ID: 1015144270 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:129968041-129968063 |
Sequence | GCAAGGTGTACCTTGGGAGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1015144262_1015144270 | 25 | Left | 1015144262 | 6:129967993-129968015 | CCCTGGCAGTTTTCTCAGAGGAG | No data | ||
Right | 1015144270 | 6:129968041-129968063 | GCAAGGTGTACCTTGGGAGGAGG | No data | ||||
1015144263_1015144270 | 24 | Left | 1015144263 | 6:129967994-129968016 | CCTGGCAGTTTTCTCAGAGGAGG | No data | ||
Right | 1015144270 | 6:129968041-129968063 | GCAAGGTGTACCTTGGGAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1015144270 | Original CRISPR | GCAAGGTGTACCTTGGGAGG AGG | Intergenic | ||
No off target data available for this crispr |