ID: 1015144269

View in Genome Browser
Species Human (GRCh38)
Location 6:129968038-129968060
Sequence TTTGCAAGGTGTACCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015144263_1015144269 21 Left 1015144263 6:129967994-129968016 CCTGGCAGTTTTCTCAGAGGAGG No data
Right 1015144269 6:129968038-129968060 TTTGCAAGGTGTACCTTGGGAGG No data
1015144262_1015144269 22 Left 1015144262 6:129967993-129968015 CCCTGGCAGTTTTCTCAGAGGAG No data
Right 1015144269 6:129968038-129968060 TTTGCAAGGTGTACCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015144269 Original CRISPR TTTGCAAGGTGTACCTTGGG AGG Intergenic
No off target data available for this crispr