ID: 1015156720

View in Genome Browser
Species Human (GRCh38)
Location 6:130104554-130104576
Sequence GCTCTTCTTCCCCTGAAATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015156715_1015156720 29 Left 1015156715 6:130104502-130104524 CCTCCGGCTAGTCCGTCATTTCC 0: 1
1: 0
2: 0
3: 7
4: 37
Right 1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG 0: 1
1: 0
2: 1
3: 26
4: 278
1015156716_1015156720 26 Left 1015156716 6:130104505-130104527 CCGGCTAGTCCGTCATTTCCAAG 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG 0: 1
1: 0
2: 1
3: 26
4: 278
1015156719_1015156720 8 Left 1015156719 6:130104523-130104545 CCAAGAAATAAAAGGACAGATGC 0: 1
1: 0
2: 3
3: 41
4: 357
Right 1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG 0: 1
1: 0
2: 1
3: 26
4: 278
1015156717_1015156720 17 Left 1015156717 6:130104514-130104536 CCGTCATTTCCAAGAAATAAAAG 0: 1
1: 0
2: 5
3: 63
4: 603
Right 1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG 0: 1
1: 0
2: 1
3: 26
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015156720 Original CRISPR GCTCTTCTTCCCCTGAAATC AGG Exonic
900538310 1:3190056-3190078 GCTCTTCTCTCCCTGACATGGGG + Intronic
900901536 1:5519782-5519804 TCTATACTTCCTCTGAAATCTGG + Intergenic
902142341 1:14367288-14367310 GGTATTCTTCCCCTGAAGTCCGG + Intergenic
903601672 1:24546523-24546545 GGTGGTCTTCCCCTGAAGTCTGG - Intergenic
904305770 1:29588201-29588223 AATATTCTTCCCCTAAAATCAGG + Intergenic
906649144 1:47498836-47498858 GCTCTTTTTTCCCTAAGATCAGG - Intergenic
906687700 1:47772967-47772989 TGTTTTCTTCTCCTGAAATCAGG + Intronic
907423822 1:54365790-54365812 CCACTTCTTTCCTTGAAATCTGG + Intronic
908322427 1:62991372-62991394 GCTCTTCTTCCCCTTGCACCTGG + Intergenic
909234722 1:73138155-73138177 ACTTTTCTTCCCCTGAAAATGGG - Intergenic
909519815 1:76554513-76554535 GCTCTTCTTTCCCTGAAGGCTGG + Intronic
910169436 1:84361668-84361690 GCTCCTCTTCCCTTCAGATCTGG - Intronic
910207167 1:84759543-84759565 CCTCTCCTTCCCCAGCAATCTGG + Intergenic
910289831 1:85589083-85589105 GCTCCTCTTCCTCTGAAAAGGGG + Intergenic
912582083 1:110729940-110729962 GGTATTCTTACCCTGAAGTCTGG - Intergenic
913503274 1:119491542-119491564 GCTTTTTTTCCCCTTTAATCTGG - Intergenic
914331056 1:146671237-146671259 GGTGATCTTCCCCTGAAGTCCGG + Intergenic
914847639 1:151291713-151291735 TCTTTTTTTCCCCAGAAATCCGG + Exonic
916525250 1:165603354-165603376 GCCCCTGTTCCCCTAAAATCAGG - Intergenic
917767625 1:178239871-178239893 GGTGTTCTGCCCCTGAAATAAGG + Intronic
919316108 1:195971910-195971932 CTTCTTCTCCCCCTGGAATCAGG + Intergenic
921079391 1:211726518-211726540 GCCCTCCTGCCCCTGAAACCTGG - Intergenic
923042359 1:230328167-230328189 GCTCTTATTGGGCTGAAATCAGG - Intronic
923892836 1:238235030-238235052 GGTAATCTTCCCCTGAAGTCCGG + Intergenic
924783458 1:247172751-247172773 GCTCTGGTTCCCCTGACCTCAGG + Intergenic
1062801827 10:386669-386691 GCTCCTCTTCACATGAATTCTGG + Intronic
1064722692 10:18246008-18246030 GCTCTTCTACTCCTGGAACCCGG + Intronic
1065774644 10:29108210-29108232 GCTCTGTTTCTCTTGAAATCTGG - Intergenic
1066583484 10:36906584-36906606 GCACTTCTTCCTCTGAAACTTGG - Intergenic
1067292189 10:44951362-44951384 CCTCTTCTTCCCCTGAATGTCGG + Intergenic
1067547349 10:47203348-47203370 GATCTTCTTCCCCTTAAGTGTGG + Intergenic
1068321713 10:55426798-55426820 GCTAATCTTCCCCTGAAGTCCGG + Intronic
1069035891 10:63645650-63645672 CCTCTTCATCCTCTGAAACCAGG + Intergenic
1069222635 10:65903527-65903549 GTTGTTCTTCCCCTGGAGTCAGG - Intergenic
1070697113 10:78571716-78571738 TCTCTCTTTCCCTTGAAATCAGG - Intergenic
1070777395 10:79117845-79117867 GCTCTACTTCCCCTGACCTGGGG - Intronic
1071201487 10:83223807-83223829 GGTAATCTTCCCCTGAAGTCCGG + Intergenic
1072009138 10:91288178-91288200 GCTCTGCTTTCCCTGAGAGCCGG - Intergenic
1072456379 10:95579964-95579986 GCTATTCTTCCCCAGGAACCAGG + Intergenic
1074105937 10:110389717-110389739 GCCTTTCTTTCCCTCAAATCAGG - Intergenic
1074177949 10:111030006-111030028 GGTCGTCTTCCCCTGGAGTCGGG + Intergenic
1075633997 10:124018076-124018098 GCTCTTCCTTCCCTGAAAGGAGG + Intronic
1075923954 10:126235703-126235725 CCCTTTCTTCCCTTGAAATCTGG - Intronic
1076428093 10:130381605-130381627 GCTCCTGTTCCCCAGAAACCTGG - Intergenic
1078546070 11:12247903-12247925 CCTCTTGCTCCCCTGAATTCAGG - Intronic
1079373740 11:19873368-19873390 TCTATTCATCCCATGAAATCTGG - Intronic
1079497587 11:21063244-21063266 TGGCTTCTTCCCCTGGAATCAGG + Intronic
1079950278 11:26793368-26793390 GCTCTTCTCCCCCTCAAGCCTGG - Intergenic
1080924479 11:36741935-36741957 GCTATTGTGCCCCTGAAATGTGG + Intergenic
1083102685 11:60326479-60326501 GGTAATCTTCCCCTGGAATCTGG + Intergenic
1083325729 11:61872084-61872106 GCTCTCCTGCCCCAGAAGTCAGG + Intergenic
1085389064 11:76172950-76172972 CCTCTTCTGCCTCTGAAATCGGG + Intergenic
1087608424 11:100405424-100405446 GGTATTCTTCCCCTGAATTCTGG + Intergenic
1087991252 11:104747060-104747082 GGTGTTCTTCCCCTGGAATCTGG - Intergenic
1088887656 11:114020514-114020536 TATCTTCTTTCCCTGAGATCTGG - Intergenic
1089093352 11:115897174-115897196 GCTTTTCTATCCCTTAAATCTGG + Intergenic
1090448253 11:126783147-126783169 GCCATGCTTCCCCTGAAACCTGG + Intronic
1090454466 11:126836029-126836051 CATCTTCTTCCCCTGGAGTCAGG - Intronic
1090727206 11:129538914-129538936 TCTCTTCTCTCCCTCAAATCAGG + Intergenic
1090939085 11:131372005-131372027 CCTCTTCTCCCCCTGCAATATGG + Intronic
1091252581 11:134156083-134156105 TCTCATCTTCCCCTGCAGTCAGG + Intronic
1092104398 12:5911163-5911185 GGTCTGCTTCCCTTGAAAGCAGG + Intronic
1092148250 12:6229497-6229519 GCACTTATTCCCGTGAACTCGGG + Intronic
1092640955 12:10508245-10508267 GCTCTTCCTGGCCTGAAATACGG + Intronic
1092680078 12:10969143-10969165 GGTAATCTTCCCCTGAAGTCCGG + Intronic
1093268493 12:17028228-17028250 GGTAATCTTCCCCTGAAGTCAGG - Intergenic
1093824811 12:23670953-23670975 GCTTCTCTTCCCCTGAATGCTGG - Intronic
1093835804 12:23826511-23826533 GCTTTTCTCTCCCTGAAAGCTGG + Intronic
1094191814 12:27705842-27705864 GTTCATCTTCCCCTGAGGTCAGG + Intergenic
1096971587 12:55670688-55670710 GCTCTATTTCTCCTGAAGTCTGG + Intergenic
1097066877 12:56327038-56327060 GCCCATCTTGTCCTGAAATCAGG - Intronic
1097170493 12:57110220-57110242 CCTCTTCTTCCCCAGCCATCAGG + Intronic
1098869805 12:75803798-75803820 TCTCTTCTTACCCCCAAATCAGG - Intergenic
1100652647 12:96607245-96607267 GCTCTTCTTCCCTTGGAGTATGG - Intronic
1101186283 12:102284088-102284110 ACTCTTATTCCCGTGAGATCTGG + Intergenic
1103928585 12:124437244-124437266 GCGCTTCTTCCCCTGACAGCTGG + Intronic
1103965572 12:124637442-124637464 GTTCTTATTCACCTGGAATCAGG + Intergenic
1104069558 12:125332345-125332367 TCTCTTCTTCCTCTGAGATCTGG + Intronic
1104095860 12:125557363-125557385 GGTCTGCCTCCCCTGAGATCAGG + Intronic
1106286946 13:28326280-28326302 TCTCTACTTCTCATGAAATCTGG - Intronic
1106787854 13:33124844-33124866 CCTCTTATTCCCCAGAAATAAGG - Intronic
1108248597 13:48542420-48542442 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1108316550 13:49242656-49242678 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
1109776279 13:67044953-67044975 TCTCTGCTTCACCTGATATCTGG - Intronic
1109778233 13:67072260-67072282 GTTCTACTTCCCCTGAAAGTAGG + Intronic
1109958656 13:69602817-69602839 GCTCATCTTCTCCTGGAACCTGG - Intergenic
1109995827 13:70124690-70124712 GTTTTTTTTCCCCGGAAATCTGG + Intergenic
1110003292 13:70233031-70233053 GCTCTTCTTCCTCTGGAGCCTGG + Intergenic
1110350696 13:74503756-74503778 TTTCTTCTTCCTCTGAAAGCTGG - Intergenic
1111611160 13:90609438-90609460 ACTCTTCCTCCCTTGAAGTCAGG + Intergenic
1111848129 13:93537251-93537273 GCTCTTCTTGCCATGATATGAGG + Intronic
1112547174 13:100382258-100382280 GGTGATCTTCCCCTGAAGTCCGG + Intronic
1112857420 13:103788080-103788102 GCTTTTCTTCTCCTGAGAACTGG + Intergenic
1113843535 13:113373445-113373467 GCTCTTCTCCCTCTGAGATAGGG + Intergenic
1114614433 14:24060772-24060794 GCTACCCTTCCCCTGAAGTCTGG + Intronic
1115153726 14:30314922-30314944 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1116977227 14:51130013-51130035 GCTCCTCTTCCCTTCTAATCAGG + Intergenic
1117332828 14:54730485-54730507 TCTCTTCTTCCCCCGGAATGAGG + Intronic
1117967235 14:61218570-61218592 GCTCTTTTTCCCTTGAAATTGGG - Intronic
1119145876 14:72313578-72313600 TCTCTTTTGCCCCTGAAATCAGG + Intronic
1120123979 14:80718916-80718938 TCTCTTCTTCACATGAAATATGG + Intronic
1120493382 14:85204551-85204573 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1122449512 14:101793860-101793882 GGTAATCTTCCCCTGAAGTCTGG + Intronic
1123570220 15:21597894-21597916 CTTCTTGTTTCCCTGAAATCTGG - Intergenic
1123606331 15:22033214-22033236 CTTCTTGTTTCCCTGAAATCTGG - Intergenic
1125600030 15:40910467-40910489 CCTTTTCATCCCCTGGAATCTGG + Intergenic
1126212097 15:46111447-46111469 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1128646995 15:69384903-69384925 GCTTTCCTTCCCCTGCAACCGGG + Intronic
1129247868 15:74290909-74290931 ACTCTTGTTACCCTGAAACCTGG - Intronic
1130287646 15:82569260-82569282 GCTCTTCTTTCCCTGGGCTCTGG - Intronic
1131747354 15:95463363-95463385 GCTTTTCCTCCTCTGAAATTGGG - Intergenic
1131794203 15:95997456-95997478 GCTCTTCTGTCCCTGAAAAGAGG + Intergenic
1202978571 15_KI270727v1_random:324985-325007 CTTCTTGTTTCCCTGAAATCTGG - Intergenic
1133269771 16:4605170-4605192 GCTCTTGATCCCCTGACCTCAGG + Intergenic
1135823161 16:25702802-25702824 GTTCTTCTACCCCTGAATTGGGG - Intronic
1137964146 16:52914273-52914295 GGTGGTCTTCCCCTGGAATCGGG - Intergenic
1140002497 16:71039667-71039689 GGTGATCTTCCCCTGAAGTCCGG - Intronic
1140177508 16:72677656-72677678 GCAGCTTTTCCCCTGAAATCAGG + Intergenic
1140333857 16:74084703-74084725 GCTCTTCTTCTCAAGATATCGGG + Intergenic
1140459952 16:75131515-75131537 GTTTTTCTTCCCATCAAATCGGG + Intergenic
1140532565 16:75679386-75679408 GCTATTCTTCCCAGGCAATCGGG - Intronic
1142301762 16:89262749-89262771 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1146661990 17:34671003-34671025 TCTCTTCTTTCCCAGAAATGGGG + Intergenic
1147872270 17:43595961-43595983 GATTTTCTTCCTCTGAAACCTGG + Intergenic
1148611635 17:48968558-48968580 GGTCTCCTTCCCCTGATTTCTGG + Exonic
1148659521 17:49317469-49317491 GCTCTTGTCTCCCTGAAATATGG + Exonic
1149206429 17:54253539-54253561 GGTTGTCTTCCCCTGGAATCGGG + Intergenic
1149453421 17:56767794-56767816 GAGCTTCTTCCCCTGACTTCAGG - Intergenic
1149969597 17:61203481-61203503 CCTCTTATCCCCCAGAAATCAGG - Intronic
1150686455 17:67325075-67325097 GGTAGTCTTCCCCTGAAATCCGG - Intergenic
1150999018 17:70352106-70352128 GGTCGTCTTCCCCTGGAGTCGGG - Intergenic
1151527613 17:74681660-74681682 ACTCTCCTTTCCCTGAAACCAGG + Intronic
1152735869 17:81996505-81996527 GCTCCACTTCCCTTGGAATCTGG + Exonic
1152911628 17:83008584-83008606 GCGCTCCCTCCCCTCAAATCTGG + Intronic
1155017877 18:21863498-21863520 GGTAATCTTCCCCTGAAGTCCGG + Intronic
1155055680 18:22180817-22180839 TCTCCACTTCCCCTGAAAACCGG - Intronic
1156393624 18:36676762-36676784 GCTCATCTTCACTAGAAATCAGG - Intronic
1156713519 18:39977382-39977404 GATAATCTTCCCCTGAATTCTGG + Intergenic
1158684226 18:59598517-59598539 GCTCTCCATCCTCTGAAATGTGG + Intronic
1158968538 18:62644640-62644662 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1159475850 18:68920220-68920242 GCTTTTCTTTTCCTGAAAGCTGG + Intronic
1161129779 19:2581103-2581125 CCTCGTCTTCCCCTCATATCAGG + Intronic
1161675378 19:5644796-5644818 GCTATTCTTCCCCTGCAAGTAGG + Intronic
1166679118 19:44756691-44756713 GCCCTTCTTCCCCAGGAACCAGG - Intronic
1166714261 19:44956369-44956391 TCTCTTCGTCCCCTGACAGCAGG - Intronic
1166907289 19:46120153-46120175 GGCATTCTTCCCCTGAAGTCTGG + Exonic
1167338442 19:48900718-48900740 CCTCTTCCTCCCCTGGAACCAGG - Intronic
1167828237 19:51994830-51994852 TCTCTTCTTTCCTAGAAATCAGG - Exonic
927642549 2:24854574-24854596 GCTTTTGTTCTGCTGAAATCTGG + Intronic
928203068 2:29263556-29263578 TCTTTTCTGCCCCTGAAATTTGG - Intronic
928541406 2:32287517-32287539 ACTCTTCTTTCACAGAAATCGGG + Intronic
929886019 2:45879269-45879291 GGTATTCTTCCCCTGAAGTCTGG - Intronic
930515428 2:52401752-52401774 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
931938942 2:67230860-67230882 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
932843377 2:75107399-75107421 GCTCTTTTTGGCCTGAAATATGG - Intronic
933155479 2:78968597-78968619 GTTCTTCATCCCCAGACATCTGG + Intergenic
933287663 2:80401749-80401771 GATTTTCTGCCCCTGAAAACAGG - Intronic
937148835 2:119672058-119672080 CCCCATATTCCCCTGAAATCAGG + Intergenic
937377281 2:121346004-121346026 GCTTTGCTTCCCCAGAACTCTGG + Intronic
937898673 2:126999163-126999185 GCTCTTCTTCCCCAGCACTTTGG - Intergenic
938257758 2:129873198-129873220 GCTCTCCTCTCCCTGAAGTCTGG + Intergenic
940899534 2:159113744-159113766 CCTCTGCTTCCCCAGTAATCGGG - Intronic
942560284 2:177212554-177212576 GGCCCTCTTCCCCTGAAAGCTGG + Exonic
942890714 2:180983407-180983429 GCTTTTCTCCCCCTTAACTCAGG + Intronic
944001378 2:194842644-194842666 GGTAATCTTCCCCTGAAATCCGG - Intergenic
944067410 2:195633691-195633713 AGTATTCTTCCCCTGAAGTCCGG + Intronic
947122475 2:226831598-226831620 GCTCTGCTCCCTCTGAAACCTGG - Intergenic
947596831 2:231418282-231418304 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
1168998139 20:2147648-2147670 GCCCCTCTTCCCCCGACATCTGG + Exonic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1172363771 20:34333257-34333279 GCTTTTTTTCCCCTGGACTCTGG + Intergenic
1174322491 20:49752950-49752972 ACTCTTCTTCCCCTCCATTCTGG - Intergenic
1177640132 21:23834833-23834855 GCTAATCTTCCCCTGAAGTCTGG - Intergenic
1178164880 21:29962153-29962175 GATGATCTTCCCCTGAAATTTGG + Intergenic
1178995864 21:37399050-37399072 GCTCTGCTTCCCTTGACTTCAGG - Intronic
1178996142 21:37401865-37401887 GCTCTTCTTCACATGAACTTTGG + Intronic
1182394371 22:30024861-30024883 TCTCCTCCTCCCCTGAAAGCTGG - Intronic
1184411047 22:44326697-44326719 GCTCTCCTTCCCCTCCCATCTGG - Intergenic
1185163799 22:49245273-49245295 GCCCTTGTTCCCCTGAGATGGGG - Intergenic
949347632 3:3091283-3091305 TCTCTTCTATCCCTGAACTCTGG - Intronic
949631208 3:5928885-5928907 GGTCGTCTTCCCCTGGAGTCTGG - Intergenic
949844775 3:8358230-8358252 GCTCTTGTTCACCTCCAATCGGG - Intergenic
949956658 3:9274763-9274785 GGTAATCTTCCCCTGAAATCTGG + Intronic
950207670 3:11093038-11093060 GCTCTTCTTGCCCTGCCATTTGG - Intergenic
950997463 3:17518477-17518499 AATCTTCTTCCCCTGAAATCTGG - Intronic
951369788 3:21831266-21831288 GCTCCTCTTCCCTTCAAATGAGG - Intronic
952164647 3:30733779-30733801 GCTGTTCATGCCCTGAATTCTGG - Intronic
952982514 3:38749186-38749208 CCACTTCTTCCCCTCAAATTAGG + Intronic
956685659 3:71825135-71825157 AGTGTTCTTCCCCTGATATCTGG - Intergenic
958119291 3:89263550-89263572 GGTAATCTTCCCCTGAAGTCTGG + Intronic
958266736 3:91446559-91446581 GCTCTTCTTACCCTAGAGTCAGG - Intergenic
960880640 3:122341247-122341269 GCTCTTTTTCTCCTAAAATAAGG + Intronic
961143738 3:124576999-124577021 GCTCATCTGCCCCTGAGCTCAGG + Intronic
961375712 3:126464492-126464514 GGTCTTCTACCCCTGACAGCTGG + Intronic
963055448 3:141182671-141182693 GATTTTCTTCTCCTGAGATCTGG - Intergenic
963534849 3:146514560-146514582 GGTGATCTTCCCCTGAAGTCTGG - Intergenic
964739594 3:159951511-159951533 CGTCTTCTTCCCCTGAAAAGGGG - Intergenic
965067123 3:163864303-163864325 GGTCATCTTCCCCTGAGGTCTGG - Intergenic
965561201 3:170063721-170063743 GCTCTTGTTCTCCTAACATCTGG + Intronic
966033298 3:175377854-175377876 GGTAATCTTCCCCTGAAGTCCGG - Intronic
966752852 3:183339058-183339080 TCTCTTTTAGCCCTGAAATCTGG - Intronic
967767497 3:193297176-193297198 GCTCTTCTTCCCCAGAAACAGGG + Intronic
968250153 3:197202536-197202558 GTTTTTCTTCTCCTAAAATCAGG - Intronic
969872166 4:10111406-10111428 CCTCTGCTTCCCCTGCCATCAGG + Intronic
970023270 4:11592941-11592963 ACTCTTCTTCCCTTGCACTCTGG + Intergenic
970547711 4:17146697-17146719 TCTCTTCTTCCAGTGAACTCTGG - Intergenic
971005473 4:22369971-22369993 GATAATCTTCCCCTGAAGTCTGG - Intronic
972906512 4:43754865-43754887 TCTCCTTTTCCCCTGAAATATGG - Intergenic
974303282 4:60098124-60098146 GGTGGTCTTCCCCTGTAATCGGG - Intergenic
975002952 4:69247980-69248002 TATCATCTTCCCCTGAACTCTGG - Intergenic
975011234 4:69355338-69355360 TATCCTCTTCCCCTGAACTCTGG - Intronic
975896458 4:79098206-79098228 GCTTTTCTTGCACTGAACTCCGG + Intergenic
975947384 4:79724038-79724060 GGTAATCTTCCCCTGAAATCCGG + Intergenic
976285603 4:83367947-83367969 GCTCTTCTTTCCCTCTAACCTGG - Intergenic
976859067 4:89640961-89640983 GGTAATTTTCCCCTGAAATCCGG - Intergenic
977364953 4:96056294-96056316 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
977767146 4:100812388-100812410 GCTCTTCATCTACTGAAAACCGG - Intronic
979156637 4:117401012-117401034 GGTCATTTTGCCCTGAAATCTGG - Intergenic
979297991 4:119054519-119054541 GGTTGTCTTCCCCTGAAGTCAGG + Intronic
979725517 4:123956083-123956105 GGTCATCTTCCCCTGAAGTCAGG - Intergenic
982671056 4:158320459-158320481 GGTATTCTTCCCCTGAAGTCTGG + Intronic
983442685 4:167807400-167807422 GCTTCTCTTCAGCTGAAATCTGG - Intergenic
983717669 4:170805240-170805262 GGTGGTCTTCCTCTGAAATCTGG - Intergenic
985543747 5:499061-499083 TCTCATCTTCTCCTGAAACCAGG + Intronic
985805834 5:2042573-2042595 GAGCTTCTTCACCTGAAAGCTGG + Intergenic
986935292 5:12876872-12876894 GGTATTCTTCCCCTGATGTCTGG - Intergenic
987090241 5:14503695-14503717 GCTATTCGTCCCCTTGAATCAGG - Intronic
992823125 5:80518590-80518612 ACTCTTCTGCCCCTGAATTGGGG - Intronic
994140445 5:96335269-96335291 ACTCTGCATCCCCTGCAATCTGG + Intergenic
995740237 5:115348272-115348294 GCTCTTCTCTCCCTGAAGCCCGG + Intergenic
998856383 5:146398863-146398885 AGTCATCTTCCCCTGAAGTCGGG - Intergenic
1000147272 5:158465798-158465820 GCTATCAGTCCCCTGAAATCAGG + Intergenic
1000810669 5:165857451-165857473 GGTAATCTTCCCCTGAAGTCTGG - Intergenic
1000866282 5:166518709-166518731 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1001489209 5:172143896-172143918 GCTGTTCTGCCCCTGATTTCTGG - Intronic
1002292274 5:178208109-178208131 GCTCTTCCCCTCCTGAACTCTGG + Intronic
1002821301 6:727423-727445 GCTTTTCTTCCTCTGTGATCTGG + Intergenic
1004110295 6:12711355-12711377 GCTCTTAGTCCTCTGAAATTCGG - Intergenic
1004469550 6:15917039-15917061 GATGATCTTCCCCTGAAATTTGG + Intergenic
1005363377 6:25053703-25053725 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1007631502 6:43275640-43275662 GCTCTGCTCCCCCTCAACTCTGG - Intronic
1009177083 6:60473625-60473647 GCTCTTCTTACCCTAGAGTCAGG + Intergenic
1009222955 6:61000538-61000560 GTTCTTCTTCCCTTGATATTAGG - Intergenic
1010618358 6:78041930-78041952 TGTATTCTTCCCCTGAAAACAGG + Intergenic
1011233811 6:85193001-85193023 GGTATTCTTCCCCTGAAGTCTGG - Intergenic
1011872800 6:91917897-91917919 GCTCTTCAGCTCCTTAAATCAGG + Intergenic
1012263248 6:97111839-97111861 GGTAATCTTCCCCTGAAGTCTGG + Intronic
1014252211 6:119126879-119126901 AATATTCTTCCCCTGAAGTCTGG + Intronic
1015156720 6:130104554-130104576 GCTCTTCTTCCCCTGAAATCAGG + Exonic
1016200668 6:141403434-141403456 GCTGTTCTTCCCGGGCAATCAGG - Intergenic
1017432565 6:154385410-154385432 GCTCTTCTTTCCCAGAAAGGTGG - Intronic
1017900775 6:158716824-158716846 GCTCTTGAGCCCCTGAAATAGGG + Intronic
1018171211 6:161144531-161144553 GCCCTTCCTCCCCTGTATTCAGG - Intronic
1019479446 7:1259894-1259916 CCTCTTTGTCCCCTGAAAGCAGG + Intergenic
1019642136 7:2109185-2109207 GCTCTGCTCCTCCTGAAATGAGG + Intronic
1020368863 7:7411502-7411524 CCTCTTTTTCTCCTGAAATCAGG + Intronic
1021210667 7:17848225-17848247 GGTAATCTTCCCCTGAAGTCCGG - Intronic
1021395498 7:20143127-20143149 GCTTTTCTTCCCATGAAAGTAGG - Intronic
1025849341 7:65233203-65233225 GATTATCTTCCCCTGAAGTCTGG - Intergenic
1028046852 7:86130899-86130921 GGTAATCTTCCCCTGAAGTCTGG + Intergenic
1030343509 7:108407632-108407654 GCTGTTCTTCCCTTCCAATCAGG - Intronic
1030680178 7:112425933-112425955 ACTCTTAATCCCATGAAATCTGG + Intronic
1031058339 7:117020022-117020044 GCTCTTCATCCCATGATACCAGG - Intronic
1032518041 7:132521595-132521617 GCTCTTTTTCCCCTGACCCCTGG + Intronic
1032536813 7:132671409-132671431 GCTCATCTAGGCCTGAAATCTGG - Intronic
1032917594 7:136509889-136509911 GATAATCTTCCCCTGAAGTCTGG + Intergenic
1033445232 7:141415521-141415543 GCCCTTCTTCCCTTGAACCCAGG - Intronic
1033592065 7:142817499-142817521 GCTATGCTTCCTCTGAAACCTGG + Intergenic
1036463957 8:8978986-8979008 GCTCATCTTCCCCTGGAGTTAGG - Intergenic
1038285999 8:26206984-26207006 GGTCATCTTCCCCCGAAGTCGGG - Intergenic
1042081575 8:65059880-65059902 GGTAATCTTCCCCTGAAGTCCGG - Intergenic
1043781059 8:84335578-84335600 GCTTTCCTTCCCCTCCAATCAGG - Intronic
1043797334 8:84560701-84560723 TCTCTTCTTCACTTGAAATTTGG - Intronic
1046422871 8:114007725-114007747 TCTCCTTTTCCTCTGAAATCAGG - Intergenic
1046587731 8:116168206-116168228 GCTCTTCTTCTACTGCAATTAGG - Intergenic
1047206610 8:122807395-122807417 GCTTTTCTTCCCATGCAGTCTGG - Intronic
1047214415 8:122864894-122864916 GGTCTTCTTCCCCTGGGGTCTGG + Intronic
1047414857 8:124655900-124655922 GCTTCTGTTCCCCTGAACTCTGG - Intronic
1047509512 8:125505730-125505752 GCTCTTATTCCTCGGAAGTCAGG + Intergenic
1048072587 8:131038558-131038580 TCTATTCTTCCCCTTAAATATGG - Intronic
1048172613 8:132122082-132122104 CCCCTTCTTCCTCTCAAATCAGG - Exonic
1048652175 8:136490237-136490259 GACCTTCCTCCCCTGAAAGCTGG - Intergenic
1050934682 9:11380234-11380256 GATGTTCTTCCCCTGAAGTTGGG + Intergenic
1051094217 9:13446673-13446695 TGTCTTCTTCCCCTAAAATCTGG - Intergenic
1052169686 9:25377688-25377710 GGTAATCTTCCCCTGGAATCTGG + Intergenic
1052765835 9:32640044-32640066 GCTCTGCTAGCCCTGGAATCTGG + Intergenic
1053807967 9:41822483-41822505 CCTCTTCTTCCCATATAATCTGG + Intergenic
1054622625 9:67364945-67364967 CCTCTTCTTCCCATATAATCTGG - Intergenic
1055152334 9:73017192-73017214 GGTCATCTTCCCCCGAAGTCAGG - Intronic
1055376127 9:75649448-75649470 GGTAGTCTTCCCCTGAAATCTGG + Intergenic
1056202772 9:84292504-84292526 TCTCTTCTCCCCCTGGAATCCGG + Intronic
1059684030 9:116617213-116617235 GCTTTGCTTCCTCTGAAATTGGG - Intronic
1059795701 9:117694167-117694189 GCTCATATTCCCCCCAAATCAGG - Intergenic
1062730334 9:138104933-138104955 GCTGTTCTGTCCCTGAAAACTGG + Intronic
1188339289 X:28978776-28978798 GCTCTGCTCCCTCTCAAATCTGG - Intronic
1190167509 X:48085303-48085325 AGTATTCTTCCCCTGAAGTCTGG + Intergenic
1190289543 X:48983185-48983207 GCCCTTCTTCCTCTAAAACCTGG - Intronic
1190743966 X:53309917-53309939 GCTTTGCTTCCCCTGAAAACTGG - Intronic
1191643818 X:63456935-63456957 GCTGTTGTTCTCCTGAAAACAGG - Intergenic
1193532648 X:82674841-82674863 GGTATTCTTCCCCTGAAGTCTGG + Intergenic
1193691907 X:84656599-84656621 GCTCTTCTGCCTTTGAAAACAGG - Intergenic
1194859554 X:98980001-98980023 GGTGGTCTTCCCCTGAAGTCAGG - Intergenic
1194922080 X:99779146-99779168 GCTCTTCCTCCCCTAATACCCGG + Intergenic
1196129650 X:112141457-112141479 GTTTTTTTTCCCCTGAGATCAGG - Intergenic
1197399734 X:125975040-125975062 GCTCTTCTGCCACTGAAAAGGGG + Intergenic
1199928306 X:152492915-152492937 GCTTTTATTACACTGAAATCTGG - Intergenic