ID: 1015144267

View in Genome Browser
Species Human (GRCh38)
Location 6:129968034-129968056
Sequence AGAGTTTGCAAGGTGTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015144260_1015144267 27 Left 1015144260 6:129967984-129968006 CCTATGGGACCCTGGCAGTTTTC No data
Right 1015144267 6:129968034-129968056 AGAGTTTGCAAGGTGTACCTTGG No data
1015144263_1015144267 17 Left 1015144263 6:129967994-129968016 CCTGGCAGTTTTCTCAGAGGAGG No data
Right 1015144267 6:129968034-129968056 AGAGTTTGCAAGGTGTACCTTGG No data
1015144262_1015144267 18 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144267 6:129968034-129968056 AGAGTTTGCAAGGTGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015144267 Original CRISPR AGAGTTTGCAAGGTGTACCT TGG Intergenic
No off target data available for this crispr