ID: 1015160445

View in Genome Browser
Species Human (GRCh38)
Location 6:130147128-130147150
Sequence ATGCCACTGTCAAAAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015160445 Original CRISPR ATGCCACTGTCAAAAACAGG AGG (reversed) Intronic
901369978 1:8788838-8788860 AAGCCACTGACAAGTACAGGTGG + Intronic
902064246 1:13671085-13671107 ATGCTGCTGTCAAAAAAAGTGGG + Intergenic
902919484 1:19657579-19657601 AGACCACTGGCAGAAACAGGAGG + Exonic
903765733 1:25733023-25733045 CTGGCACTGTCAAAGACAGCTGG + Intronic
905777288 1:40676977-40676999 ATGCCTTTTTTAAAAACAGGTGG + Intergenic
906826684 1:48988938-48988960 ATTCCTCTGACAAAAAAAGGTGG + Intronic
907150898 1:52286539-52286561 ATGGCACTGTCATAACCAGAAGG - Intronic
907532092 1:55109278-55109300 AAGTGTCTGTCAAAAACAGGAGG - Intronic
908320551 1:62974067-62974089 CTTTCACTGTCAAAAAGAGGAGG - Intergenic
909534843 1:76725031-76725053 ATGGCACTGTCAAACACAAATGG + Intergenic
918778252 1:188665995-188666017 ATGCAGCAGTCAAAAACAGAAGG - Intergenic
919567948 1:199212636-199212658 ATTCCAATGTCAGAAATAGGAGG + Intergenic
921859692 1:220029100-220029122 TGGCCACTGCCAAAAAAAGGTGG + Intronic
922017848 1:221670125-221670147 ATGCAACTGTTAAAAAAATGTGG + Intergenic
922417582 1:225435726-225435748 AGGCCACTCTCAAAAGAAGGGGG - Intergenic
924335781 1:242985820-242985842 ATGCCACATTCAAAAACAAAGGG + Intergenic
924671046 1:246125705-246125727 ATGGCAATGGCAAAAACAAGAGG + Intronic
1064553204 10:16522308-16522330 ATGCCACTGTTAACAGAAGGAGG + Intergenic
1065301281 10:24323651-24323673 ATGCCATTGTAAAAACCAGCTGG + Intronic
1065816063 10:29483587-29483609 ATGCCACTATTAAATACAGTTGG + Intronic
1065956830 10:30701312-30701334 ATGCCACTATTAAATACAGTTGG - Intergenic
1068873686 10:61973602-61973624 ATGCCAGTGTAAAAAATGGGAGG + Intronic
1069527583 10:69186831-69186853 AAGCCAGTGGCAAAAACAGATGG - Intronic
1069558469 10:69413339-69413361 AGGCGACTGGGAAAAACAGGCGG - Intronic
1070343758 10:75522291-75522313 AGGCCACTGCCAAACACAGATGG + Intronic
1071413665 10:85421297-85421319 ATGACAATTTCAAAAACTGGAGG - Intergenic
1072681771 10:97512780-97512802 ATGGTACTGTCAAAAGCAGCAGG - Intronic
1079643307 11:22833137-22833159 ATGCCACTGAAAAAAAAAGCAGG - Intergenic
1084365836 11:68697714-68697736 ACGCCATTGTCAAAAACCGATGG - Intergenic
1084710127 11:70839040-70839062 TTGCCACTGTAATTAACAGGAGG + Intronic
1085176924 11:74496549-74496571 ATGCCTTTGTCAAAACCAGTTGG + Intronic
1085365637 11:75940594-75940616 ATGCCACTGTCCAAAGCACTTGG - Intronic
1088377927 11:109161964-109161986 ATCTCAGTGTCAAAAACTGGGGG - Intergenic
1088971739 11:114780168-114780190 AAGCCACTGACAAAAACAAATGG + Intergenic
1090618456 11:128539566-128539588 CAGCCACTTTCAAAAACAGTTGG + Intronic
1090973793 11:131665062-131665084 ATGCCACTGGCAAACACAGATGG - Intronic
1104252551 12:127109246-127109268 ATGCCATTGTAAAAAAATGGAGG + Intergenic
1104804078 12:131573885-131573907 GTGCCACTGTCAGAACAAGGTGG - Intergenic
1105780957 13:23704953-23704975 ACTCCACTGTCAAAAACGTGAGG + Intergenic
1106705823 13:32278448-32278470 AAGCCACTGTCAGAAAGAGAGGG - Exonic
1106752429 13:32788757-32788779 TTGCAACTGTTGAAAACAGGAGG + Intergenic
1107112270 13:36710972-36710994 ATGCCAATGTCCAAAGCAGCGGG + Intergenic
1110010200 13:70323316-70323338 TTGTCACTGTCAAAAACCTGTGG + Intergenic
1115781248 14:36771060-36771082 ATTCCACTGTGATAAACAAGAGG + Intronic
1116579638 14:46622920-46622942 ATGCCCATATCAAAAACAGAAGG - Intergenic
1117789135 14:59320148-59320170 ATCACATTATCAAAAACAGGAGG - Intronic
1119459918 14:74792568-74792590 ATGCCATTGGCAAAAACATTTGG - Intronic
1120218149 14:81703003-81703025 ATGGAGCTGTCAAAAGCAGGAGG - Intergenic
1121837592 14:97106173-97106195 ATGCTAATGACAAAAGCAGGTGG - Intergenic
1124029243 15:25994671-25994693 ATGCCACTGTCAAAAAGCTATGG + Intergenic
1124443627 15:29708640-29708662 ACTCCACTGTCAAACTCAGGAGG + Exonic
1124686043 15:31782791-31782813 ATGCCACTTCTAAAAAGAGGAGG + Intronic
1124848584 15:33314256-33314278 ATGCCACTGCCAACAGCAGTGGG - Intronic
1127512058 15:59652508-59652530 ATGCCCATGTCAAAATCATGGGG - Intronic
1130091428 15:80824323-80824345 ATGCCACCCTCAAGAGCAGGTGG - Intronic
1130959249 15:88648887-88648909 TTGCCACTTTCAAACACAGGGGG - Intronic
1131325749 15:91442441-91442463 CTGCCACACACAAAAACAGGGGG + Intergenic
1133602342 16:7351790-7351812 ATGGCACTCCCAGAAACAGGTGG - Intronic
1133611348 16:7436450-7436472 AGATCACTGTCAAACACAGGTGG + Intronic
1137253738 16:46758613-46758635 CTGCCACTTTCACAGACAGGAGG + Intronic
1137431260 16:48419815-48419837 ATGCAACACACAAAAACAGGTGG + Intronic
1142140231 16:88469457-88469479 ATGCCACAGCCACAGACAGGAGG - Intronic
1144310530 17:14010104-14010126 TTCCCACTGGGAAAAACAGGAGG - Intergenic
1144508956 17:15858720-15858742 ATGCCTCTGTAAAAACCAGGGGG - Intergenic
1145120308 17:20253488-20253510 ATGCCTCTGTAAAAACCAGGGGG - Exonic
1145173072 17:20676362-20676384 ATGCCTCTGTAAAAACCAGTGGG - Intergenic
1146960519 17:36971991-36972013 GAGCCACTGTGGAAAACAGGTGG - Intronic
1149502094 17:57160848-57160870 CAGCCACTGTGAAAAACATGTGG - Intergenic
1152022578 17:77788426-77788448 ATGCCACTGTCCCATCCAGGTGG + Intergenic
1153414161 18:4826611-4826633 TTGCAAATATCAAAAACAGGAGG + Intergenic
1155365026 18:25041299-25041321 ACTCCACAGTCAAAATCAGGAGG - Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1161324623 19:3657572-3657594 ATGCTGCTGTGATAAACAGGTGG + Intronic
1165613662 19:37179306-37179328 ATGCCACTGTGACCAAGAGGAGG + Intronic
1166061678 19:40329495-40329517 AACCCAGTCTCAAAAACAGGGGG + Intronic
1166591186 19:44000914-44000936 ATGACACTGACAAAAACAACAGG - Intergenic
1167733475 19:51276321-51276343 ATGTCACTGACAACAACATGGGG - Intergenic
927498854 2:23568629-23568651 ATCCCACTGGCCAAAGCAGGAGG + Intronic
929379226 2:41330620-41330642 ATGCCTAAGTCAAAAACATGTGG + Intergenic
929697784 2:44133951-44133973 TTGCCACTGCCAACAACATGAGG + Intergenic
930370424 2:50494405-50494427 AGCCCACTGTGCAAAACAGGGGG + Intronic
930748645 2:54910609-54910631 AGGCAACTGGGAAAAACAGGGGG + Intronic
932738964 2:74277126-74277148 ATGCCACTGTCATCGTCAGGAGG - Intronic
935290413 2:101605823-101605845 GTATCATTGTCAAAAACAGGTGG - Intergenic
935810974 2:106796852-106796874 TTGCCTGTGTCAAAAACATGGGG - Intergenic
935902667 2:107809354-107809376 ATGACACTGTGTAAAACAAGTGG - Intergenic
937947184 2:127351256-127351278 ATCCAACTGTCAAAATGAGGAGG - Intronic
938312049 2:130299582-130299604 ATGGTACTGTCAAAAAAAAGCGG + Intergenic
941942243 2:171052808-171052830 AAGACACTGTCAAATACAGTAGG + Intronic
942431760 2:175919441-175919463 AAGGCACTGTTAAAAACAGAAGG + Intergenic
944795808 2:203184132-203184154 ATGCCACTTGAAAAAAAAGGTGG + Intronic
947257360 2:228181179-228181201 ATTCCAAGGTCTAAAACAGGAGG - Intronic
947269653 2:228319779-228319801 ATTCATATGTCAAAAACAGGTGG - Intergenic
1172191404 20:33063940-33063962 TTGGCACTGTCAGAAACAGGGGG + Intronic
1174510084 20:51044760-51044782 AAGACCCTGTCTAAAACAGGAGG - Intergenic
1176447713 21:6833713-6833735 AGACAACTGTCAAAAACAAGTGG + Intergenic
1176825882 21:13698739-13698761 AGACAACTGTCAAAAACAAGTGG + Intergenic
1177202829 21:17977249-17977271 TTGCCACTGTCAGAAAAAGCAGG + Intronic
1177783889 21:25648996-25649018 AGGCCACTGTTAAAAAGAGGAGG - Intronic
1177854978 21:26390554-26390576 CTGCCACAGTCAAAACCAGCTGG - Intergenic
1183207108 22:36426948-36426970 ATGCCTCTGACACAAACAGGCGG - Intergenic
950729283 3:14942733-14942755 ATTCCACAGTTAAAAAAAGGGGG + Intergenic
954611722 3:51947850-51947872 ATGACACTGTCGAAGCCAGGAGG - Exonic
955018210 3:55092049-55092071 ATGCCACTTTCAAACACAGTAGG + Intergenic
955823156 3:62917842-62917864 CTGCCACTGCCAAAATCAGTGGG + Intergenic
957012262 3:75020657-75020679 ATGTCACAGTTAAAAACAAGAGG + Intergenic
960421727 3:117454544-117454566 AAGCCACTGCCAAAAACACTGGG + Intergenic
964418303 3:156473077-156473099 ATGCCCCTTTCCAAAACAGGGGG + Intronic
969266059 4:6064802-6064824 TTGCAACTATCAAAAGCAGGAGG + Intronic
969869939 4:10098404-10098426 ATGCCACTGTCAAGTTCAAGGGG + Intronic
971664292 4:29461763-29461785 CAGCCACTGTAAAAAACAGTCGG + Intergenic
972476242 4:39452494-39452516 ATGCTATTGACAAAAACAAGTGG + Intergenic
975705789 4:77110849-77110871 ATGCCACTGTGAGAAAAGGGCGG - Intergenic
975711799 4:77168285-77168307 ATGCCAATGGCAGAAAAAGGGGG - Exonic
976831544 4:89320457-89320479 ACTTCACTGACAAAAACAGGTGG - Intergenic
978413749 4:108454059-108454081 ATGCCAGTGGTTAAAACAGGGGG + Intergenic
979974710 4:127182684-127182706 ATGCCACTGGAAAAAAAATGTGG + Intergenic
981898572 4:149834867-149834889 AAGCCACTGAGAAAAACAAGTGG - Intergenic
982307379 4:153947193-153947215 ATGCTACTCTCAAACAAAGGAGG - Intergenic
982583449 4:157207951-157207973 ATGCTCCTTACAAAAACAGGTGG + Intronic
986179106 5:5376745-5376767 AGGCCACTGTCATAGACAGCTGG + Intergenic
986777109 5:11026219-11026241 ATGCCAGGCTCAAACACAGGAGG - Intronic
986883028 5:12198705-12198727 ATGTCAGTGTCATAAACAAGTGG - Intergenic
987594114 5:19973859-19973881 ATCCCAATATGAAAAACAGGGGG - Intronic
988265759 5:28948548-28948570 AAGCCACTGTGGAAAACAGTTGG + Intergenic
989549462 5:42716899-42716921 ATGACACTGTCATGAAGAGGTGG - Intronic
989626800 5:43437364-43437386 ATGCCACTATCAAAAAGCTGTGG + Intergenic
992225180 5:74613378-74613400 AAGACACTGTCAAAAAAAAGTGG + Intergenic
993313847 5:86374294-86374316 CTGCCACTGTGGAAAACAGTTGG + Intergenic
993397518 5:87408719-87408741 AAGCTACTGTAAAAAACAGTTGG + Intronic
994450291 5:99932279-99932301 ATCCCACTGACAAGAACAAGAGG - Intergenic
996821144 5:127629212-127629234 ATGCCACTGGCAAAAAAAAGAGG + Intergenic
999872752 5:155769609-155769631 ATGCCAAGGTTAAAAACTGGGGG - Intergenic
1008086474 6:47250503-47250525 TTGCCTCTGTCAAGAACAGCCGG - Intronic
1009868180 6:69423918-69423940 ATGGCAATGTGAAAAACAGAAGG - Intergenic
1011550175 6:88524786-88524808 ATCCCACTGTCAACATTAGGCGG - Intergenic
1015160445 6:130147128-130147150 ATGCCACTGTCAAAAACAGGAGG - Intronic
1015208493 6:130669207-130669229 CAGCCACTATGAAAAACAGGAGG + Intergenic
1015773002 6:136787906-136787928 AAGCCATACTCAAAAACAGGTGG - Intronic
1015811363 6:137164751-137164773 ATGCCACTCTGAGAAACATGGGG + Intronic
1017047084 6:150356845-150356867 AGGCCACTGAGAAAGACAGGAGG - Intergenic
1018178443 6:161199501-161199523 CTGCCACTGTCATCAACAAGGGG - Intronic
1021769050 7:23980263-23980285 ATGGCACTGTCAGAAGCTGGGGG + Intergenic
1022478347 7:30726666-30726688 GTGCCACTGTCACCAGCAGGTGG + Intronic
1027430401 7:78106301-78106323 ATACCACTGTAATAAACAAGGGG + Intronic
1030133775 7:106226501-106226523 ATGCAACTATCCAAAACTGGGGG + Intergenic
1031555295 7:123167728-123167750 TTGCTTCTGTCAAATACAGGTGG - Intronic
1035480594 7:159179450-159179472 GTGCCTCTGTCAGACACAGGCGG - Intergenic
1036174610 8:6525079-6525101 ATGTTACTGTCAAAAAAAGGTGG - Intronic
1036740551 8:11357489-11357511 ATGCCACTGATAGAAACGGGAGG - Intergenic
1038947105 8:32373293-32373315 TTTACACTGTCAAAATCAGGAGG - Intronic
1041519133 8:58735628-58735650 CTGAAACTGTAAAAAACAGGAGG + Intergenic
1042165373 8:65940538-65940560 ATGGCAACCTCAAAAACAGGAGG + Intergenic
1042505094 8:69551061-69551083 CTGCCACTGTCTCAAAGAGGAGG + Intronic
1043243194 8:77963073-77963095 ATGCCACTCTCCTAAACAGCAGG - Intergenic
1043724031 8:83586459-83586481 ATGCTACATTCAAAAGCAGGAGG - Intergenic
1045960434 8:107961684-107961706 ATGCCCCTGTTTAATACAGGAGG - Intronic
1049749685 8:144277296-144277318 AGGCCACTGTCAGCAGCAGGGGG - Intronic
1050079201 9:1897615-1897637 AAGCCACTGCCAAAATCAGAAGG + Intergenic
1050465701 9:5920942-5920964 TTTCCACTGACTAAAACAGGAGG + Exonic
1050646174 9:7721810-7721832 ATGCAACTGACCACAACAGGAGG - Intergenic
1051041147 9:12812772-12812794 AGGCCACTGTTATAAACAGTAGG - Intronic
1051863782 9:21655394-21655416 ATGCCACTGTCAGAACCAAAAGG - Intergenic
1052809978 9:33049628-33049650 AAGCCACTGTCAAGAAAATGAGG + Intronic
1053273359 9:36765365-36765387 ACGCCACTGACAGAAAGAGGAGG + Intergenic
1055920618 9:81456588-81456610 ATGCCACTGACCAAATCAGGAGG - Intergenic
1056535944 9:87527786-87527808 ATGTCACTTGCAAAAAGAGGAGG - Intronic
1057176222 9:93002278-93002300 TGCCCAATGTCAAAAACAGGAGG + Intronic
1058627804 9:106953448-106953470 ATGCCACAGACAAAAAAAGAAGG - Intronic
1059778387 9:117500384-117500406 ATGCCACTGACTGAAACAGAGGG - Intergenic
1203521478 Un_GL000213v1:50818-50840 AGACAACTGTCAAAAACAAGTGG - Intergenic
1203360522 Un_KI270442v1:216991-217013 TTGCCACCCGCAAAAACAGGAGG - Intergenic
1186460365 X:9743668-9743690 AGGCCACTGTGAAGAACAGAAGG + Exonic
1187880299 X:23841075-23841097 ATGGCAGTCTGAAAAACAGGAGG + Intronic
1188486334 X:30686193-30686215 ATGACATTCTCAGAAACAGGTGG - Intronic
1195678993 X:107529667-107529689 ATGCCACTGTCCAATAAATGAGG - Intronic
1198274999 X:135091816-135091838 CAGCCACTGTGGAAAACAGGTGG - Intergenic
1202263787 Y:22996998-22997020 ATGTCACTCTCAAAGACAAGGGG + Intronic
1202416778 Y:24630740-24630762 ATGTCACTCTCAAAGACAAGGGG + Intronic
1202454009 Y:25039346-25039368 ATGTCACTCTCAAAGACAAGGGG - Intronic