ID: 1015161831

View in Genome Browser
Species Human (GRCh38)
Location 6:130160809-130160831
Sequence TTTCAAATGTAAAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 1, 2: 10, 3: 82, 4: 612}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015161827_1015161831 10 Left 1015161827 6:130160776-130160798 CCAGGATAATGGATTGTCAACGA 0: 1
1: 0
2: 1
3: 1
4: 38
Right 1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG 0: 1
1: 1
2: 10
3: 82
4: 612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015161831 Original CRISPR TTTCAAATGTAAAATGTGGA AGG Intronic
901113538 1:6819121-6819143 TTTTAAATATAAAATGTTGAGGG + Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904395455 1:30218270-30218292 TTTTAAAAGAAAAATGGGGAGGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
905196699 1:36284903-36284925 TTTCAAATGAAAAGTGTGGAAGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906724027 1:48030583-48030605 TTTCCAATTGAAAATGTAGATGG + Intergenic
907025298 1:51111956-51111978 TCTAAAAGGTAAAATGAGGATGG - Intronic
907536006 1:55157943-55157965 TTCCACATATAAAATTTGGAGGG - Intronic
907770467 1:57457347-57457369 TAACAAATGTAATATGTGAATGG - Intronic
908336705 1:63132970-63132992 TTTCAAAGATAAAATGATGATGG + Intergenic
908618330 1:65948159-65948181 TTCCAAATGTACAATTGGGATGG - Intronic
908888240 1:68814604-68814626 GTTCAAATGTGAAAAGTGGCTGG + Intergenic
908900061 1:68946368-68946390 TTTCAACAATAAAATTTGGAAGG - Intergenic
910255897 1:85247240-85247262 TTTTAAATTTAAAATATGAATGG - Intergenic
910500235 1:87882191-87882213 TTTCATAGATAAAATGTGGCTGG + Intergenic
910521703 1:88129426-88129448 CTTAAAATGTTACATGTGGAAGG + Intergenic
910574743 1:88748371-88748393 TTTCAAAGGCAATATGCGGAGGG - Intronic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910893055 1:92038209-92038231 TTCTAAATGTAAAATGTTGCAGG + Intronic
911145897 1:94552310-94552332 TCTCAAGGGTAAAATGGGGAAGG - Intergenic
911203214 1:95067343-95067365 TTTTAAAGCTAAAATGGGGAGGG - Intronic
911723651 1:101218797-101218819 GTTCAAATTAAAAATGTGGAAGG - Intergenic
911819273 1:102396130-102396152 TTTGGAAGGGAAAATGTGGAGGG - Intergenic
912870325 1:113298462-113298484 TTTCACAGGTAAAATGTAGAAGG - Intergenic
912916817 1:113823773-113823795 TTTCAAATGGAAATTATGGTAGG - Intronic
912997475 1:114545648-114545670 TTTCAAATGAATATTGGGGAGGG - Intergenic
913381413 1:118215188-118215210 TTTCAACTGTGAAATATGGTGGG + Intergenic
913567581 1:120088292-120088314 TTTCAAATGTGGTATGTGGATGG - Intergenic
913665830 1:121048152-121048174 TTTCAACTGTAATATGAGGATGG - Intergenic
913918387 1:124802082-124802104 TTTCAAACGTGAACTGTGAAAGG - Intergenic
914017230 1:143831428-143831450 TTTCAACTGTAATATGAGGATGG - Intergenic
914160556 1:145129570-145129592 TTTCAACTGTAATATGAGGATGG + Intergenic
914288329 1:146248999-146249021 TTTCAAATGTGGTATGTGGATGG - Intergenic
914549366 1:148699745-148699767 TTTCAAATGTGGTATGTGGATGG - Intergenic
914617318 1:149371973-149371995 TTTCAAATGTGGTATGTGGATGG + Intergenic
914655841 1:149739968-149739990 TTTCAACTGTAATATGAGGATGG - Intergenic
915866905 1:159510756-159510778 TATCAAATGTAAATTGTGCTAGG - Intergenic
916990174 1:170234938-170234960 TGTCAACTTAAAAATGTGGAAGG - Intergenic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917227090 1:172795819-172795841 TTTCGAAGGAAAAATGAGGAGGG + Intergenic
917817104 1:178722410-178722432 TTTCAAATGTATATAGTGGCTGG - Intergenic
918290196 1:183099967-183099989 TTTCAAATGAACCAAGTGGAGGG - Intronic
919193595 1:194254911-194254933 TTTCAAAGGTAAAATGTCATAGG + Intergenic
919238182 1:194873679-194873701 TCTGATATGTAAAATCTGGATGG + Intergenic
919260462 1:195186880-195186902 TCTTAAATGTAAAATGTGTCAGG - Intergenic
919376557 1:196801536-196801558 TTACAAATATAAAATATGGCAGG + Intergenic
919678857 1:200413520-200413542 TTTCAAAAGTAAAATATTAAAGG + Intergenic
920160078 1:203990609-203990631 TTTAAAATGAAAGATGTGGCCGG + Intergenic
920638226 1:207725811-207725833 TTTCAAGTGTAAAAAGTTAATGG - Intronic
921403274 1:214750393-214750415 TTTGAAAAGTAAAATGCAGAAGG - Intergenic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
922113647 1:222588329-222588351 TTTCAAGAGGAATATGTGGAGGG - Intronic
922632420 1:227129929-227129951 TTTCAGACATAAAATTTGGAAGG - Intronic
922632593 1:227131669-227131691 TTTCAGATGTAAACTTTGGAAGG - Intronic
923150631 1:231230298-231230320 TTTTAGATGTAAAATTTAGAGGG + Intronic
923254159 1:232205573-232205595 CTTTAAATGTAAAATGTTGTTGG - Intergenic
923288735 1:232523057-232523079 TTTCAAATGTAAGTTGTAGTTGG - Intronic
923516937 1:234705928-234705950 TTTAAAATTTAAAATCTAGATGG + Intergenic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
924319543 1:242834783-242834805 TTTCTAATGTAAAATATATATGG - Intergenic
924592594 1:245417868-245417890 TTTCTCATCTAAAATTTGGAGGG - Intronic
924796625 1:247297366-247297388 TTTAAAAAGTAAAATGTGGCTGG - Intergenic
1062784124 10:247074-247096 TTACAAATGTAAAAAAGGGAAGG - Intronic
1062982704 10:1738215-1738237 TGCCAAATGTAATATTTGGATGG + Intergenic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1063147953 10:3313660-3313682 TTCCAAATAACAAATGTGGAAGG + Intergenic
1063466218 10:6246672-6246694 TTTAAAATGTTAGATTTGGAGGG + Intergenic
1063882964 10:10549984-10550006 GTTCAAAGGTCAAATGTGTATGG - Intergenic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1065111048 10:22440132-22440154 ATTTAAATGTGAAATGTGGAAGG - Intronic
1065148130 10:22793586-22793608 TGTCAAATGGTAAATGAGGAGGG - Intergenic
1065200967 10:23312731-23312753 TTTCAAACGTTAAATGTTGCTGG + Intronic
1065475055 10:26126858-26126880 TTTAAAATCTAAGATTTGGATGG - Intronic
1065673669 10:28150952-28150974 TTTCAAGTATAAAATATGAAAGG - Intronic
1065849034 10:29771549-29771571 TTTCAGATGTAAAGTGAGAAAGG - Intergenic
1066342543 10:34550221-34550243 TCTCAAAGATAAAAGGTGGAGGG - Intronic
1067688231 10:48480750-48480772 TCTCATCTGTAAAATGTGGTTGG - Intronic
1067917203 10:50413039-50413061 TTTAAAATGTAAGATTTGGAAGG - Intronic
1068036245 10:51763547-51763569 TTTAAAATATATAATGTGGCTGG - Intronic
1068212929 10:53945106-53945128 TTTTACATGTAAAATTTAGAAGG - Intronic
1068291968 10:55015183-55015205 TTTTAAGTGTAAAATGTGGTGGG - Intronic
1068994819 10:63190692-63190714 TTTCCAAGGTGAAAGGTGGAGGG - Intronic
1069260823 10:66393979-66394001 TTCCAAATGTATAATGGGAAGGG + Intronic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1070057769 10:72952195-72952217 TATCAAAGGTAAAATCTGGCTGG + Intronic
1070177363 10:73982911-73982933 TTTGAAAGGTAAAATGTTCACGG + Intergenic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1074209910 10:111320993-111321015 CTTGAAATGTAAAATGAGGCAGG + Intergenic
1074792804 10:116908453-116908475 TTTCAAATGTAAAGTGGCTATGG - Intronic
1074805414 10:117045864-117045886 GTTCTAATGAAAAAAGTGGATGG + Intronic
1074899942 10:117807344-117807366 ATCCAAATGTTAACTGTGGAGGG - Intergenic
1074913886 10:117937647-117937669 TCTCATCTGTAAAATGTTGATGG - Intergenic
1075905845 10:126081347-126081369 TTTAAACTGAAAAATCTGGATGG - Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076506378 10:130975818-130975840 CTTCAAGTGTACAATGTGGTGGG + Intergenic
1076555807 10:131320782-131320804 TGTAAAATGTAAAATGTCCAGGG + Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1077452585 11:2658272-2658294 TTCCAAATAAAAAATGTAGAAGG - Intronic
1077847034 11:6036823-6036845 TTTCAAATCTAAATTTTAGAGGG + Intergenic
1077940917 11:6842280-6842302 TTTAAAATGTTACATGTGCATGG - Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078351988 11:10602375-10602397 TTTCAAGTATAAAATGAGGATGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078705212 11:13737324-13737346 TTTCAAATGGGAGATGGGGAAGG - Intergenic
1078853416 11:15185879-15185901 TGTCAAATTAAAAATGTGCAAGG + Intronic
1079059767 11:17238147-17238169 TTTAAATTTTAAAATGTGGCTGG - Intronic
1080493017 11:32787675-32787697 ATGTAAATGTAAAATATGGATGG + Intronic
1081540099 11:44028421-44028443 TTTCAAGTGCTAAATGTGGCTGG - Intergenic
1082724897 11:56722716-56722738 ATTCAAATGTTAAATGTAGATGG + Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083318452 11:61830214-61830236 TTTCATAGGTAAATTGTAGAAGG + Intronic
1084146584 11:67268131-67268153 TCTCATCTGTGAAATGTGGATGG + Intronic
1084439560 11:69164800-69164822 TTTCAACACTAAAATGGGGAGGG + Intergenic
1085357317 11:75850286-75850308 TTTCAATTGGAAAATCAGGAAGG + Intronic
1085719988 11:78904062-78904084 TTTTAAAAGTAAAACGTGGCCGG + Intronic
1086159875 11:83710115-83710137 TAACACATGTGAAATGTGGATGG + Intronic
1086235073 11:84619752-84619774 TTTTAAATGTAAAATATTTAAGG + Intronic
1086306410 11:85485403-85485425 TCAAAAATTTAAAATGTGGAAGG + Intronic
1087495666 11:98887893-98887915 ATCCAAATGTAAAATATGGAAGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088005772 11:104938127-104938149 TTTCAATTTAAAAATGTGGGAGG + Intergenic
1088040351 11:105374305-105374327 TTTCAAGTCTAAAATCTAGATGG - Intergenic
1088202943 11:107359747-107359769 TTTCCTTTGTAAAATGTAGATGG - Intronic
1088455241 11:110026558-110026580 TTTCAACTGTAGAATGAGGGAGG - Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090630810 11:128645723-128645745 TTTCAAATGTTAAATGAGAGGGG - Intergenic
1090746255 11:129707317-129707339 TTTAAAATGTAAATTTTGGCTGG - Intergenic
1091056659 11:132425475-132425497 TTTTATGTATAAAATGTGGAAGG + Intronic
1091114244 11:132998633-132998655 TTCCACATATAAAATTTGGAGGG - Intronic
1091129017 11:133128376-133128398 TTTCGAATGTAAAAAGTAGGAGG + Intronic
1091145938 11:133280497-133280519 CTTGAAATTTAAAATGGGGAGGG - Intronic
1091904834 12:4176792-4176814 ATTAAAATGTATAATGTGAAAGG - Intergenic
1092137071 12:6157237-6157259 TTTTAAATGTATAATGTATATGG + Intergenic
1092976313 12:13748438-13748460 TGACAAATGAAAAATGTAGACGG + Intronic
1093886865 12:24471591-24471613 TTCTAAATGTTAAATGAGGATGG + Intergenic
1094163902 12:27422474-27422496 CTTCAAGTGTGAAATGTGCAGGG + Intronic
1094246917 12:28308769-28308791 TGTCAAATGTAAAAGGTGCTAGG - Intronic
1094462251 12:30708993-30709015 TCTCAAATGTAAAATGTGAATGG - Intergenic
1094749209 12:33386023-33386045 TTTCAAAAAACAAATGTGGACGG - Intronic
1095157805 12:38879699-38879721 TTTCAAATTTCATCTGTGGAAGG - Intronic
1095304453 12:40623264-40623286 ATTCAAATGTAGAATGTTAAAGG - Intergenic
1095321035 12:40827346-40827368 TTTCATTTCAAAAATGTGGAAGG - Intronic
1095459725 12:42430344-42430366 TTTCAAATGTTAAGGGTGGCGGG - Intronic
1095679703 12:44960007-44960029 TTTCAGATGTGAAGGGTGGATGG + Intergenic
1096121759 12:49093174-49093196 TCTCAGATGTAAAATGAGGGTGG + Intronic
1096541748 12:52311835-52311857 TTTCAAATGTAAGCTTTGCAGGG + Intergenic
1096909406 12:54967017-54967039 TATCTAATGTAAAATGCAGAAGG - Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097515647 12:60602000-60602022 TTTCTAATGTGAAATGTTGGAGG + Intergenic
1097605474 12:61747923-61747945 ATTTAAAATTAAAATGTGGAAGG + Intronic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098826513 12:75304537-75304559 TTACAAATAAAAAATCTGGAGGG + Intronic
1098892115 12:76019991-76020013 TTTTCACTGTAAAATGGGGAAGG + Intergenic
1099420728 12:82456673-82456695 TTTCCAATGTAAATTTTAGATGG - Intronic
1099638909 12:85257985-85258007 ATTCAAATGTAAAATATGCATGG + Intronic
1099837578 12:87926745-87926767 TCTCAATTATAAAATGAGGATGG - Intergenic
1099980545 12:89596740-89596762 TTTCAAATTTAAAATTTTGAGGG + Intronic
1100046027 12:90382240-90382262 TTTAGAATGTGAAAGGTGGAAGG - Intergenic
1100207446 12:92366105-92366127 TTACAAATGTAGACTGTGGCAGG + Intergenic
1100361434 12:93883343-93883365 TTTTAAATGTCAAAAGTGTAGGG - Intronic
1100403745 12:94254524-94254546 TTTCACTTGTAAAATGAGTAAGG + Intronic
1100856374 12:98761053-98761075 TCTCACACGTAAAATGAGGATGG - Intronic
1101015200 12:100493305-100493327 TTTCAATTGAAAAATTTGGATGG + Intronic
1101100013 12:101382107-101382129 TTAAAAATGTAAAATGGGGCTGG + Intronic
1101299885 12:103468337-103468359 TTCCAAATGTAACCTGTGCATGG + Intronic
1101451088 12:104779942-104779964 TTCCAAATGTTCAATGGGGATGG - Intergenic
1101612567 12:106304272-106304294 TTTCAAATGTGAAAAGTGCCAGG + Intronic
1101717660 12:107324778-107324800 TTTTAAATGTACAATTTGAAGGG + Intronic
1102299402 12:111760072-111760094 TTTCAAATGAGAAATCTGGCCGG - Intronic
1102725768 12:115063276-115063298 TTTTATTTGTAAAATGGGGATGG + Intergenic
1104166981 12:126241461-126241483 TTTCAAATGGAACATCTGTAAGG + Intergenic
1104255363 12:127131585-127131607 TTTAAAATGTTAAAAGTGGATGG - Intergenic
1104265573 12:127229339-127229361 CTTCAAAGGTGAGATGTGGAGGG + Intergenic
1104320116 12:127742938-127742960 TTTCAAAGGTAATTTGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1105584411 13:21730724-21730746 TTCCAAAAGAAAAATCTGGAAGG + Intergenic
1105770782 13:23610089-23610111 TGTTAAATTTTAAATGTGGATGG - Intronic
1106003147 13:25743590-25743612 TTACAAATGAAACATGTGGCCGG - Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106068052 13:26377540-26377562 TTTCAAATTTAAACAGAGGAAGG + Intronic
1106808072 13:33332015-33332037 TTTATGATGTAAAATGTGGAAGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107327509 13:39260776-39260798 TTTCAAAGGGTAAATGTGGATGG - Intergenic
1108326878 13:49341889-49341911 TTTTAAGTGTAAAATGTGAGGGG - Intronic
1108731252 13:53238090-53238112 TTCCAAATGAAAAATTTTGAGGG - Intergenic
1108830122 13:54467200-54467222 TTTCACTTGTAAGATTTGGATGG + Intergenic
1108838832 13:54585923-54585945 AAACAATTGTAAAATGTGGAAGG - Intergenic
1109269125 13:60234780-60234802 TTTTAAAGGTAAAATGAGGAGGG - Intergenic
1109299529 13:60576669-60576691 TTTCAAAAGTAAAAAGTGCTAGG + Intergenic
1109677057 13:65690852-65690874 TTTTAAATTTCAAATGTAGAAGG - Intergenic
1109759036 13:66802527-66802549 ATTCAACTGAAAAATGTGGCAGG + Intronic
1110300590 13:73922223-73922245 ATTCATATGTAAAATGTTTAAGG - Intronic
1110762521 13:79245980-79246002 TTTCACGTGGAAGATGTGGAAGG + Intergenic
1111118543 13:83815081-83815103 TTTTAAAGGTAAAATGAAGAGGG - Intergenic
1111228269 13:85305174-85305196 TTTCAACTAGTAAATGTGGAAGG - Intergenic
1112673834 13:101674307-101674329 TTTTAAAGGTAAAGTGAGGAGGG - Intronic
1112757694 13:102656721-102656743 TCTCAGATTTAAAATGTGAAAGG + Intronic
1112812204 13:103231888-103231910 TTTTAAAGACAAAATGTGGAGGG - Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113241027 13:108337255-108337277 GTTAAAGTGTAAAATGTGGATGG - Intergenic
1114230442 14:20776844-20776866 CTTCAAAAGGAAAATATGGAAGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1114597938 14:23930135-23930157 TTTCAAATCTGAAATCTGCAGGG - Intergenic
1115505547 14:34090479-34090501 TTTCATTTGTAAAGTGTTGAGGG + Intronic
1116379849 14:44251917-44251939 TGTAAAATGTAAAATGAGGGAGG + Intergenic
1116405303 14:44559117-44559139 TTTAAAATGTAAAATGTGGCCGG + Intergenic
1117066421 14:52016517-52016539 TTTGACATATCAAATGTGGATGG - Intronic
1117290828 14:54330921-54330943 TTTCAGAGGTAAAGTGAGGAGGG - Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1118514954 14:66517182-66517204 TTTCAGATGTAAAAAGATGAAGG + Intronic
1118537533 14:66784573-66784595 AATCATATTTAAAATGTGGAAGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1119461881 14:74812085-74812107 TTACATATGAAAAATGTGTATGG - Intronic
1119540674 14:75436137-75436159 CTTCAAAAGTGAAATGTAGATGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119574389 14:75705578-75705600 TTTAATCTATAAAATGTGGATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120633469 14:86921407-86921429 TTTAAAATAAAAAAAGTGGAAGG - Intronic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122105592 14:99452003-99452025 TTTACAATGTAAAAACTGGAAGG + Intronic
1124021344 15:25927364-25927386 ATTCAAAAGTAAAATTAGGATGG - Intergenic
1125047760 15:35262223-35262245 TTTTAAATGGGAAATCTGGAAGG - Intronic
1125431395 15:39598018-39598040 TAAAAAATGTAAAATTTGGAAGG + Exonic
1125774675 15:42201469-42201491 TTTAAAATGTACAATTTGGCTGG - Intronic
1127143751 15:56003333-56003355 TTTTAATAGTTAAATGTGGAAGG - Intergenic
1127951943 15:63816482-63816504 TTTCAAAAGTAATTTGTGCAGGG - Intronic
1130865723 15:87931867-87931889 GTTCAAATGTAAATTATAGAAGG - Intronic
1130942066 15:88519095-88519117 TTTCAAAGGTAAAATGATGGGGG + Intronic
1130954287 15:88615957-88615979 TTTCAGATTGAAAATGCGGAGGG + Intergenic
1131552130 15:93366070-93366092 ATTCAAGTGTAAACTGAGGATGG + Intergenic
1131623332 15:94090481-94090503 TGTCAAATGTAACATTTCGAGGG + Intergenic
1133140668 16:3741506-3741528 TTTAAAAAGAAAAATGTGGCCGG + Intronic
1133848853 16:9482788-9482810 TGTAAAATGTGACATGTGGATGG - Intergenic
1133858613 16:9573318-9573340 CTGCAAATGCAAAGTGTGGATGG + Intergenic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134566172 16:15253649-15253671 TTTCAAATAAAAACTGGGGAAGG + Intergenic
1134736323 16:16503049-16503071 TTTCAAATAAAAACTGGGGAAGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134931194 16:18209118-18209140 TTTCAAATAAAAACTGGGGAAGG + Intergenic
1135085915 16:19474389-19474411 TTTCAAAAGTAAGGTGTGGCTGG + Intronic
1135348147 16:21706772-21706794 TCTCAAATGTCAAATGTGTTTGG - Intronic
1135409850 16:22225480-22225502 TTTCGAATTTAAAATGTGCCTGG + Intronic
1136588132 16:31201137-31201159 TCTCCAGTGGAAAATGTGGAAGG + Intergenic
1137315817 16:47321447-47321469 TTTCAAAAGTAAAAAGTAAATGG - Intronic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1137870901 16:51949334-51949356 TTTCTAATGTAAATTCTAGATGG + Intergenic
1137994994 16:53200575-53200597 ATTCCAATTGAAAATGTGGAAGG + Intronic
1138748385 16:59389923-59389945 TTACAAATGTACAATGTTTACGG + Intergenic
1138897033 16:61219046-61219068 TTTCAGAGGGAAAATTTGGATGG + Intergenic
1138962705 16:62046306-62046328 TCTCAAAGGAAAAATCTGGATGG + Intergenic
1139275699 16:65725571-65725593 TTTCAAAGGAAATATTTGGAAGG + Intergenic
1139445305 16:66994543-66994565 TTTGAAATGTTAAATGAGGTCGG + Intronic
1139454609 16:67063183-67063205 TTTTAAATGCACAGTGTGGAAGG + Intronic
1140290991 16:73657158-73657180 TTTAAAATGTACAATTTGGCTGG + Intergenic
1140620523 16:76725546-76725568 TTTCATATTTAAAATGTTCAAGG + Intergenic
1141458598 16:84162304-84162326 TTTAAAGTGTACAATGTGGCTGG + Intronic
1142839608 17:2617338-2617360 TTTCCTATGTAAATTTTGGATGG + Intronic
1142896627 17:2983750-2983772 TTTTTAATGTAAAAGTTGGAAGG + Intronic
1144367357 17:14557234-14557256 TGTCAAAAGAAAAATGTGGCCGG + Intergenic
1144715124 17:17429039-17429061 ATTTACATGTAAAATGTGTAAGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145472795 17:23563927-23563949 TTTCAAACGTAAACTTTGAAAGG - Intergenic
1145481774 17:23694405-23694427 TTTCAAATGTGAACTTTGAAAGG - Intergenic
1145492238 17:23846392-23846414 TTTCAAATGTGAACTTTGAAAGG - Intergenic
1145676150 17:26521706-26521728 TTTCAAATGTGAACTTTGAAAGG - Intergenic
1145683740 17:26631946-26631968 CTTCAAATCTAAAATATTGAAGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146472275 17:33134191-33134213 TCTTATATGTAAAATGGGGATGG - Intronic
1146817591 17:35955632-35955654 TTTAAAATGTGATATGTGTATGG - Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1148069238 17:44897859-44897881 TTAAAAATGTAAAATGTGGCCGG - Intronic
1149970002 17:61208135-61208157 TTTCAAATCTAAATTCAGGATGG + Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1151123992 17:71825295-71825317 TTTAAAAAGTGAAATGTGTAGGG - Intergenic
1152235246 17:79135238-79135260 TTTCAACTGTAAAATGGGACAGG + Intronic
1153347196 18:4039688-4039710 CTTCAAATATAAAATGGTGATGG + Intronic
1155005470 18:21725289-21725311 GAAAAAATGTAAAATGTGGAAGG + Intronic
1156598028 18:38570434-38570456 TTTAGAATGTAAAACGTGGTAGG + Intergenic
1156874660 18:41994435-41994457 TTTTAAATGTAAACTTTGGGTGG + Intronic
1157042211 18:44053453-44053475 TTTGAATTGGAAAATGTGGAAGG + Intergenic
1157175910 18:45452028-45452050 TTTCAAATCAAAAATATGGGGGG + Intronic
1157232354 18:45930005-45930027 CTTAAAGTGTAAAATGTGCAAGG + Intronic
1157431252 18:47628671-47628693 TTTCAAATGGAAGAAATGGATGG - Intergenic
1157785572 18:50479049-50479071 TTTTAAAGGTAAAATGAGGAAGG + Intergenic
1158173057 18:54620727-54620749 TTGCAGAAATAAAATGTGGAAGG - Intergenic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158784555 18:60693850-60693872 ATTTTAATGTACAATGTGGATGG + Intergenic
1159088557 18:63821247-63821269 TTTCCAATGGGAAATGGGGATGG + Intergenic
1159730078 18:72015070-72015092 CTTCAAATGAAACATGTAGATGG - Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160165189 18:76505283-76505305 TTTCAAAGATAACATGTAGACGG + Intergenic
1160516393 18:79481418-79481440 TTTCTAATGTAAAACGAGGCGGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1163524912 19:17814915-17814937 TTTCAAAAATAAAATGAGGCTGG + Intergenic
1163671997 19:18635006-18635028 TTTCAAATGTTATTTGTGGCGGG + Intergenic
1165251804 19:34544204-34544226 TATCAGAAATAAAATGTGGAAGG + Intergenic
1165274877 19:34740323-34740345 TATCAGAAATAAAATGTGGAAGG - Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925548956 2:5049460-5049482 TTGCAAATGTAAAATGTTACTGG + Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926778619 2:16446838-16446860 CTTTAAATTTAAAATTTGGAGGG + Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
927154723 2:20214946-20214968 TCTCATCTGTAAAATGTGCATGG - Intronic
927307620 2:21591468-21591490 TGTCTAATGCAAAATATGGATGG + Intergenic
927935914 2:27076481-27076503 TTTGCAATGTAGAATTTGGAAGG + Intergenic
928052754 2:28017339-28017361 TTAGAAATGTAAAATGTTGTTGG + Intronic
928187131 2:29121403-29121425 CTTCTAATGGAAAATCTGGAAGG - Exonic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
928914800 2:36459312-36459334 TTTCAAAATTAGTATGTGGAAGG - Intronic
928954744 2:36852858-36852880 ATTTAAATATAAAATGTGGCTGG + Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
929905560 2:46043049-46043071 CTTCAAATGTTTAATTTGGATGG - Intronic
929932252 2:46267372-46267394 TTTCAACTAATAAATGTGGAAGG + Intergenic
930057449 2:47263014-47263036 TTTCACAGGTAAAATGAGAATGG + Intergenic
930224711 2:48780501-48780523 TTTAAAATGTATAATTTGGTGGG - Intergenic
930299868 2:49601980-49602002 TTTCAAATGGAAATTGTGAAAGG - Intergenic
930342770 2:50138150-50138172 TTGTAAATGAAATATGTGGAAGG - Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
930421526 2:51159197-51159219 ATTCAAATGTAAAAAGTGCATGG - Intergenic
931484478 2:62676439-62676461 TTTTAAATGTAAATTCTGAAAGG - Intronic
932281372 2:70495358-70495380 ATGCTCATGTAAAATGTGGAGGG - Intronic
933005474 2:76987959-76987981 TTTCAAATGCTAAATATGCAGGG + Intronic
933393704 2:81705316-81705338 TTCTAAATGTAAACTGTGGTAGG + Intergenic
933415265 2:81979262-81979284 ATTGAATTGTAAAATGTGAAAGG + Intergenic
933447415 2:82399495-82399517 TCAAAAATGTAAAATGTGGGGGG - Intergenic
933486214 2:82927470-82927492 TTTAGAAGGTAAAATGCGGAAGG - Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
934731839 2:96663744-96663766 TTTAAAATGTACAATTTGGCTGG + Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935946545 2:108291474-108291496 TTTCAAATGTATATTGTTGTAGG - Intronic
936169961 2:110162214-110162236 ATTCAACTGTAAACTATGGAGGG - Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
936779373 2:116013727-116013749 TTTAAAATATAACATGTGGCTGG - Intergenic
936807385 2:116352256-116352278 TTACAAGTGTATATTGTGGATGG - Intergenic
937950731 2:127386038-127386060 TTACAAAGTTAACATGTGGATGG - Intronic
938276604 2:130031223-130031245 ATTCAAATGAAAAATGTTGAAGG + Intergenic
938327567 2:130421989-130422011 ATTCAAATGAAAAATGTTTAAGG + Intergenic
938362379 2:130699489-130699511 ATTCAAATGAAAAATGTTTAAGG - Intergenic
938438769 2:131306129-131306151 ATTCAAATGAAAAATGTTGAAGG - Intronic
938922747 2:136009927-136009949 TTTAAAATGTAAGGTTTGGATGG + Intergenic
939311657 2:140486403-140486425 TTCCAAATTTGAAATGTGGTGGG - Intronic
939442745 2:142270990-142271012 ATCCAAATGTAACATGTGGATGG - Intergenic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
940708710 2:157135820-157135842 TTAAAAATGTAAAATGGGGCCGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941808789 2:169734868-169734890 TAATAAATGCAAAATGTGGATGG - Intronic
941876274 2:170436777-170436799 CTTCAAAGGTAAAAAGTGGGAGG + Intronic
941890661 2:170577886-170577908 TTCCAAATATTAAATGTGAAGGG + Intronic
942700573 2:178704307-178704329 TACCAAATGTAAAATCTGAATGG - Exonic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
943444040 2:187960855-187960877 TTTTAATTTTAAAATGTGAAGGG - Intergenic
943736358 2:191359889-191359911 TTTCAAATGGGAAAGGAGGAAGG - Intronic
943964359 2:194313549-194313571 TTTCAAATGTAAAATATTTCAGG + Intergenic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
944915896 2:204359867-204359889 TTTCAAATGTACAATTTGCATGG + Intergenic
945454951 2:210040930-210040952 TTTCAAATGCAAAGTTTGTAGGG - Intronic
945619679 2:212119348-212119370 TTTAAAATGTAAAAGCTGGTGGG + Intronic
947178491 2:227391274-227391296 TTTCAAATCTAACTTTTGGAAGG + Intergenic
947226465 2:227845205-227845227 TTTCAAATGTACATTGTTTAAGG + Intergenic
947671514 2:231939493-231939515 TATTAAATATAAAATGTGGAAGG - Intergenic
1168767874 20:394342-394364 GTTCTAATATAAAATGTAGAAGG - Intronic
1169763743 20:9126450-9126472 TTTAAAACTTAAAATATGGAAGG - Intronic
1169799557 20:9500879-9500901 TTTCAAATGTTAAATGTGGGAGG - Intergenic
1170085087 20:12522168-12522190 TCTCAAGTATAAAATGTGAATGG - Intergenic
1170651903 20:18250737-18250759 TTTCATATGTAAAAAGAGTAGGG + Intergenic
1171026073 20:21631556-21631578 TTTCAAAACAAAAATGTGGAAGG - Intergenic
1171515632 20:25730734-25730756 TGTCAAATATTAAATTTGGAGGG - Intergenic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174683823 20:52434413-52434435 TTTCAAATAAAAAGTGAGGATGG - Intergenic
1174776887 20:53351559-53351581 TTTGAAAGATAAAATGTGGCAGG + Intronic
1174882833 20:54299518-54299540 TTTCAAAAGTTAAATGTAGGAGG - Intergenic
1176276579 20:64274218-64274240 TTTCAAAGGAAAAATTTTGATGG + Exonic
1176920921 21:14686447-14686469 TTACAAATGTAATGTGTGGTTGG - Intergenic
1177019417 21:15835415-15835437 TGACAAATGTAAAATGAGGATGG - Intronic
1177153673 21:17480334-17480356 ATTAAAAAGTAAAATGTGGCTGG + Intergenic
1177280151 21:18971618-18971640 TTTCCAATGAAAAATATGGTTGG - Intergenic
1177462120 21:21426167-21426189 TTCAACATATAAAATGTGGAGGG + Intronic
1177993758 21:28070915-28070937 TTTTAAATGTAAAATGTCTATGG + Intergenic
1178974096 21:37207374-37207396 TTTCAAATGTGAAATGAGAAAGG - Intergenic
1179280079 21:39926449-39926471 TTTTAAATGTAAAATGTTGCTGG - Intronic
1179934629 21:44594278-44594300 AATCAAATGTAAAGTGGGGAAGG + Intronic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1181380225 22:22496435-22496457 TTTCAAAAGTAAGCTGAGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181930857 22:26400484-26400506 TTTAAAATGTCACATGTGGCCGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1184028885 22:41879247-41879269 TTTGAAATGTAATATTTGGAAGG + Intronic
1184949585 22:47831650-47831672 TGTCAAGTGTAAAATAAGGACGG - Intergenic
949100475 3:138275-138297 TTTTAAAGGTAAAATGATGAGGG + Intergenic
949656096 3:6221751-6221773 ATTCAATGGTCAAATGTGGAAGG - Intergenic
951160493 3:19413841-19413863 TTTTAAAGGGAAAATGTGAAAGG - Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
954428690 3:50457727-50457749 CTTCATATATAAAAGGTGGAGGG - Intronic
955659609 3:61283267-61283289 TGTCAAATGGAAAATGAGAAAGG - Intergenic
955728222 3:61955261-61955283 TTTTAACTGGAAAATGTGAATGG + Intronic
955768888 3:62370869-62370891 TTTCAAATGAAAAATATTGGAGG - Intronic
955991665 3:64634254-64634276 TTTAAAATGTAGAAGGTGAAAGG + Intronic
956349964 3:68323582-68323604 TTTCAAGGCTAAAATGTGCATGG + Intronic
956546948 3:70415055-70415077 TGTCAACTGTAAAATGAGGGGGG + Intergenic
956699067 3:71942787-71942809 TCTCATGTGTGAAATGTGGATGG + Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957371236 3:79297080-79297102 TTTCAAATACAAAATGTAGTTGG + Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958004654 3:87795491-87795513 TTTCCAATATGAAAGGTGGACGG + Intergenic
959161637 3:102731780-102731802 CTTTAAATGTAACATGTAGAAGG - Intergenic
959834885 3:110906431-110906453 TTTCAATTAAAAAATGGGGAGGG + Intergenic
960045875 3:113197668-113197690 TTTCAAATAATAAATGTAGAAGG - Intergenic
961298513 3:125906045-125906067 TTTCAAGTGTACAATTTGGCCGG - Intergenic
961559967 3:127721960-127721982 TTACATATTTAAAAGGTGGAAGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963261800 3:143200074-143200096 TTTCACCTGTAATATGAGGAAGG + Intergenic
963359130 3:144248115-144248137 TTTCATATATAAAATGAGAAGGG - Intergenic
963892284 3:150649223-150649245 TGTCAACTGAAAAATGTGCAAGG + Intergenic
964166612 3:153714435-153714457 CTGCTAAAGTAAAATGTGGATGG - Intergenic
964435342 3:156645522-156645544 TCTCAAATGTAAAAGGTGGGAGG - Intergenic
964529045 3:157647310-157647332 TTTCTAATGTGAAATGTGATTGG + Intronic
965070490 3:163910764-163910786 TGTGAAATGAATAATGTGGAGGG - Intergenic
965350097 3:167600583-167600605 TTGAAAATGTAAAATAGGGATGG - Intronic
966019696 3:175192905-175192927 TTTCAACTCTAAAATGTGCAGGG - Intronic
966207147 3:177416664-177416686 TGTCAACTGTAAAATGAAGATGG + Intergenic
967342485 3:188415167-188415189 CTTCAGATGTAAAATACGGAGGG - Intronic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
968195180 3:196700541-196700563 TTTGAAATGTGAAATTTGGCCGG + Intronic
969478234 4:7433234-7433256 TTTCATTTGTGAAATGGGGATGG + Exonic
970130624 4:12866138-12866160 TTTAAAATGTAACATGATGATGG + Intergenic
970463631 4:16301337-16301359 TTTCAAATGTAAAGAATGAAAGG + Intergenic
972238328 4:37160591-37160613 TTTTTAATGTAAAATGTAGGTGG - Intergenic
972328194 4:38038369-38038391 TTAAAACTGTAAAATCTGGATGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972897996 4:43646400-43646422 TTCCATATGTAAAATTTAGAAGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
975058818 4:69970994-69971016 TTTCAGAGGTAAAATTAGGAGGG + Intergenic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975631063 4:76402749-76402771 TTTCAAAGGTAAAATCAGCAGGG + Intronic
976553773 4:86426802-86426824 TTTCAAATGAAATATGAGGTAGG - Intronic
977611107 4:99032541-99032563 TTTTGAATATAAACTGTGGAAGG + Intronic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
978057109 4:104283862-104283884 TTTCTAGAGAAAAATGTGGATGG - Intergenic
978304377 4:107307020-107307042 ATTCAAATGTAAAATATTGAGGG + Intergenic
978304408 4:107309130-107309152 ATTCAAATATAAAATATTGAGGG - Intergenic
978484594 4:109237442-109237464 TTTCAAATGAAAAATTTACAAGG + Intronic
978818967 4:112943239-112943261 TCTCAAATGTAAAACTTGAAAGG + Intronic
978889459 4:113805887-113805909 TTTTAAATCTAAAATGTTAAAGG + Intergenic
979090150 4:116472980-116473002 TTTCAAATTTAACATGTAAATGG - Intergenic
980030186 4:127819182-127819204 TTTCAAAAATAAAATGTTAAAGG + Intronic
980304084 4:131034034-131034056 TTTCAAATGTTGAAAGTTGATGG - Intergenic
980485251 4:133449414-133449436 TTTTAAATTTAAAATATTGAGGG - Intergenic
981596620 4:146431102-146431124 TTCAAAATGTGAAATGGGGATGG - Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983382347 4:167013096-167013118 TTGCAAATATGAAATGTGAAAGG + Intronic
984210652 4:176843424-176843446 TTTCAAATATTAAATGTGGAGGG - Intergenic
984605802 4:181784924-181784946 TTAGAAACGTAAAATGTGGCTGG + Intergenic
984646851 4:182229861-182229883 TTCCAATTCTAAAATTTGGAAGG + Intronic
984795996 4:183660489-183660511 ATTAAAAAGTAAAACGTGGATGG - Intronic
984888114 4:184468914-184468936 TTTTCACTGTAAAATGTGGCTGG - Intronic
985052157 4:186001688-186001710 TTTGAAATGTGGAATGTTGAAGG - Intergenic
986186444 5:5445708-5445730 TTTTAAATAAAAAATGTGGCTGG - Intronic
986291492 5:6403181-6403203 TTTCATATGTAATTTGAGGAAGG - Intergenic
986383678 5:7210231-7210253 TGTCAAAAATCAAATGTGGATGG - Intergenic
987269745 5:16294424-16294446 TTTTAAAGGCAAAATGTGAAAGG - Intergenic
988800966 5:34696430-34696452 TTTAAAAAGTAAAATGCGGCCGG - Intronic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
989223198 5:38993259-38993281 TTTCAAATGTAAAAAGTTTGTGG + Intronic
989441163 5:41473921-41473943 TTTGAAATTTAAAAAGAGGAAGG - Intronic
990543680 5:56800529-56800551 CTTCAAGTGTAAAATGCTGAAGG + Intergenic
991319792 5:65359497-65359519 TTACAATTTTAAAATTTGGAGGG - Intronic
992943415 5:81785666-81785688 TTCCAGATGTAAAATGCAGATGG + Intergenic
993056296 5:82984000-82984022 TTTCAATTGTATAATTTGGCAGG + Intergenic
993265280 5:85718996-85719018 TTTCAAATGGAAAGAGAGGATGG + Intergenic
993638726 5:90377123-90377145 TTTCAAAAGTAAACTGTGCATGG + Intergenic
993650490 5:90514912-90514934 CTTCAAATGTACAGTGTCGATGG + Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
993892766 5:93493547-93493569 TTTCAAAAGTAACATATGGTTGG + Intergenic
994109342 5:95982728-95982750 TGTCAAATGTAAAATATGTTGGG - Intergenic
994784976 5:104147078-104147100 TTTAAAAAGTAAAATGAGAAAGG + Intergenic
994798337 5:104335919-104335941 TTCCACCTGTAAAATGTGGGGGG + Intergenic
995537179 5:113148494-113148516 ATTAAAATGTAAAATGTAAATGG - Intronic
995563001 5:113403357-113403379 TTTTAAATATAAAACGTTGATGG - Intronic
995626858 5:114088915-114088937 TTTAAAATAAAAAATGTGGCTGG - Intergenic
995707744 5:115002379-115002401 TTTAAAATGTTAAGTGTGGGTGG - Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996255192 5:121392493-121392515 TTATAAATGTATAATGTGAAAGG - Intergenic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996472988 5:123881730-123881752 TTTCAATTCTAAAATGTAAATGG + Intergenic
996821415 5:127633217-127633239 TTTCAAATATAAAATAATGATGG + Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
997095437 5:130905397-130905419 TTTAAAATTTAAAAGATGGAAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997717667 5:136054073-136054095 ATTCAAAGGTAACATGGGGAAGG + Exonic
997731603 5:136184276-136184298 TTTAAAATGTTAAATGGGAAGGG - Intronic
998308618 5:141103437-141103459 TTTATAATGTAAAATTTGAATGG - Exonic
998890970 5:146745313-146745335 TCTCAACTCTAAAATGTGGCAGG + Intronic
998928008 5:147148542-147148564 TCTCAAGTATAAAATGGGGATGG + Intergenic
999000624 5:147918844-147918866 TTTCCAATGATAAATTTGGATGG + Intergenic
999222985 5:149997039-149997061 TATGAAATATAAAATGTGGTGGG + Intronic
999644543 5:153704839-153704861 TTTCCAATCTACAAGGTGGAAGG - Intronic
1000226742 5:159268520-159268542 TTTCAAATGTTAAATGAACATGG + Intronic
1000467772 5:161601030-161601052 TTTAAAATTTAAAATGGTGAGGG + Intronic
1000937411 5:167319571-167319593 TTTCAACTGTACAATAAGGAGGG - Intronic
1001103901 5:168836501-168836523 TTTCAAGGGCAAGATGTGGAGGG - Intronic
1001219459 5:169887187-169887209 TTTCAGAATGAAAATGTGGAGGG - Intronic
1001771839 5:174302658-174302680 TTACAAAGGTAAGAGGTGGAAGG - Intergenic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002282069 5:178136904-178136926 TTTCAATGGTATAATGAGGAGGG + Intronic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1003913967 6:10768278-10768300 TTAAAAATATAAAATGTGGCCGG + Intronic
1004767871 6:18751598-18751620 TTTGGAATGTGAAATGTGGTTGG + Intergenic
1006255795 6:32830934-32830956 TTTTAAATGTACAATTTGGACGG + Intronic
1006572994 6:35020903-35020925 TTTCAAATTTAAAATGTAGCAGG - Intronic
1006590772 6:35154884-35154906 GTTAAAATGTAAAAGGAGGATGG - Intergenic
1006758035 6:36434380-36434402 TTTCAAACATAAAAAGTTGAGGG - Intronic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007757275 6:44108055-44108077 TCTCATATGTGAAATGTGGTTGG + Intergenic
1008198139 6:48551606-48551628 TTTTAAAGGTAAAATGTAAAAGG + Intergenic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010533114 6:76991285-76991307 TTTCAAATGTACATAATGGAAGG + Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1011979145 6:93350460-93350482 TTTTAAAAGTAAAATTTTGAGGG - Intronic
1012109549 6:95211742-95211764 TTGCATATGTAAAATTTTGAGGG - Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1013271552 6:108550230-108550252 TCTCAAATGTATAATCTGAAGGG - Intergenic
1014021284 6:116593262-116593284 TTTCAAATATAAAATGTTCAAGG + Exonic
1014051239 6:116957604-116957626 TTTTAAATGTATAATCTGCAAGG + Intergenic
1014242900 6:119037770-119037792 TTTCTAAAGTAAAATTTTGAAGG - Intronic
1014417441 6:121199660-121199682 TATAAAATCTAAAATATGGATGG + Intronic
1014641772 6:123920499-123920521 TCTCACATGGAAAATATGGAAGG - Intronic
1014699228 6:124662896-124662918 TTTAACATGTAAAACGTGAATGG - Intronic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015369161 6:132431066-132431088 TTTTGAATGTAAAGTGTGAAGGG + Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015602552 6:134924502-134924524 TTTTAAAGGTAAAATGAGGAAGG - Intronic
1015685763 6:135857807-135857829 TTTCAGATGTATTAAGTGGAGGG + Intronic
1015835696 6:137417880-137417902 ATTCAAATGTGAAATGTTGAAGG - Intergenic
1015891481 6:137973895-137973917 TTTCAAATATAAATTTTGGGGGG + Intergenic
1016472887 6:144393333-144393355 TCTCAACTTTAAAATGTGCATGG + Intronic
1016612150 6:146002133-146002155 TGACATATATAAAATGTGGAAGG + Intergenic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019495251 7:1335384-1335406 TTTTAAACGTAGAATCTGGAGGG - Intergenic
1019908854 7:4085848-4085870 TTTAAAATGTAAAATGAGCTAGG - Intronic
1020036854 7:4969045-4969067 TTTTAAATGTACAATTTGGCCGG + Intergenic
1021018565 7:15566983-15567005 TTTCATATTCAAATTGTGGAAGG - Intergenic
1021113872 7:16726784-16726806 TTTCAAATGTATATTTTTGAAGG - Intergenic
1021299384 7:18953696-18953718 GTTCAAATGTATAAGGTGGTTGG + Intronic
1021505775 7:21383347-21383369 TGTGAAATGTACAATGTTGAAGG - Intergenic
1021531572 7:21652349-21652371 CTTGAAAGGTAAAATGTTGATGG + Intronic
1021789204 7:24184225-24184247 TTTCAAATGTTGAATGAGCATGG - Intergenic
1022214161 7:28241587-28241609 TTTGAAACGGAAAATCTGGATGG - Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1024308234 7:47946010-47946032 TTTCAAATAAAAAAAATGGAAGG + Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024602773 7:50999372-50999394 CTTCAAAAGTTAAATGTGGCCGG + Intergenic
1024637428 7:51301890-51301912 GATAAAATGTAAAATGTGGCTGG - Intronic
1024740413 7:52347870-52347892 TTTCAAATATTAAATGTAAAAGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1027757828 7:82238030-82238052 TTTAACATGTAAGATGTTGAGGG - Intronic
1027880387 7:83828153-83828175 TTTATCATATAAAATGTGGAAGG + Intergenic
1027904814 7:84165936-84165958 GTGAAAATATAAAATGTGGAGGG + Intronic
1028006635 7:85579113-85579135 TTGCATATGTAAACTGTGAAGGG - Intergenic
1028283350 7:88961954-88961976 ATTCTAATGTAAAATGTAAAAGG - Intronic
1028448007 7:90946947-90946969 TTTAAAATGGAAAGGGTGGAAGG - Intronic
1028692764 7:93672407-93672429 TTTGAAATGTGAAATGTAGAAGG + Intronic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030834028 7:114261321-114261343 TTTCAAATCTAAAATGTTTCAGG + Intronic
1031213154 7:118857548-118857570 TTTCAAATGTAAATAGAAGAGGG - Intergenic
1031260518 7:119513256-119513278 TTCCAAAGATAATATGTGGATGG + Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031982113 7:128134860-128134882 GTTGAAATGTAAATTTTGGAGGG + Intergenic
1032095462 7:128936193-128936215 TTTAAAATTTAAAGTATGGATGG - Intergenic
1032104020 7:129009886-129009908 TTTCACATGAGAAGTGTGGAGGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032895177 7:136242260-136242282 TTTCAAATGGAAAATGTGAAAGG + Intergenic
1032969698 7:137146562-137146584 TTTTAAAGGTAAAAAGTTGAAGG + Intergenic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1033382821 7:140840346-140840368 TTTTAAAGTTTAAATGTGGATGG - Intronic
1033952112 7:146797555-146797577 TTTCAAGTGAAAAATGTTGATGG + Intronic
1033955075 7:146837426-146837448 TTAAAAATGCAAAATGTTGAAGG - Intronic
1033981674 7:147172673-147172695 TTTCAACTGAAAAATCTTGATGG - Intronic
1035100538 7:156392551-156392573 ATTAAAATATAAAATGTGGCCGG + Intergenic
1035438394 7:158876418-158876440 TATCAAATTTAAAATGAAGAAGG - Intronic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035934777 8:3824994-3825016 TTTTAAATATGAAATGTGGCAGG + Intronic
1036067574 8:5399718-5399740 TTTTCAATTTAAAATGTGGAAGG - Intergenic
1037300702 8:17448840-17448862 TTTCAAAGGTGAAGTCTGGATGG - Intergenic
1038214169 8:25546440-25546462 TTTCAAATGTTAAGACTGGAAGG + Intergenic
1039373598 8:37011666-37011688 CTGCAAATGTAAAATGTTAATGG - Intergenic
1039883509 8:41642098-41642120 TTTGACATGTAAATTTTGGAGGG + Intergenic
1040371107 8:46775792-46775814 TTTTAAATCTAAAATTTGTATGG - Intergenic
1040963540 8:53061226-53061248 TTTCATATGCTAAATGTGTAAGG - Intergenic
1041052951 8:53955522-53955544 CTTCAAATCTAAAATGTAGGAGG + Intronic
1041209455 8:55534186-55534208 TTTCAGAGGTAAAATCTGCATGG + Exonic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1042452138 8:68960143-68960165 TTTCAAATGTTATTTGTGGAAGG - Intergenic
1042760759 8:72269270-72269292 TTTCACATGTAAAAGGTTTATGG - Intergenic
1043121700 8:76333325-76333347 AATAAAATGTAAAATGTGCATGG + Intergenic
1043184678 8:77132283-77132305 TTTCAAAAATAAAATGTGGTTGG + Intergenic
1043276569 8:78403573-78403595 TTTCAAATGGAAAGTCTGGTTGG - Intergenic
1043476586 8:80611401-80611423 TTTGCAATTTTAAATGTGGAAGG + Intergenic
1043858048 8:85284428-85284450 TTAAAAGTGTAAAATGTGGCTGG - Intergenic
1044323862 8:90837942-90837964 TTTGAAATGTAAAATATAAAGGG - Intronic
1044924025 8:97194633-97194655 TTTCAAGTGTAAAATATGAGTGG + Intergenic
1045078416 8:98596675-98596697 TTTCAAATGAAAAATTTCAAAGG + Intronic
1045189475 8:99868779-99868801 TTTCCTATGATAAATGTGGAAGG + Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1045902161 8:107295280-107295302 TTTCAAATGTACAATCTTGGAGG - Intronic
1046126241 8:109912263-109912285 TTGCAAATGAAAACTGTAGAGGG - Intergenic
1046207343 8:111017539-111017561 TTTCAAATATAATATGTAAAAGG + Intergenic
1046358576 8:113120030-113120052 TTTTAAATTTACAATTTGGAAGG + Intronic
1047172678 8:122509279-122509301 AATAAAATATAAAATGTGGAAGG - Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047711514 8:127557290-127557312 TTTCAACTGTAACATGTGGTGGG + Intergenic
1047874621 8:129122426-129122448 TTTCAACTATAAAATGAGAATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1050595623 9:7201619-7201641 TACCAAATGTAAAATGTGCTTGG - Intergenic
1051060929 9:13044215-13044237 TTTGAAAAGTAAAATGTGGCAGG - Intergenic
1051572653 9:18577858-18577880 TTTCAATTGTGAAATGATGATGG - Intronic
1051843032 9:21419782-21419804 TTTCCTATGTAAAGTATGGAGGG + Intronic
1052021292 9:23528535-23528557 TTTTCAAAGTACAATGTGGAGGG + Intergenic
1052207560 9:25861713-25861735 TTTAGATTCTAAAATGTGGAAGG + Intergenic
1052610655 9:30769328-30769350 TTTCAAATGACCCATGTGGATGG - Intergenic
1054571871 9:66819799-66819821 TGCCAACTGTAAAGTGTGGAAGG - Intergenic
1055098138 9:72435501-72435523 TTTCATATTTTAAATGTGGAAGG - Intergenic
1055389375 9:75802624-75802646 TATCAAATGTAACATGGGAAGGG + Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056222157 9:84460697-84460719 GTTCATATGTTTAATGTGGATGG + Intergenic
1056434070 9:86558334-86558356 TTTCAAATGTACAAAATAGATGG + Intergenic
1056481310 9:87009273-87009295 TTTTGAATCTAAAATTTGGATGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057253184 9:93520513-93520535 TTTTAAAAATAAAATGTGGTGGG + Intronic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1058027698 9:100160627-100160649 ATTTAAATGTAAATTATGGAGGG - Intronic
1059188759 9:112303321-112303343 TTTCAACATTAAAATGTGTATGG + Intronic
1059359220 9:113726933-113726955 TTTCAATTTTAAACTGGGGAAGG - Intergenic
1059369781 9:113818380-113818402 TTTCAAATGTCAAACATGGATGG + Intergenic
1059943474 9:119381278-119381300 ATTGAATTGTAAAATGTGTAAGG - Intergenic
1060392756 9:123291901-123291923 TCTCATCTGTAAAATGTGCAGGG - Intergenic
1060619790 9:125053774-125053796 TTTCAACTGTAAACTTTGAATGG + Intronic
1061439651 9:130592228-130592250 TCTCAAAAATAAAATGAGGAAGG + Intronic
1185688733 X:2135192-2135214 TTTCATATGTAATATGTCCATGG + Intergenic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186546657 X:10457070-10457092 TTTCAATTTTTAAAGGTGGAAGG + Intronic
1186587550 X:10891894-10891916 TTTCAAAGGTATAATGTTTAAGG - Intergenic
1188260768 X:28020572-28020594 TTTCAAATGTGATATGAGGCTGG + Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189533992 X:41917411-41917433 TTTCACATTTTAAATGTGGTAGG - Intronic
1189772757 X:44442708-44442730 TGTCAAATTTCAAATGTTGATGG + Intergenic
1189773077 X:44445389-44445411 TGTCAAATTTCAAATGTTGATGG + Intergenic
1189903974 X:45738328-45738350 ATTTAAATGTGAAATGTGAAAGG + Intergenic
1190874496 X:54449939-54449961 TTACAAGTGTAAAATGGGGGAGG + Intronic
1191904773 X:66076701-66076723 TTTCAGATATAAGATGGGGAGGG + Intergenic
1192499499 X:71640409-71640431 TTTAAAATGTAAAAACTGGCCGG + Intergenic
1193061984 X:77216387-77216409 TTTCAAATATAAATTGTGGAGGG + Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194046518 X:89012726-89012748 TTTCAAAAGTAAAACTTTGAAGG + Intergenic
1194152912 X:90347618-90347640 TTTTAAATGTTAAAAGTGAAGGG + Intergenic
1194174315 X:90628537-90628559 CTGAAAATGTCAAATGTGGATGG + Intergenic
1194230042 X:91310527-91310549 TTTCAAATATAAAATAGGTAAGG - Intergenic
1195935847 X:110125094-110125116 TTTACATTGTAAAATGAGGACGG + Intronic
1196007034 X:110847817-110847839 TTTCAAAAGGAAAATATGGCTGG + Intergenic
1196407470 X:115379733-115379755 TTTCAAATGAGAAAAATGGAAGG - Intergenic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197238678 X:124097589-124097611 TTTGAAATGAAAAGTATGGAAGG + Intronic
1197315765 X:124964200-124964222 TTTCAAATGTGGAATGTGCAGGG - Intergenic
1197464564 X:126786558-126786580 TTTCATTTGTTAAATGGGGATGG + Intergenic
1197531667 X:127636129-127636151 TTTCAAAAGGAAAATATGGTTGG - Intergenic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197855919 X:130913933-130913955 TTTCATTTGTAAAATTTCGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200336094 X:155353110-155353132 TTTCATTTGTAAAATGGAGATGG - Intergenic
1200350376 X:155488117-155488139 TTTCATTTGTAAAATGGAGATGG + Intergenic
1200499256 Y:3924419-3924441 TTTTAAATGTTAAAAGTGAAGGG + Intergenic
1200520534 Y:4206230-4206252 CTGAAAATGTCAAATGTGGATGG + Intergenic
1201514877 Y:14809164-14809186 ATTAAAAAATAAAATGTGGAAGG - Intronic