ID: 1015174316

View in Genome Browser
Species Human (GRCh38)
Location 6:130289785-130289807
Sequence TTTTCTTGGGCTGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6361
Summary {0: 2, 1: 12, 2: 150, 3: 1102, 4: 5095}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174316_1015174325 19 Left 1015174316 6:130289785-130289807 CCACCGTGCCCAGCCCAAGAAAA 0: 2
1: 12
2: 150
3: 1102
4: 5095
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166
1015174316_1015174322 9 Left 1015174316 6:130289785-130289807 CCACCGTGCCCAGCCCAAGAAAA 0: 2
1: 12
2: 150
3: 1102
4: 5095
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data
1015174316_1015174324 13 Left 1015174316 6:130289785-130289807 CCACCGTGCCCAGCCCAAGAAAA 0: 2
1: 12
2: 150
3: 1102
4: 5095
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174316 Original CRISPR TTTTCTTGGGCTGGGCACGG TGG (reversed) Intronic
Too many off-targets to display for this crispr