ID: 1015149080

View in Genome Browser
Species Human (GRCh38)
Location 6:130019254-130019276
Sequence GCGCCGCGGAGCCGCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 2, 1: 0, 2: 2, 3: 39, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015149071_1015149080 8 Left 1015149071 6:130019223-130019245 CCGGGCTCCACCGGGGTGCGTGT 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG 0: 2
1: 0
2: 2
3: 39
4: 284
1015149077_1015149080 -2 Left 1015149077 6:130019233-130019255 CCGGGGTGCGTGTCCGGGTGGGC 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG 0: 2
1: 0
2: 2
3: 39
4: 284
1015149074_1015149080 1 Left 1015149074 6:130019230-130019252 CCACCGGGGTGCGTGTCCGGGTG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG 0: 2
1: 0
2: 2
3: 39
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015149080 Original CRISPR GCGCCGCGGAGCCGCAGCCC AGG Intronic
900090558 1:918528-918550 TGGCCGGGGAGCAGCAGCCCAGG - Intergenic
900093546 1:930921-930943 GCCCCGCTGGGCCACAGCCCTGG - Intronic
900096431 1:941933-941955 GCGGCGCGGAGGCGCTGACCCGG - Intronic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900176432 1:1293422-1293444 GGGCCGCGGCGCCCCAGCACTGG + Exonic
900393556 1:2444026-2444048 GCGCGGGGGCGCCGCAGCCCTGG + Intronic
900495716 1:2975137-2975159 GCTCCTCGGAGCCGGAGACCAGG + Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
901064013 1:6486153-6486175 CCGCCTCGGAGCCTCAGCCCAGG + Intronic
902044275 1:13513557-13513579 GCGCCGCGGCGGCGCAGGCTGGG + Exonic
902617727 1:17632971-17632993 GTGCCTGGGAGCCGGAGCCCTGG + Intronic
903764577 1:25725888-25725910 GTACCGCTGAGCCTCAGCCCAGG - Intronic
904033598 1:27547792-27547814 GGGCCACGCAGCTGCAGCCCAGG - Exonic
904199878 1:28812630-28812652 GCGCCGCAGGGCTGGAGCCCGGG + Intronic
905548576 1:38818392-38818414 CCGCCGCGCAGCCGCGGACCCGG - Intergenic
906204340 1:43979202-43979224 GCGCCTCGGAGGGGCAGGCCCGG - Intronic
907386010 1:54125714-54125736 GCTCTGCGGAGCGGCAGCCAGGG + Intergenic
908561326 1:65309557-65309579 GCGAGGCGAAGCCGCCGCCCTGG - Exonic
909134147 1:71775948-71775970 GCGCCACTGAGCTGCAGCCTGGG + Intronic
909392903 1:75136349-75136371 GCGCCGGAGACCCGGAGCCCGGG + Intronic
910408412 1:86914628-86914650 GGGCGGCGCAGCCGCAGCGCCGG + Intronic
910935090 1:92480824-92480846 GCGCCAGGGAGCTGCAGCGCAGG - Exonic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
914702781 1:150149824-150149846 GAATCGCGGAGCCGCAGCTCGGG - Intronic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
915247684 1:154568050-154568072 GCGCCACGGGGCCGCAGCGCCGG - Exonic
915345472 1:155194935-155194957 GCGGCGCGGAGCCGTCGCCATGG - Intergenic
917755623 1:178094518-178094540 GAGCCGCGGAGGCGCTGTCCTGG + Exonic
919724475 1:200873050-200873072 GAGCCCTGGAGCCCCAGCCCGGG + Exonic
919830867 1:201539305-201539327 GCGGCGCGGACCCGGAGCCCGGG + Intergenic
921060146 1:211578609-211578631 GGGCCCCGCAGCCGCAGCCATGG - Exonic
921355608 1:214281573-214281595 GCAGCGCGGGGCCGCAGCGCGGG - Intronic
923056008 1:230426261-230426283 GCGCCGAGGAGACGCAGCGGCGG - Intergenic
1063418204 10:5890185-5890207 GCTCCGCCCCGCCGCAGCCCCGG - Intronic
1064208840 10:13347422-13347444 CCGCCGCCGGCCCGCAGCCCGGG - Intronic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065533634 10:26697760-26697782 GCGGCGCGGAGCCCCGGGCCCGG + Exonic
1066220672 10:33334804-33334826 GAGCCGCGGAGCTGGCGCCCAGG + Exonic
1069620989 10:69837068-69837090 GCACCCTGGAGCCGGAGCCCTGG - Intronic
1070592716 10:77812013-77812035 GCGCCACGGAGCAGCAGGCGCGG - Exonic
1070786868 10:79166987-79167009 GCACGGTGGAGCCGCAGCCCAGG - Intronic
1072151807 10:92690097-92690119 GCGCGGCGGGCCCGCGGCCCAGG - Exonic
1072241168 10:93496726-93496748 GCGGCCAGGACCCGCAGCCCCGG + Exonic
1073099603 10:100999789-100999811 GCGCCGCGGAGGCGGAGGCGGGG + Exonic
1073363556 10:102918850-102918872 GAGCGGCGGCGCCACAGCCCGGG + Exonic
1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG + Intergenic
1074865683 10:117543242-117543264 GCGCCGAGGAGCGGGCGCCCTGG - Exonic
1075640971 10:124064475-124064497 GCGCAGCGTAGGCACAGCCCTGG + Intronic
1076529634 10:131135894-131135916 GGGCGGAGGAGCCACAGCCCGGG + Intronic
1076892785 10:133292933-133292955 GGGCCGTGGAGCAGCTGCCCAGG - Intronic
1076945024 10:133640708-133640730 GGCCGGCGGAGCCACAGCCCCGG - Intergenic
1077107950 11:849976-849998 GCGCCCCGCACCCGCCGCCCCGG - Intronic
1077214692 11:1390457-1390479 CGGCCGCGAAGCCGCAGGCCCGG + Intronic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082986154 11:59172566-59172588 GCCGCGCAGCGCCGCAGCCCCGG + Exonic
1083635283 11:64117516-64117538 GAGTCGGGGAGGCGCAGCCCTGG - Exonic
1083668034 11:64285858-64285880 GAGCCGGGGAGCCGGAGCCCCGG + Intronic
1083669496 11:64292137-64292159 GCGGCGCGGCGCTGCAGCCTCGG + Intronic
1084554649 11:69868590-69868612 CCGCCGCGGAGCCCCCACCCCGG + Intergenic
1084791468 11:71477744-71477766 CAGAGGCGGAGCCGCAGCCCCGG - Intronic
1089687970 11:120169084-120169106 GCGCCGAGGGGGCGCAGCCGGGG + Exonic
1089796567 11:120985983-120986005 GCGCCGCAGTCCCGCCGCCCCGG + Exonic
1090716633 11:129437119-129437141 GGGCCGTGGAGCCACAGCACTGG + Intronic
1090788529 11:130070189-130070211 CCGCCGCAGAGCCGGACCCCCGG - Intronic
1090835450 11:130450200-130450222 GCGCCGAGGGGCCGGAACCCAGG + Intronic
1091718429 12:2795588-2795610 GGGCACCCGAGCCGCAGCCCGGG + Intronic
1094460845 12:30695651-30695673 GGGCCGCGGAGCCCCCACCCGGG - Exonic
1094564892 12:31590677-31590699 GCTCAGCGCCGCCGCAGCCCTGG + Intronic
1095603071 12:44037045-44037067 GCTCCATGGAGCTGCAGCCCTGG - Intronic
1098161189 12:67649194-67649216 GTGCCGCCGCGCCGCATCCCCGG + Intronic
1098828537 12:75330312-75330334 GCGCCGCGGAGCCGGTTCCCTGG - Intronic
1102256430 12:111418198-111418220 GCCCCGCGGGGCCGCCGCCGGGG - Exonic
1102853884 12:116277288-116277310 GCGCCGCGGCGACGCCGCGCCGG + Exonic
1104008880 12:124915017-124915039 GGGCCGCGGAGCCGCGGCTAAGG - Exonic
1104865259 12:131949866-131949888 GCGCCGCGGAAGCGCAGCTACGG + Intergenic
1104865325 12:131950102-131950124 GGGTCGCGTAGCCGCAGCCGCGG + Intronic
1104985424 12:132593821-132593843 GCGCTGCGGAGCATCTGCCCTGG + Intergenic
1105538999 13:21298294-21298316 GCGCCGCAGAGCCGCTGCTCTGG - Intergenic
1106057725 13:26254312-26254334 GAGCGGCGGAGCCGGCGCCCAGG + Exonic
1107481494 13:40789509-40789531 GCTTCGCGGGGCCGCAGTCCGGG + Exonic
1109562862 13:64075900-64075922 TGGCCACCGAGCCGCAGCCCTGG - Intergenic
1112353447 13:98655292-98655314 GCCCCCTGGAGCCACAGCCCTGG - Intergenic
1113695729 13:112343879-112343901 GCGCTGAAGGGCCGCAGCCCTGG - Intergenic
1113765280 13:112877236-112877258 GGGCCGCGGAGTCTCAGCCAGGG - Intronic
1113775600 13:112943383-112943405 GCGGCGCGGAGCCGGGGACCGGG - Intronic
1114046580 14:18881276-18881298 GGGCTGCGGAGGCTCAGCCCTGG + Intergenic
1115398258 14:32933376-32933398 GGGCCCCGCAGCCGCAGCCAGGG - Intergenic
1115850734 14:37588144-37588166 GGGGCGCGGCGCCCCAGCCCGGG + Intergenic
1116817889 14:49599863-49599885 ACGCCGCGGGGCCGCCCCCCCGG - Intronic
1118947201 14:70399027-70399049 CCTCCGCGGGGCCGCATCCCCGG - Intronic
1121074926 14:91060231-91060253 GGGGCGCGGGGCCGCAGCCGTGG - Intronic
1121137188 14:91509844-91509866 GCGCCGGGGAGCCGGAGGCGAGG - Exonic
1121352415 14:93184458-93184480 GCGCCGCAGTGCGGCTGCCCTGG - Intronic
1121616973 14:95319888-95319910 GCGCCGCGGAGCTGGAGTCGCGG + Exonic
1121622543 14:95360523-95360545 GCGCTGAGGAGCTGCGGCCCAGG - Intergenic
1122624231 14:103075886-103075908 GCGCCCCGCAGCCGCGCCCCGGG + Intergenic
1122658611 14:103279421-103279443 GCACCGCGGAGCCGTCGCCGTGG - Intergenic
1123558054 15:21452483-21452505 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1123594282 15:21889764-21889786 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1124118447 15:26868040-26868062 GCACTGCGGAGCCGCAGCCTGGG - Intronic
1124370757 15:29103603-29103625 GCCCCGCGGAGCCGGCTCCCCGG + Intronic
1124922325 15:34038944-34038966 GCGGCCCGGAGCCGCAGCGGCGG - Exonic
1125541190 15:40471036-40471058 CCGCTTCGGCGCCGCAGCCCGGG + Exonic
1125589140 15:40843919-40843941 GCCCCGCGGCCCCGCAGCCCCGG - Intergenic
1126736691 15:51737758-51737780 GAGGCGGGGAGCCGCAGGCCGGG + Exonic
1128300062 15:66561040-66561062 GTGCCGCGGAGCTTCAGGCCCGG + Exonic
1128731422 15:70024008-70024030 GAGCCGCTGAGGGGCAGCCCCGG - Intergenic
1129503197 15:76059775-76059797 GCGCCGCCGTTCCGCAGCCTCGG + Intronic
1130411612 15:83653427-83653449 GCGCGGAGGAGGCGCAGGCCAGG + Intergenic
1130517143 15:84634080-84634102 GCGGCGCGGGGCCGGAGTCCTGG - Intergenic
1130908766 15:88257037-88257059 GCGCCCGCTAGCCGCAGCCCGGG + Intergenic
1131144049 15:90000471-90000493 GCGCCCCGGGGCCGAGGCCCAGG + Intergenic
1202966404 15_KI270727v1_random:179655-179677 GCCCTGCGGCGCCGCAGCCTGGG - Intergenic
1132500070 16:281164-281186 GCGGCGCAGAGCCTGAGCCCAGG + Intronic
1132585806 16:705395-705417 GGGCCGCGCCGCCGCCGCCCGGG - Intronic
1132799923 16:1746961-1746983 CCACGGCGGAGCCGCAGGCCAGG + Intronic
1132815867 16:1826373-1826395 GCGCCTCAGAGCCGCGCCCCAGG + Intronic
1133010997 16:2911842-2911864 GCGGCGCCGAGCCGCAGGCCTGG - Intergenic
1133188375 16:4116095-4116117 GCTCCGCGCACTCGCAGCCCGGG - Exonic
1133770789 16:8866489-8866511 GCGCAGCTGAGCCCCAGCCTGGG + Intronic
1133784441 16:8963617-8963639 GGCCCGCGGCCCCGCAGCCCCGG - Intronic
1133802132 16:9092386-9092408 GGGCCGCGGAGCCACCGGCCGGG - Intronic
1135712601 16:24730071-24730093 GCGCCGCGGGACCGCAGTCCGGG + Intronic
1136554774 16:31001378-31001400 CCACCGCCCAGCCGCAGCCCCGG - Intronic
1139364817 16:66427009-66427031 GCACCGCGGCGCCGCGGCCCGGG - Intergenic
1139364822 16:66427020-66427042 GCGCCGCGGTGCTGAGGCCCGGG + Intergenic
1139804224 16:69550380-69550402 GCGCCGCTGAACCCCAGCCTAGG - Intergenic
1139907398 16:70376087-70376109 GCACCGTGGAGACGCAGCCCAGG + Exonic
1139908437 16:70381873-70381895 GCGCAGCGGAGCGTCACCCCAGG + Intronic
1139922154 16:70467272-70467294 GTGCCCAGGTGCCGCAGCCCTGG + Intronic
1141760429 16:86025523-86025545 GGGCCGCAAAGCCTCAGCCCTGG - Intergenic
1142133229 16:88440354-88440376 GGGCTGCAGAGCCGCTGCCCTGG + Exonic
1142490283 17:274217-274239 GCACCGCGAAACCCCAGCCCGGG + Intronic
1142683373 17:1562765-1562787 GCGCTGCGGAACCGGAGCTCCGG - Exonic
1142860067 17:2755864-2755886 GGGCCCCGCAGCCTCAGCCCGGG - Intergenic
1143118854 17:4595261-4595283 GCACCTCGGAGGCGCAGGCCCGG + Exonic
1143885217 17:10060167-10060189 GCGCCGAGGAGAAGCAGCCCTGG + Intronic
1144109737 17:12020631-12020653 GCCCCGCGGGCCCGCAGCCCTGG + Intergenic
1144339750 17:14301693-14301715 GAGCCCAGGAGCAGCAGCCCCGG - Exonic
1144515946 17:15917664-15917686 CCGGCGCGGAGCCGCAGCCTGGG - Intergenic
1144853430 17:18255475-18255497 GTGCCCCGGAGCCCCAGCACAGG + Intronic
1146398592 17:32487098-32487120 GCGCCGCGGCCCCGCCGCCGCGG - Exonic
1147139586 17:38453783-38453805 GCCCCCCGGAGCCGCGGGCCCGG - Intronic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148744470 17:49910608-49910630 GCGCCGCTGGGCCGGAGCTCGGG - Intergenic
1149296267 17:55265005-55265027 GCTCCGCGGCCCCGCAGCGCCGG - Exonic
1150002915 17:61452477-61452499 GCGGCGCGGAGTCGGAGCCCCGG + Intronic
1150137676 17:62704400-62704422 GAGCCCGGGAGCCCCAGCCCGGG - Intronic
1150520302 17:65859970-65859992 GCGCCACGGCACTGCAGCCCAGG + Intronic
1152218539 17:79048389-79048411 GAGCCGCGGTGCCGCACCCTGGG - Exonic
1152242489 17:79167774-79167796 GCACCCCGGAGCCGGAGCACGGG + Intronic
1152728664 17:81959724-81959746 GCGCGGCGGGTCGGCAGCCCTGG - Intronic
1152885479 17:82846688-82846710 TCACCTCGGAGCAGCAGCCCAGG + Intronic
1153565648 18:6414879-6414901 GGGCAGCGGCGCCGCAGCCTGGG - Intronic
1155209231 18:23586565-23586587 TCGCGGCGGCGCCCCAGCCCGGG - Exonic
1155500151 18:26479583-26479605 GGGCCGCGGAGGCACAGGCCTGG + Intronic
1157123779 18:44936276-44936298 GTGCCGAGGACCCGCTGCCCCGG - Intronic
1158505662 18:58044359-58044381 GCGCGGCGGCGGCGCAGACCCGG - Exonic
1160691055 19:460846-460868 CCGCCGCCGGGCCGCGGCCCAGG + Exonic
1160804115 19:984264-984286 GGGCCGCGGGGCCGCCGCTCTGG + Exonic
1160900495 19:1425594-1425616 GTGACACGGAGCCCCAGCCCGGG + Intronic
1160935565 19:1592879-1592901 GCGCCGCGGCTGCGCAGCGCGGG - Intergenic
1161054356 19:2182556-2182578 GCCCCGGGAAGCCACAGCCCTGG - Intronic
1161984588 19:7646618-7646640 GTGCCCCTGAGCCCCAGCCCTGG + Intronic
1163018831 19:14472231-14472253 TCCCAGCGGAGCCCCAGCCCCGG + Intergenic
1163020042 19:14476981-14477003 GAGTCGGGGAGCCGCAGTCCTGG - Intergenic
1163306450 19:16482621-16482643 GGGCAGCGGAGGGGCAGCCCTGG + Intronic
1163426911 19:17245225-17245247 GCGCCCCGGCCCCGCTGCCCTGG - Exonic
1163443649 19:17334296-17334318 CCGCCGCGATCCCGCAGCCCGGG + Intronic
1163777121 19:19225167-19225189 GCGCTGCGGGGGCCCAGCCCCGG + Exonic
1164958237 19:32405378-32405400 CCACCGCGGAGCCGCTGCTCCGG + Intergenic
1165066824 19:33234387-33234409 GTACCTCGGAGCAGCAGCCCTGG - Intergenic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165305199 19:34999405-34999427 GCGCTGGGGAGCCACAGCCCCGG + Intronic
1166938141 19:46347288-46347310 GCAACGCGGAGCTGCAGCCTGGG + Intronic
1167042742 19:47032285-47032307 CCGCCGCGGCCCCGCAGCGCTGG + Exonic
1167288304 19:48611209-48611231 GCGCCCCTGAGCTGCAGCCTGGG - Intronic
1168286995 19:55340107-55340129 GTGCCGCGGAGCCCGAGGCCCGG - Intronic
1168328251 19:55549802-55549824 GGGCCACAGAGCCGCAGCCAGGG + Intergenic
1168676221 19:58279599-58279621 GCACCGCGGAGCCCCTGCCCTGG + Exonic
926095801 2:10080133-10080155 GGGGCCCGGAGCGGCAGCCCTGG - Exonic
926152432 2:10432574-10432596 CCGACCCGGAGCCGGAGCCCAGG - Intergenic
927212638 2:20648067-20648089 GGGCCTCGGAGCCGCTGCCCTGG - Intronic
927472233 2:23385295-23385317 GCGCTGCGGAGCCGGGGCCGGGG - Exonic
927702445 2:25276894-25276916 ACGCCGCGGGTCCTCAGCCCGGG + Intronic
927809400 2:26173191-26173213 GCGCCCCGGGGCCGCCGTCCCGG - Exonic
927904525 2:26847659-26847681 GGGCAGCGCGGCCGCAGCCCGGG + Intergenic
929966879 2:46542919-46542941 GCGCCGCAGGGCCGCCCCCCCGG - Exonic
930096781 2:47571482-47571504 GCGCATCGGTGCCGCAGCCGCGG + Intergenic
930753970 2:54957718-54957740 GGCCGGGGGAGCCGCAGCCCAGG - Intronic
932106077 2:68944064-68944086 GCACTCCGGAGCCACAGCCCTGG + Intergenic
932313991 2:70767740-70767762 GCGCGTCGGTGCTGCAGCCCTGG - Intronic
946422244 2:219571401-219571423 CCGCCGCAGAGCTGCAGCTCGGG - Intronic
948429627 2:237911442-237911464 GGGCCACGGTGCAGCAGCCCGGG + Intronic
948470237 2:238172875-238172897 GAGCAGCGGTGCAGCAGCCCTGG - Intronic
1169367263 20:5001509-5001531 GCGCCGCGGAGGGGCGGGCCGGG + Intronic
1171458485 20:25285201-25285223 GAGCCGGGAAGCCACAGCCCCGG - Intronic
1171473708 20:25391143-25391165 GCGAGGCAGAGCCGCAGCGCTGG + Intergenic
1172037300 20:32019105-32019127 GCGCCGCGGAGGCCCGGGCCGGG + Exonic
1172245598 20:33443402-33443424 GCGCCGCGGAGCCGGGCGCCGGG - Exonic
1172284735 20:33732392-33732414 GCGCCGCCAAGCCGCCTCCCTGG - Intronic
1172510536 20:35497909-35497931 TGGCCGCAGAGCAGCAGCCCGGG + Exonic
1172756588 20:37289659-37289681 GCGCCGCCGCGCCGCTCCCCCGG - Intronic
1172764962 20:37346298-37346320 GCGCGGGGGAGCCCCCGCCCCGG + Intronic
1172962188 20:38806825-38806847 GCGCGGCAGCGGCGCAGCCCTGG - Intronic
1173322258 20:41998695-41998717 CCTGCGCGGCGCCGCAGCCCTGG + Intergenic
1173633202 20:44531932-44531954 GCGCTGCGGACCGGCGGCCCAGG + Exonic
1174386793 20:50192101-50192123 GCTCCCCGGAGTCTCAGCCCCGG - Exonic
1175399646 20:58693081-58693103 GCGCCGCGGAAGCCCAGGCCCGG + Intronic
1176086011 20:63295872-63295894 GCGCCGCGTTGGCCCAGCCCAGG - Intronic
1176550194 21:8217424-8217446 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176569122 21:8400462-8400484 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1176577036 21:8444694-8444716 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1177754398 21:25328080-25328102 GCGCCGCTGCACTGCAGCCCGGG + Intergenic
1178417109 21:32412818-32412840 GCGGGGCGGAGGCGCAGGCCCGG - Exonic
1178534981 21:33403622-33403644 CCGCCGCGGAGGCCCAGGCCCGG - Intronic
1178922595 21:36748132-36748154 GCTCGGTGGCGCCGCAGCCCCGG - Exonic
1179511827 21:41878826-41878848 GGGCCGCGGGGCCGCGGGCCGGG + Exonic
1179675207 21:42975727-42975749 CCACGGCGGGGCCGCAGCCCTGG + Intronic
1180871412 22:19149224-19149246 GTGGCGCGCAGCCGCGGCCCGGG - Intronic
1180949323 22:19714223-19714245 CCTCCCCGGTGCCGCAGCCCAGG - Intergenic
1181401408 22:22652177-22652199 GGGCCGCAGAGCCACGGCCCAGG + Intergenic
1181775932 22:25160317-25160339 GAGCCACAGAGCCGCAGCCCAGG + Intronic
1182903848 22:33920440-33920462 CCGCCGCCGCGCCGGAGCCCGGG - Intronic
1183154687 22:36066049-36066071 GCGCCACGGAGCTGCTGCTCCGG - Intergenic
1183162480 22:36124116-36124138 GCGCTGCGCAGCCGCAGCCCGGG - Intergenic
1183489520 22:38109096-38109118 GGGCCACCGAGCCCCAGCCCTGG - Intronic
1184046772 22:41976907-41976929 GCGCGGCGGGGCCGCGGGCCGGG + Exonic
1185344497 22:50305424-50305446 GCGCCAGGTAGCCACAGCCCTGG + Intronic
1203255089 22_KI270733v1_random:133762-133784 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203263145 22_KI270733v1_random:178841-178863 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
950253919 3:11488530-11488552 GCGCCGCTGCGCTGCGGCCCGGG - Intronic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952152351 3:30606799-30606821 GCGGCGCGGAGGCGCAGCCAGGG + Exonic
952745949 3:36779572-36779594 GCGCCGCTGAACTCCAGCCCGGG - Intergenic
954434611 3:50489548-50489570 GCCCAGGGGAGCAGCAGCCCCGG + Intronic
954558815 3:51538891-51538913 GCGGCCCGGAGCCGCGGCGCAGG + Intergenic
958470202 3:94507628-94507650 CCGCGGCAGAGCCGCAGCGCCGG + Intergenic
961688307 3:128650608-128650630 GGGACGTGGAGCCGCCGCCCAGG + Exonic
964801904 3:160566055-160566077 ACGGCACGGAGCCCCAGCCCGGG - Intergenic
966878929 3:184338823-184338845 GCTCCGCGCAGCTGCGGCCCAGG - Intronic
966915748 3:184583417-184583439 GGTCTGCGGAGCCGCAGGCCTGG + Intronic
968134525 3:196211400-196211422 CAGCCTCAGAGCCGCAGCCCAGG + Intronic
968448438 4:663941-663963 GCGCAGCGGCGGCACAGCCCGGG + Intronic
968512914 4:1003218-1003240 CCGCCTCGGAGCCCCCGCCCCGG - Intronic
968655271 4:1775858-1775880 GGGCCGCGGAGACACAGCCGTGG - Intergenic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
969436632 4:7192711-7192733 GCGCGGCGGCGGCGGAGCCCCGG - Exonic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
971272149 4:25160195-25160217 GCCCGGCGGAGCCAGAGCCCCGG + Intronic
980464220 4:133152182-133152204 GCGCCGTGGAGCCCCAGGGCGGG + Exonic
981688515 4:147481252-147481274 CCGCCGCCGCGCCGGAGCCCGGG + Exonic
985448407 4:190041218-190041240 GGCCGGCGGAGCCACAGCCCCGG - Intergenic
985660888 5:1155991-1156013 GCGCCGCGCGGCCCCATCCCCGG - Intergenic
989643204 5:43603205-43603227 GCGCCGCGGGGCCCAAGCCCGGG + Intronic
991626241 5:68603978-68604000 GAGCTGGGAAGCCGCAGCCCAGG + Intergenic
992473113 5:77077242-77077264 GCGCAGCGGGGGCCCAGCCCAGG + Exonic
992611209 5:78510048-78510070 GCTCCGGGGAGCCCCCGCCCGGG + Exonic
992716307 5:79514223-79514245 CCGCCGCGGAGCCGCGGCCGGGG + Intergenic
997990803 5:138543133-138543155 CCGCCGCGGAGCCGCCGCCGGGG - Exonic
998406687 5:141878282-141878304 GCCGTGCGGAGCCGCAGCCCAGG - Exonic
999421422 5:151447831-151447853 GAGTCGCGGACCCACAGCCCGGG - Intronic
1000594331 5:163196404-163196426 GCGCCGCTGCGCTGCAGCCTAGG + Intergenic
1002058036 5:176609909-176609931 CCGCCCCGGAGCCGCTGTCCAGG - Intronic
1002182241 5:177436568-177436590 GAGCCCCTGAGCCCCAGCCCTGG - Intronic
1002385001 5:178860086-178860108 GCGGCGGGGAGGCGCGGCCCGGG + Exonic
1002575229 5:180170552-180170574 TCCCCGCGGAGCCCCCGCCCTGG + Intronic
1002712573 5:181204261-181204283 GAGCTGCGGAGACGCAGACCAGG + Intronic
1003139028 6:3456349-3456371 CAGCCGCGGAGCAGCAGCTCGGG + Exonic
1003212338 6:4079107-4079129 AGCCCGCGGAGCCGCAGCCCCGG - Exonic
1003545013 6:7051855-7051877 GCGCCGCGCAGCCCCCGGCCCGG + Intergenic
1003963293 6:11229357-11229379 GGGCCGCTGAGCCCCCGCCCGGG + Intronic
1004193874 6:13487274-13487296 CGGCCGCGCCGCCGCAGCCCGGG + Exonic
1007390316 6:41546750-41546772 GCGGCGCGGAAGGGCAGCCCCGG + Exonic
1012548781 6:100449224-100449246 GCGTCGAAGAGCCGCAGGCCAGG - Intronic
1014045247 6:116877209-116877231 CCCCAGCGGAGCCCCAGCCCGGG - Intronic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1016597027 6:145814609-145814631 GCGCGGCCGAACCGCGGCCCAGG + Exonic
1017021524 6:150143566-150143588 GCGCCCCGGAGCTGGAGCCCGGG - Intronic
1017738204 6:157381903-157381925 GGGCCGCGGCGCCGCGGCTCGGG + Exonic
1019322207 7:420888-420910 GCTCCGGGGAGCAGCAGCCCTGG + Intergenic
1019612855 7:1945747-1945769 GCGGCGCTGGGCCGCAGACCGGG + Intronic
1020201179 7:6081380-6081402 GGGCGGCGCAGCCACAGCCCCGG + Intergenic
1020418324 7:7969833-7969855 CCGTCGGGGAGACGCAGCCCGGG - Intronic
1023287094 7:38631348-38631370 GCTCCCCGGACCCGCAGCCATGG - Exonic
1025282801 7:57640578-57640600 GCCCCGCTGTGCCCCAGCCCAGG + Intergenic
1025301912 7:57824842-57824864 GCCCCGCTGTGCCCCAGCCCAGG - Intergenic
1027250021 7:76393233-76393255 CCGCCGCGCAGCCGCAGAGCGGG + Intronic
1027978436 7:85186788-85186810 GTTCCTCTGAGCCGCAGCCCTGG + Intronic
1028841640 7:95435081-95435103 GGGCCGCGGAGGCTCCGCCCTGG + Exonic
1029423429 7:100483459-100483481 GGGCCCCGCAGCCGCAGCCTCGG + Intergenic
1029813986 7:103075243-103075265 CCGCGGCAGAGCCGCAGCGCCGG - Exonic
1030227531 7:107169377-107169399 GCGCCGCCGCCCCGAAGCCCAGG - Intronic
1033288591 7:140062661-140062683 GGGCGGCGCAGCCGCGGCCCCGG - Exonic
1034284164 7:149873617-149873639 GCCCTGCGGACCCGCAGCCTGGG - Exonic
1035171112 7:157017990-157018012 GGCCCCCGGAGCCGCAGCCCGGG + Intergenic
1035431750 7:158828598-158828620 GCGCCCCGGACCCGGAGCCTGGG + Intronic
1035752065 8:2002950-2002972 GCGCCTCGAAGCCGCCGCCCTGG - Exonic
1037840986 8:22245199-22245221 GCGGTGTGGAGCCGCGGCCCGGG + Intronic
1039477780 8:37849741-37849763 GCTCCGTGGAGCCGCAGTCCGGG + Exonic
1040481385 8:47831158-47831180 GTGCCCCGGGGGCGCAGCCCGGG + Intronic
1045547377 8:103140818-103140840 CAGCCCCGGAGGCGCAGCCCCGG - Exonic
1047687066 8:127315671-127315693 GCGCCGCTGCGCTGCGGCCCGGG + Intergenic
1047961659 8:130016076-130016098 GCGCAGCGGGGCCGCCGCCCGGG - Intronic
1049411453 8:142475651-142475673 GCGGGGCGGAGCCGGAGCCCTGG + Intronic
1049419576 8:142510837-142510859 GGGGCGCGGAGCCGCCGCTCGGG + Intronic
1049620945 8:143598021-143598043 GCCACGCGGGGCCGCGGCCCGGG - Exonic
1049710389 8:144060580-144060602 GGGCCGCGGAGGGGAAGCCCGGG + Intronic
1049777562 8:144413647-144413669 GGGAGGCGGAGCCGCAGGCCTGG + Intronic
1049936347 9:504692-504714 CCGCCGCGGACCCGGAGCTCGGG - Exonic
1049989427 9:977405-977427 GGACTGCCGAGCCGCAGCCCGGG + Exonic
1053055157 9:34989673-34989695 GCGGCGCGGAGGCGGAGCCGTGG + Exonic
1057483188 9:95461799-95461821 GGGCTGCGGGGCCGCTGCCCTGG - Intronic
1057483189 9:95461802-95461824 GGGCAGCGGCCCCGCAGCCCTGG + Intronic
1058110659 9:101028500-101028522 GCGCCGCGGAGTCCCCGCGCAGG + Intergenic
1058861257 9:109119700-109119722 GCACCGCGGCGCCGCAGCACAGG + Exonic
1060479261 9:124008595-124008617 GCGCCACGGAGCCGGGGCCGCGG - Intronic
1060945640 9:127568358-127568380 GCTCCGCCGGGCCCCAGCCCTGG - Intronic
1061242609 9:129383299-129383321 GCTCCCGGGAGCCGCAGCGCAGG + Intergenic
1062556352 9:137114868-137114890 GCGCCCCGCGGCCGCTGCCCAGG + Intronic
1062636371 9:137493709-137493731 GCGCCTCGGAGCAGGAGCCCTGG - Intronic
1203471487 Un_GL000220v1:116899-116921 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1203479308 Un_GL000220v1:160871-160893 GCCGCGCGGAACCGCGGCCCCGG - Intergenic
1185457628 X:318738-318760 ACGCGGGAGAGCCGCAGCCCCGG + Exonic
1189333880 X:40158374-40158396 GGACCGCGGAGCCGCAGGCTGGG + Intronic
1199500374 X:148500690-148500712 GCGGCGCGGCGCGGCAGCCGGGG - Exonic