTACCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015144262 Original CRISPR CTCCTCTGAGAAAACTGCCA GGG (reversed) Intergenic
No off target data available for this crispr