ID: 1015148584

View in Genome Browser
Species Human (GRCh38)
Location 6:130015196-130015218
Sequence ATTTGTGAAGGGCTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015148580_1015148584 -9 Left 1015148580 6:130015182-130015204 CCTGGGCACTTTCAATTTGTGAA 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG No data
1015148577_1015148584 11 Left 1015148577 6:130015162-130015184 CCAGTCTCTTGGACTTCACTCCT 0: 1
1: 0
2: 0
3: 28
4: 273
Right 1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015148584 Original CRISPR ATTTGTGAAGGGCTGGCTCA TGG Intronic
No off target data available for this crispr