ID: 1015174317

View in Genome Browser
Species Human (GRCh38)
Location 6:130289788-130289810
Sequence ATCTTTTCTTGGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1138
Summary {0: 1, 1: 3, 2: 13, 3: 137, 4: 984}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174317_1015174325 16 Left 1015174317 6:130289788-130289810 CCGTGCCCAGCCCAAGAAAAGAT 0: 1
1: 3
2: 13
3: 137
4: 984
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166
1015174317_1015174324 10 Left 1015174317 6:130289788-130289810 CCGTGCCCAGCCCAAGAAAAGAT 0: 1
1: 3
2: 13
3: 137
4: 984
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174317_1015174322 6 Left 1015174317 6:130289788-130289810 CCGTGCCCAGCCCAAGAAAAGAT 0: 1
1: 3
2: 13
3: 137
4: 984
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174317 Original CRISPR ATCTTTTCTTGGGCTGGGCA CGG (reversed) Intronic
900647676 1:3716312-3716334 CTCTTTTCTTGGGCAGCGCTGGG + Intronic
900769659 1:4530576-4530598 AGCGATACTTGGGCTGGGCACGG + Intergenic
901033023 1:6319481-6319503 ATTATATATTGGGCTGGGCAAGG - Intronic
901174447 1:7288712-7288734 ATCACTTCTTGGGCTTTGCATGG - Intronic
901588962 1:10323150-10323172 AGCATTTATTTGGCTGGGCACGG - Intronic
901868298 1:12122354-12122376 ATGTTGCCTTAGGCTGGGCATGG + Intronic
901909480 1:12444129-12444151 ATGTTTTCTGAAGCTGGGCACGG - Intronic
902192712 1:14774773-14774795 ATCTGCTCAAGGGCTGGGCATGG - Intronic
902497786 1:16886383-16886405 ATCTTTCCTAGATCTGGGCAAGG + Intronic
902614144 1:17614683-17614705 GCCTTTTCTGGGGTTGGGCAAGG - Intronic
903039900 1:20521638-20521660 ATCTTCACTTGGGCCGGGCGTGG + Intergenic
903106053 1:21081140-21081162 ATATGTACTTGGGCTGGGCGTGG + Intronic
903399145 1:23026670-23026692 AATATTTCTTGGGCGGGGCATGG - Intronic
903796495 1:25932911-25932933 TCCTTTGCTTTGGCTGGGCACGG + Intergenic
903822794 1:26115905-26115927 GTCTGCTTTTGGGCTGGGCATGG + Intronic
903903031 1:26662338-26662360 AACTTGTTTTTGGCTGGGCATGG - Intergenic
904055224 1:27665570-27665592 AGCTTTTCGAGGGCTCGGCAAGG - Intergenic
904169044 1:28578436-28578458 ATCTCTTTAAGGGCTGGGCATGG + Exonic
904395314 1:30217278-30217300 GTCCTTTCTGGGGCTGAGCAGGG - Intergenic
904578464 1:31521964-31521986 ATCTTTCAATGGGCCGGGCACGG - Intergenic
904661050 1:32085460-32085482 ATCTCTTATTTGGCTGGGCGTGG + Intronic
905023944 1:34837162-34837184 GTACATTCTTGGGCTGGGCACGG + Intronic
905095879 1:35470200-35470222 AACTGTACTTAGGCTGGGCATGG + Intronic
905229959 1:36508773-36508795 ATGTTTTCTTGGGATGGAGAAGG + Intergenic
905650431 1:39652874-39652896 ATCTTTGCCTAGGTTGGGCAGGG + Intergenic
905705640 1:40054944-40054966 ATCATTTATTTGGCCGGGCATGG - Intronic
905724247 1:40235341-40235363 AAATTCTCTTTGGCTGGGCACGG - Intronic
905782209 1:40721851-40721873 ATGTCTCCTTGGGCTGGGAACGG - Intronic
905858847 1:41332744-41332766 ATGATTTTTGGGGCTGGGCATGG + Intergenic
905926879 1:41757405-41757427 ATATTTTTTTGGGCCGGGCACGG - Intronic
906030913 1:42719416-42719438 AATTTTTTTTGGGCCGGGCACGG + Intergenic
906081697 1:43094282-43094304 TTCTTTTCTTGGGCCGGGCGCGG - Intergenic
906271545 1:44483219-44483241 TACTATGCTTGGGCTGGGCATGG - Intronic
906414902 1:45613776-45613798 ATCATGCCTAGGGCTGGGCATGG - Intronic
906852748 1:49269481-49269503 ATCTTTTCTGGATCTGGGCAAGG - Intronic
906976314 1:50576955-50576977 ATCTGTTTTTAGGCTGGGCATGG - Intronic
907049598 1:51321162-51321184 AACATTTATTGGGCTGGGCGTGG - Intronic
907474969 1:54699587-54699609 ATCTTGGCTTGGGCCGGGCACGG - Intronic
908076651 1:60526774-60526796 ATACTTACTTAGGCTGGGCATGG - Intergenic
908156466 1:61358676-61358698 AGCTTGGATTGGGCTGGGCATGG - Intronic
908199212 1:61777272-61777294 AGCTTTTCTAAGGCTGGGCGTGG + Intronic
909686688 1:78356794-78356816 ATCACTTATTAGGCTGGGCATGG + Intronic
910000801 1:82340160-82340182 AGCATTTCCTGGGGTGGGCACGG + Intergenic
910562309 1:88603894-88603916 ATCCTATGTCGGGCTGGGCATGG + Intergenic
910684552 1:89902812-89902834 ATCCTTTTATTGGCTGGGCACGG - Intronic
910879445 1:91909516-91909538 AAGTTGTATTGGGCTGGGCACGG - Intergenic
911197646 1:95011703-95011725 ATTTATTTTTCGGCTGGGCACGG - Intronic
911657080 1:100456512-100456534 ATTTATTCTTCAGCTGGGCATGG + Intronic
911877195 1:103181877-103181899 GTCTTTTCTTGGGCTATGGAGGG - Intergenic
912389096 1:109289441-109289463 ATCATAATTTGGGCTGGGCATGG - Intergenic
912396580 1:109349473-109349495 AACATTTCTGGGGCTAGGCATGG + Intronic
912525214 1:110277838-110277860 AAGAATTCTTGGGCTGGGCATGG + Intronic
912789267 1:112635710-112635732 TTATTTCCTTGGGCCGGGCACGG - Intronic
912897347 1:113606255-113606277 ATTATTTCTTGGGCTGGGCATGG - Intronic
912905751 1:113705147-113705169 CACATTTCTGGGGCTGGGCATGG + Intronic
912927435 1:113925825-113925847 ATATGTACGTGGGCTGGGCACGG + Intergenic
913337994 1:117727578-117727600 TTCTTTTCTTCTGCTGGGCTTGG - Intergenic
913369035 1:118076352-118076374 ATCTTGCCTTGGGCTGGTGAAGG + Intronic
913595268 1:120370028-120370050 ATGTATGCTTTGGCTGGGCATGG + Intergenic
913655448 1:120955608-120955630 ATCTTTCCTAGATCTGGGCAAGG - Intergenic
914213414 1:145602767-145602789 ATATTTTATGGGGCTGGGCATGG - Intergenic
914465352 1:147923216-147923238 ATATATTATGGGGCTGGGCATGG - Intergenic
914595517 1:149147885-149147907 ATGTATGCTTTGGCTGGGCATGG - Intergenic
914690538 1:150022105-150022127 ATCTCATGCTGGGCTGGGCATGG + Intergenic
914732457 1:150383605-150383627 ATCTCTTCTTTGGCTGGGCACGG - Intronic
914783225 1:150804919-150804941 AAACTTTTTTGGGCTGGGCATGG + Intronic
914785560 1:150826203-150826225 ATGTTTTCCTCGTCTGGGCATGG - Intronic
914789070 1:150860504-150860526 ATTTTTTTTTCTGCTGGGCACGG - Intronic
914820380 1:151097489-151097511 AAGTGTTCTTGGGCTGGGCACGG + Intronic
914864898 1:151418733-151418755 AGCTACTTTTGGGCTGGGCACGG + Intronic
915175737 1:154013186-154013208 ATGTTATTTTGGGCTAGGCATGG - Intronic
915501439 1:156321581-156321603 ATCTCTTTTTTGGCTGTGCACGG + Intronic
915896073 1:159811964-159811986 ATCTCGTCTGGGGCTGGGGAGGG - Intronic
916040388 1:160956372-160956394 CTCTTTTTTTGGGCTGGGCGCGG + Intergenic
916081948 1:161239138-161239160 ATTTTTTTTTTGGCTGGGCGGGG + Intergenic
916100652 1:161390496-161390518 GCCTTCTCTGGGGCTGGGCAAGG + Intergenic
916411535 1:164551426-164551448 ATGGTTTCGTGGGCTGGGCCTGG - Intergenic
916850366 1:168696969-168696991 ATCTTGTTTTAGGCTGGGCTTGG + Intronic
916988676 1:170218706-170218728 GTCTTAGCTTGGGCTTGGCAGGG - Intergenic
917003632 1:170387842-170387864 AACTCTTGCTGGGCTGGGCATGG + Intergenic
917020548 1:170581761-170581783 ATCTTTTCACCGGCTGGGCATGG + Intergenic
918211458 1:182354904-182354926 ATCTGTCCTTGGGCTGGGCACGG + Intergenic
918333995 1:183489307-183489329 CTTTCTGCTTGGGCTGGGCAAGG + Intronic
918639987 1:186827956-186827978 AACATTTTTCGGGCTGGGCACGG - Intergenic
918810939 1:189119656-189119678 AACATTCCTTGGGCTGTGCAAGG + Intergenic
918992855 1:191720910-191720932 ATCATTTATTCGGCCGGGCACGG - Intergenic
919449716 1:197756282-197756304 TGCTTTTATTAGGCTGGGCATGG + Intronic
919510812 1:198461426-198461448 AACTTTTTTAGGGCTGGGCGTGG + Intergenic
919524734 1:198633579-198633601 ATTTTTTCATGGGCTGGGTCAGG + Intergenic
919629195 1:199943494-199943516 ATCTGTCTTTAGGCTGGGCATGG - Intergenic
919829397 1:201529885-201529907 CTCTTTTCTCTGTCTGGGCATGG - Intergenic
919915627 1:202137311-202137333 ATGTTTTTTTTGGCTGAGCATGG - Intronic
920011329 1:202869836-202869858 ATGGTTACTTGGGCTGGGCGCGG - Intergenic
920055611 1:203188843-203188865 CCCTTATCTTGGGCTGGCCAAGG - Intergenic
920238307 1:204524486-204524508 ATCTATTTTCCGGCTGGGCATGG + Intronic
920337491 1:205254919-205254941 ATGTTAGCTTGGGCTGGGCATGG + Intronic
920778270 1:208962258-208962280 ATTTTTTTTTTGGCTGGGCACGG - Intergenic
921256296 1:213342855-213342877 AACATTTTTTTGGCTGGGCATGG + Intergenic
921542943 1:216440013-216440035 ATTTTTTTGGGGGCTGGGCATGG - Intergenic
921574949 1:216824154-216824176 TTATTTTATTAGGCTGGGCACGG + Intronic
921773523 1:219071400-219071422 ATGGTTTCCTGGGCTGGGCCCGG + Intergenic
922274402 1:224063601-224063623 ATGCTTTATTGGGCTGGGCGTGG - Intergenic
922436396 1:225611608-225611630 ATTTTTTTTTTGTCTGGGCAAGG - Intronic
922510977 1:226167083-226167105 ACCGATTGTTGGGCTGGGCATGG - Intronic
922544008 1:226441653-226441675 ATCTGTTCTCCGGCTGGGCGTGG - Intergenic
922577160 1:226669123-226669145 ATCTACTCCTGAGCTGGGCATGG + Intronic
922608921 1:226909805-226909827 AATTTTTTTAGGGCTGGGCATGG - Intronic
922623945 1:227018202-227018224 TTCTGTTCTTTGGCTGGGCATGG - Intronic
922869890 1:228893888-228893910 AACTTTTCTCAGGCCGGGCACGG + Intergenic
922890409 1:229057724-229057746 GTCTTCTCTGGGGCTGGGGATGG - Intergenic
922940646 1:229462172-229462194 ATCAGTTGTTGGGCTGGGCAAGG - Intronic
923059557 1:230458136-230458158 CTGTTTTCTGAGGCTGGGCACGG - Intergenic
923635460 1:235691986-235692008 ATCTGATGTTAGGCTGGGCATGG - Intronic
923722230 1:236476813-236476835 AACTTTTTGTAGGCTGGGCAAGG - Intronic
924737288 1:246769570-246769592 GTCTGTCTTTGGGCTGGGCACGG + Intergenic
924741748 1:246798226-246798248 CTCTGAGCTTGGGCTGGGCATGG + Intergenic
924755625 1:246938144-246938166 ATCTATGTGTGGGCTGGGCACGG + Intergenic
924791238 1:247250449-247250471 AGCATTTCTATGGCTGGGCACGG - Intergenic
924798860 1:247312469-247312491 GTCTGTTCATGGGCTGGGCACGG + Intronic
1063007962 10:1992776-1992798 ATCATTTCTGGGGTTGTGCAGGG + Intergenic
1063229997 10:4056024-4056046 ATCCTACCTGGGGCTGGGCACGG - Intergenic
1063348490 10:5333928-5333950 AGCTCTTGTTAGGCTGGGCACGG + Intergenic
1063730804 10:8695166-8695188 AACATTTTTGGGGCTGGGCACGG + Intergenic
1063911123 10:10831679-10831701 ATATTTGCTATGGCTGGGCAAGG + Intergenic
1064089446 10:12371284-12371306 ATCTTTTTTGAGGCCGGGCACGG + Intronic
1064162180 10:12956204-12956226 ATTTCTTCTTGGGCTGGGGTAGG - Intronic
1064506024 10:16030970-16030992 ATCTTTGCTGGGACTGTGCAGGG + Intergenic
1064664296 10:17634298-17634320 ATATTTCTTGGGGCTGGGCACGG + Intergenic
1064668829 10:17687182-17687204 ATGTTATTTTGGGCTGGGCACGG + Intronic
1064742504 10:18448191-18448213 ATGTTAGCTTGGGCCGGGCATGG + Intronic
1065314025 10:24444300-24444322 ATTTTATTATGGGCTGGGCATGG - Intronic
1065351744 10:24801956-24801978 ATCTTTTTGTGGACTGGGCGTGG - Intergenic
1065436681 10:25709961-25709983 AACTATATTTGGGCTGGGCACGG - Intergenic
1065582945 10:27189992-27190014 ATTGTTTTTTAGGCTGGGCATGG + Intergenic
1065605914 10:27417777-27417799 AATTATTTTTGGGCTGGGCATGG + Intergenic
1065794103 10:29290548-29290570 CTCATGTTTTGGGCTGGGCATGG + Intronic
1066286403 10:33970668-33970690 ATGTTTTCCTTGGCTGGGCATGG - Intergenic
1066393977 10:35001249-35001271 ATCTCATTTTGGGCTGGGCACGG + Intergenic
1066524258 10:36259114-36259136 ATCTCTTCTGGGGCCAGGCATGG + Intergenic
1068298049 10:55101086-55101108 ATATTTTTATGGGCTTGGCATGG + Intronic
1068602476 10:58970145-58970167 ATTTTTTCATGGACTTGGCAGGG + Intergenic
1068780287 10:60912521-60912543 ATCTTTTTTAAGGCTAGGCATGG - Intronic
1069258376 10:66362389-66362411 ATAATTTTGTGGGCTGGGCATGG - Intronic
1069304450 10:66951404-66951426 ATATGGTGTTGGGCTGGGCATGG - Intronic
1069382174 10:67852376-67852398 TTCCTATCTGGGGCTGGGCACGG + Intergenic
1069459995 10:68585718-68585740 AAATTTTTTTGGGCCGGGCACGG + Intronic
1069484801 10:68815034-68815056 ATCCTTTTTTGGGGTGAGCAGGG - Intergenic
1069702724 10:70438531-70438553 AACTTTGGTTGTGCTGGGCATGG - Intronic
1069969321 10:72152318-72152340 ATCTTAATTTTGGCTGGGCATGG - Intronic
1070073878 10:73116297-73116319 TTCATTTCTTAGGCTGGGCATGG - Intronic
1070128315 10:73639519-73639541 ATGTTTCCTGGGGGTGGGCAGGG - Intronic
1070461003 10:76670089-76670111 ATCGTTTCCTTGGCTGGCCAGGG - Intergenic
1070593266 10:77815367-77815389 AGATTTTCTCTGGCTGGGCACGG + Intronic
1071184459 10:83025255-83025277 TTCTTCTTTTTGGCTGGGCATGG + Intergenic
1071576556 10:86730860-86730882 TTCATCTCTTGGGCTGGGCGTGG + Intronic
1071587582 10:86839950-86839972 ATCTTATCCTGGGCTGGGTCTGG - Intronic
1072053138 10:91726262-91726284 TTCTATTCGTGGGCTGGGCGCGG - Intergenic
1072124526 10:92433805-92433827 ATCTCTTATTTGGCTGGGCGTGG - Intergenic
1072183508 10:93011550-93011572 ATACTTTTTTTGGCTGGGCATGG - Intronic
1072343167 10:94475724-94475746 ATGTACTCTTAGGCTGGGCATGG - Intronic
1072596935 10:96881745-96881767 AACATTGCTTTGGCTGGGCATGG - Intronic
1072769013 10:98121323-98121345 TTCTTTTCTTCTGCTGGGTATGG + Intergenic
1072847683 10:98850444-98850466 ATATTATTTTGGGCCGGGCACGG + Intronic
1073520581 10:104125091-104125113 ATATTTTTTTAGGCTGGGGATGG - Intronic
1073923281 10:108483165-108483187 GTATATTGTTGGGCTGGGCATGG - Intergenic
1074361768 10:112829458-112829480 ATCTATTGATTGGCTGGGCACGG + Intergenic
1074805540 10:117047353-117047375 ATATTTTTGAGGGCTGGGCATGG - Intronic
1074977303 10:118591983-118592005 ATCCTTTCTAGGGCTGGGCATGG - Exonic
1075275758 10:121091018-121091040 ATGTTTCATGGGGCTGGGCACGG + Intergenic
1075760935 10:124856050-124856072 ATCTTTTTTTAGGCCGGGCATGG - Intergenic
1075839418 10:125486965-125486987 ATAAAGTCTTGGGCTGGGCATGG + Intergenic
1076919576 10:133444731-133444753 ACCTTTTCATGGGCTGTGAAAGG + Intergenic
1077031024 11:467465-467487 ATATATTCTTGGGCTGGACGTGG + Intronic
1077609109 11:3633325-3633347 TTGTTGTCATGGGCTGGGCATGG - Intergenic
1077799141 11:5521210-5521232 ATTTGTACTTGGGCTGGGCGTGG + Intronic
1077989299 11:7388960-7388982 ATATTTTCCTGGACTGGGAAGGG - Intronic
1078013396 11:7591836-7591858 TTCTGTTCTAGGACTGGGCATGG + Intronic
1078422359 11:11223033-11223055 ACCTTCTCTTGCTCTGGGCAAGG + Intergenic
1079014710 11:16858780-16858802 ATCTTTTTTTAGGTTGGGCGCGG - Intronic
1079397581 11:20078746-20078768 ATGTTTTCCTAGGCTGGGCATGG - Intronic
1079691494 11:23423805-23423827 AGCTCTTATTAGGCTGGGCATGG + Intergenic
1079804531 11:24912516-24912538 AAATATTCTGGGGCTGGGCATGG + Intronic
1079990039 11:27236711-27236733 GTCTTTTTTTGGGCCGGGCGTGG - Intergenic
1080090564 11:28343182-28343204 ATTTTTTCATGGGGTGGGGAAGG + Intergenic
1081181971 11:39994901-39994923 ACCTTTTCTTGAGATGGGAAAGG - Intergenic
1081564553 11:44249778-44249800 ATGTAGTCTTTGGCTGGGCATGG + Intergenic
1081791575 11:45790736-45790758 ATCTTGTTTTGGGCCAGGCATGG - Intergenic
1081794251 11:45808710-45808732 CTCTGTGGTTGGGCTGGGCATGG + Intronic
1081912569 11:46709284-46709306 ATCTTTTCTAGATCTGGACAAGG + Intergenic
1081982797 11:47279780-47279802 TTCCTTTATTTGGCTGGGCACGG + Intronic
1082035278 11:47640705-47640727 ATAGTTACTTGGGCCGGGCACGG - Intronic
1082680074 11:56156603-56156625 ATGTTTTCTTTGGCTGGGGTTGG - Intergenic
1082732650 11:56818867-56818889 ATCTGTGCTTTGGCTGGGCATGG - Intergenic
1082885386 11:58076775-58076797 AACTGTTCTTAGGCTAGGCATGG - Intronic
1083341923 11:61963748-61963770 ATCTTGTCTTGGGCTGGGTGTGG + Exonic
1083422529 11:62562767-62562789 AGATTATCCTGGGCTGGGCACGG - Intronic
1083556200 11:63630505-63630527 GGCTATTTTTGGGCTGGGCACGG + Intronic
1083584505 11:63846944-63846966 AAATTTTTTTGGGCTGGGCGCGG - Intronic
1083689280 11:64397004-64397026 AACTTAGCTGGGGCTGGGCATGG - Intergenic
1083697910 11:64454992-64455014 ATCTTTGCTGGAGCTGGGTAAGG + Intergenic
1083912009 11:65715468-65715490 AGCAATTCCTGGGCTGGGCACGG + Intronic
1083947359 11:65931644-65931666 AAGTATTCTTGGGCTGGGCGTGG + Intergenic
1084027452 11:66460663-66460685 TTTTTTTTTTTGGCTGGGCACGG - Intronic
1084048164 11:66582546-66582568 AAATTTTTTTGGGCTGGGCGTGG - Intergenic
1084097081 11:66918661-66918683 AGATTTTGTTGGGCTGGGCATGG - Intronic
1084103139 11:66963305-66963327 AAATGTTCTTGGGCTGGGCCGGG + Intergenic
1084352982 11:68616814-68616836 ATCTTTTCCTGGGCTGGTGATGG - Intergenic
1084451689 11:69242767-69242789 ATCTTGTCCTGAGCTGGGAAAGG - Intergenic
1085208544 11:74752304-74752326 AAAGATTCTTGGGCTGGGCATGG + Intronic
1085244852 11:75092653-75092675 GGCTTTTGTTAGGCTGGGCATGG + Intergenic
1085494898 11:76960118-76960140 ATATTTTATTTGGCTGGGCGCGG + Intronic
1085576977 11:77614373-77614395 ATCTTTATAGGGGCTGGGCACGG - Intronic
1085792396 11:79507254-79507276 AACCTTTCTTGGGCCGGGCACGG - Intergenic
1086226839 11:84521868-84521890 AAATTTCTTTGGGCTGGGCATGG + Intronic
1086373629 11:86178709-86178731 GTCTTTTCTGGGACTGAGCATGG + Intergenic
1086662518 11:89437692-89437714 AGCTTCTCTTGGGTTGGGAAGGG - Intronic
1087098525 11:94342945-94342967 ATGTTATCCTAGGCTGGGCATGG - Intergenic
1087466090 11:98508145-98508167 GTGTTTCCTGGGGCTGGGCAAGG + Intergenic
1087734913 11:101820975-101820997 ATGTTAACATGGGCTGGGCATGG - Intronic
1088307143 11:108422591-108422613 ATGTTGACCTGGGCTGGGCATGG + Intronic
1088327467 11:108615913-108615935 ATATAATCTTGGGCCGGGCACGG - Intergenic
1089479690 11:118794137-118794159 TTTTTCACTTGGGCTGGGCACGG + Intergenic
1089972191 11:122703134-122703156 TTTTTTTCTTTGGCCGGGCACGG + Intronic
1090053697 11:123403132-123403154 ATCATTTCCTGGGCCGGGCACGG + Intergenic
1090432816 11:126660796-126660818 ATCTTTTATTGGTCTTGGAATGG - Intronic
1090822658 11:130357594-130357616 ATTTTATTTTAGGCTGGGCATGG - Intergenic
1090999818 11:131900549-131900571 ATCTTGGCTTGGGCCAGGCAAGG + Intronic
1092297514 12:7212253-7212275 GACTTTTTTTTGGCTGGGCACGG - Intronic
1092484487 12:8890712-8890734 ACCTTTCCTGGGGCTGGGGAAGG - Intergenic
1092804219 12:12204630-12204652 AAACTCTCTTGGGCTGGGCACGG + Intronic
1092821009 12:12353548-12353570 TTCTTTTCTTGGGGAGGGCAGGG - Intergenic
1093249012 12:16776951-16776973 ATATTTGCTTAGGCCGGGCATGG - Intergenic
1094034708 12:26055893-26055915 ATCTTATGATTGGCTGGGCATGG + Intronic
1094789525 12:33895480-33895502 TTCTTTTCTTCTGCTGGGCTTGG - Intergenic
1096149637 12:49300690-49300712 ATTATTTTTTGGGCTGGGCGAGG - Intergenic
1096234499 12:49917042-49917064 AACTTGTTTTGGGCTGGGCGTGG - Intergenic
1096246254 12:49989087-49989109 ATCATTTCTGGGGCTGGGCTTGG - Intronic
1096279298 12:50238214-50238236 AACTTTTCTGAGGCTTGGCATGG + Intronic
1096449713 12:51728296-51728318 ATGGTTTCTTGGGCAGGTCATGG - Intronic
1096706789 12:53426971-53426993 TTTTTTTTTTTGGCTGGGCACGG - Intronic
1097028148 12:56073544-56073566 ATCTCATCTTAGGCTGGGCGCGG - Intergenic
1097603778 12:61727735-61727757 TTCTTTTCTTCTGCTGGGTATGG + Intronic
1097846098 12:64368256-64368278 CTCTCTCCTTAGGCTGGGCATGG - Intronic
1098020339 12:66149148-66149170 ATTTTTTTCTGGGCTGGGCATGG + Intronic
1099898181 12:88675133-88675155 ATCTTTTCTTGAGCAGTGCTAGG + Intergenic
1100521726 12:95381713-95381735 TTTTGTACTTGGGCTGGGCATGG + Intergenic
1101069154 12:101054775-101054797 ATGTTCTCTTAGGCCGGGCACGG - Intronic
1101155904 12:101927470-101927492 ATCTGTAACTGGGCTGGGCATGG + Intronic
1101244591 12:102873475-102873497 AACTTTTATTGGGTTGGCCACGG + Intronic
1101348979 12:103910496-103910518 AGGTTATCTTGAGCTGGGCACGG - Intergenic
1101851305 12:108404480-108404502 ATCTTCTCTTGGCCTGGGGTTGG + Intergenic
1102069274 12:110003866-110003888 AAATTTTTTTTGGCTGGGCACGG + Intronic
1102091083 12:110188632-110188654 GTCTTTTGTCAGGCTGGGCACGG + Intronic
1102104053 12:110305222-110305244 TTTTTTTCCTAGGCTGGGCATGG - Intronic
1102208389 12:111106304-111106326 ATATTAGCTGGGGCTGGGCATGG - Intronic
1102243373 12:111339448-111339470 GTCTCTTGTAGGGCTGGGCAAGG + Intronic
1102375045 12:112415420-112415442 ACTTTTTTTTGGGCCGGGCATGG + Intronic
1102399258 12:112614391-112614413 ATCCTTTGTGGGGCTGGGCATGG + Intronic
1102412094 12:112728891-112728913 GTCTTTTCTGGGAATGGGCAGGG + Intronic
1102488708 12:113275858-113275880 ATATTTTCTCAGGCCGGGCACGG - Intronic
1102499976 12:113345310-113345332 ATTTATTTTTGGGCTGAGCACGG - Intronic
1102820565 12:115905727-115905749 AACTTTTTTTTGGCTGGGTATGG - Intergenic
1102852069 12:116256963-116256985 AGTTTGTTTTGGGCTGGGCACGG - Intronic
1102932269 12:116871592-116871614 TTTTTTTTTTTGGCTGGGCACGG - Intronic
1103075833 12:117981877-117981899 AACATTTCCTTGGCTGGGCACGG - Intergenic
1103114687 12:118316971-118316993 AACATTGCTGGGGCTGGGCACGG + Intronic
1103401689 12:120647502-120647524 ATCATATCCTGGGCCGGGCATGG - Intronic
1103635644 12:122302885-122302907 ATCTATATTTAGGCTGGGCACGG - Intronic
1103660559 12:122512094-122512116 ATTCATTTTTGGGCTGGGCATGG - Intronic
1103810873 12:123612691-123612713 ATCTATCCTTTGGCTGGGCGAGG + Intronic
1103865781 12:124050937-124050959 ATTTATTTTTGGGCTGGGCATGG + Intronic
1104026966 12:125034592-125034614 TTTTTTTTTTGGGCTGGGGATGG + Intergenic
1104565437 12:129877068-129877090 GTCTTGTTTTGGGCTGGGGAGGG - Intronic
1105427789 13:20309968-20309990 ATTATTTTTTGGGCTGGGCGTGG - Intergenic
1105515994 13:21091133-21091155 AACTGCTCCTGGGCTGGGCAAGG - Intergenic
1105540233 13:21309835-21309857 TTCTTCATTTGGGCTGGGCATGG + Intergenic
1105656651 13:22448370-22448392 ATTTTTTTGTGGGCTGGGCGTGG + Intergenic
1106128401 13:26920063-26920085 ATCTTTTCCTGAGCTGGGGCTGG - Intergenic
1106448607 13:29859529-29859551 ATTTTTTTGTTGGCTGGGCATGG - Intergenic
1106482348 13:30146364-30146386 GTCTGTTTTTAGGCTGGGCATGG + Intergenic
1106632196 13:31486560-31486582 ATGTTTTCTTGGGCTGGGCACGG - Intergenic
1106854248 13:33830935-33830957 ATTTTTCCATGGACTGGGCAGGG + Intronic
1106992614 13:35440168-35440190 ATCAGTTATCGGGCTGGGCATGG - Intronic
1106994578 13:35466757-35466779 TTTTTTTTTAGGGCTGGGCATGG - Intronic
1107083016 13:36395115-36395137 ATATATTTTTGGCCTGGGCACGG - Intergenic
1107459133 13:40584331-40584353 ATATTATTTGGGGCTGGGCATGG + Intronic
1107460064 13:40593316-40593338 ATATTTCCTTAGGCTGGACACGG - Intronic
1107543135 13:41411858-41411880 TGCTTTTCTTAGGCTGGGCGTGG + Intergenic
1107698848 13:43026742-43026764 ATATCTTGTTGGGCTGGACATGG + Intronic
1107733286 13:43370075-43370097 ATATCTTCTTGGGCCGGGCGCGG + Intronic
1107773878 13:43817330-43817352 ATCAAATATTGGGCTGGGCATGG + Intergenic
1108456012 13:50614492-50614514 ATATCTTCTTTGGCTGGGTATGG + Intronic
1108488608 13:50955185-50955207 AACTTATCTTGAGATGGGCAAGG - Intronic
1108612792 13:52100581-52100603 ATTTGTTCTTGGGCTGAGTAAGG + Intronic
1108723285 13:53154098-53154120 ATCTTATCTGGGGCCAGGCATGG + Intergenic
1109227717 13:59716463-59716485 ATGTTTCCTGGGGCCGGGCACGG - Intronic
1109284620 13:60396649-60396671 AGGTTTTCTTGGGCTGACCAGGG + Intronic
1109573479 13:64223068-64223090 ATCTTTTAGTTGGTTGGGCACGG - Intergenic
1110442458 13:75540259-75540281 AGATTTCCTGGGGCTGGGCATGG - Intronic
1110962176 13:81640417-81640439 ATCTTTTCTGATGCTGGGCTAGG - Intergenic
1111411032 13:87877108-87877130 ATTATTACTTTGGCTGGGCACGG + Intergenic
1111744798 13:92254088-92254110 ATTTTTTCTTGGGTTGAACATGG - Intronic
1111760521 13:92458294-92458316 TTCTTTTTTTGGGGGGGGCAGGG + Intronic
1112456871 13:99571042-99571064 ATGAATTCTTTGGCTGGGCACGG + Intergenic
1113220527 13:108096258-108096280 ATGTTTTCATGGGGTGGGAAAGG + Intergenic
1113898150 13:113778796-113778818 ATCTTTTTCTAGCCTGGGCAGGG + Intronic
1114014409 14:18413757-18413779 ATATTCCCTTTGGCTGGGCAAGG - Intergenic
1114424264 14:22609286-22609308 AAAATTTCTTGGGCTGGGCACGG - Intronic
1114431100 14:22661606-22661628 TTCTGTTCTTAGGCTGGGCATGG + Intergenic
1114677646 14:24454751-24454773 GTTATTTCTTAGGCTGGGCATGG - Intergenic
1115250560 14:31342094-31342116 AAGTTTTATTGGGCTAGGCATGG + Intronic
1115419947 14:33183133-33183155 ATCCATTCTTGGGCTGGGTGCGG + Intronic
1115427833 14:33281338-33281360 ATTTTTTTTCAGGCTGGGCATGG + Intronic
1115560292 14:34576791-34576813 ATATTTTCTCAGGCTGGGTATGG + Intronic
1115579646 14:34745531-34745553 GTCTCATCATGGGCTGGGCATGG - Intergenic
1115655308 14:35438217-35438239 TTTGTTTTTTGGGCTGGGCACGG + Intergenic
1115739219 14:36370481-36370503 ATCTATTTCTTGGCTGGGCATGG + Intergenic
1115765082 14:36614938-36614960 ATCAATTGTGGGGCTGGGCATGG + Intergenic
1115784619 14:36810788-36810810 ATATATTCTTGGGATGGGAAAGG + Intronic
1115851435 14:37592860-37592882 ATCTTTGCTCGGTCTGGGGAGGG - Intronic
1115988090 14:39123361-39123383 ATTTTTTCTTGGGCAGGGGAGGG - Intronic
1116012128 14:39364067-39364089 TTGTTTTCTGGGGCCGGGCACGG + Intronic
1116138674 14:40959807-40959829 ATATTTTTGTGGGCTGGGCCCGG - Intergenic
1116739105 14:48732727-48732749 ATATGTTATGGGGCTGGGCACGG - Intergenic
1117103551 14:52375668-52375690 TTCTTTTCTTCTGCTGGGTATGG + Intergenic
1117361939 14:54983807-54983829 ATTTTTTTTTTGGCTGGGCATGG - Intronic
1117385086 14:55203916-55203938 AACTATTTTTAGGCTGGGCATGG + Intergenic
1117637419 14:57759287-57759309 ATCTTTTGAGGGGCTGGGCATGG + Intronic
1118198860 14:63653475-63653497 ATCCTTTTTGGGGCTGGGCGCGG - Intergenic
1118382976 14:65232799-65232821 ATTTTTTTTTGGGCCGGGCATGG + Intergenic
1118641458 14:67796494-67796516 ATCCTTTCTTCGGCCTGGCACGG - Intronic
1118823737 14:69362137-69362159 ATCTTCTCTGGGGCTCGGGAGGG + Intergenic
1119503329 14:75149812-75149834 AACTTCTTTTGGGATGGGCACGG + Intronic
1120014464 14:79454504-79454526 ATATATGATTGGGCTGGGCACGG - Intronic
1120876968 14:89383943-89383965 ATTTTTTTTTTAGCTGGGCATGG - Intronic
1121375477 14:93406290-93406312 ATCTATTAATGAGCTGGGCATGG + Intronic
1121651670 14:95563410-95563432 ATCCTTTACTGGGCCGGGCACGG + Intergenic
1122509673 14:102256272-102256294 TTAATTTTTTGGGCTGGGCACGG + Intronic
1123027613 14:105434789-105434811 GTCCTCTTTTGGGCTGGGCATGG - Intronic
1124159405 15:27255050-27255072 ATCTTTGCAGGGGCTGGGCCTGG - Intronic
1124700071 15:31905069-31905091 ATGTTTTCCTGGGCTGGGGAAGG + Intergenic
1124787618 15:32696405-32696427 ATCGTTTCTGGGGCCGGGCGCGG - Intronic
1124855393 15:33382610-33382632 GTCATTTTTTGGGGTGGGCACGG - Intronic
1124958394 15:34375532-34375554 ATATATTTTGGGGCTGGGCACGG - Intergenic
1125143902 15:36443088-36443110 AGTATTTTTTGGGCTGGGCATGG - Intergenic
1125532654 15:40423748-40423770 AACTATCCTTGGGCCGGGCATGG - Intronic
1125763063 15:42111607-42111629 ATAATTACTTGGGCCGGGCATGG + Intergenic
1125908850 15:43418205-43418227 ATCCATTTTTTGGCTGGGCATGG + Intronic
1125914292 15:43471716-43471738 ATACTTTCTCAGGCTGGGCACGG - Intronic
1126007758 15:44274501-44274523 ATTTTTTTTTTGGCCGGGCATGG - Intergenic
1126488832 15:49213825-49213847 AACTTTTTTTGGGCTGGGCATGG + Intronic
1126566177 15:50102209-50102231 TTCTTTTCTTCTGCTGGGCTTGG - Intronic
1126623180 15:50660639-50660661 ATATATTTTTAGGCTGGGCATGG - Intronic
1126650813 15:50919784-50919806 ATAATTTATGGGGCTGGGCACGG + Intronic
1126788306 15:52197462-52197484 ATGGTTTCCTAGGCTGGGCAGGG + Intronic
1127090478 15:55461754-55461776 TTCTTTTCTTGTGCTGGGTTTGG - Intronic
1127415866 15:58756705-58756727 ATCCCTTCTGGGCCTGGGCACGG + Intergenic
1127484451 15:59406186-59406208 ATCCTTTCTTGGCTTGGGGAGGG - Intronic
1127597809 15:60504254-60504276 ATATTTTTTCTGGCTGGGCACGG + Intronic
1127949019 15:63785994-63786016 ATTATCTCTTGGGTTGGGCATGG - Intronic
1128013980 15:64326314-64326336 ATATTTTCTTGGGCCAGGCATGG - Intronic
1128035980 15:64526939-64526961 ATCTCATATTGGGCTGGGTACGG - Intronic
1128423202 15:67514376-67514398 ATCTCTTCTGGTGCTGAGCATGG + Intergenic
1128435615 15:67644856-67644878 ATGTTATTTTTGGCTGGGCATGG + Intronic
1128782029 15:70365898-70365920 ATTGTTTTTTTGGCTGGGCACGG - Intergenic
1128892131 15:71340888-71340910 ATAATCTCTGGGGCTGGGCACGG - Intronic
1129802028 15:78422318-78422340 ATATTATCCTGGACTGGGCATGG - Intergenic
1130009311 15:80136174-80136196 AGCCTTTCTAGGGCTGGGCATGG + Intronic
1130164444 15:81438450-81438472 ATCATGTTTTTGGCTGGGCACGG + Intergenic
1131026086 15:89142786-89142808 CTCTTGTCTTGGGTTGGGCTGGG + Intronic
1131222325 15:90595280-90595302 GTATTTTTTTTGGCTGGGCATGG + Intronic
1131496017 15:92911736-92911758 ATTTTTTCTTGGGCAGGGGTTGG - Intronic
1131552646 15:93371247-93371269 AAATTGTCTTGGGCTGGGCGTGG - Intergenic
1132771087 16:1563915-1563937 AGATCTTCATGGGCTGGGCACGG - Intronic
1132917259 16:2357143-2357165 TTCTCTCCTTGGGCTGGGAATGG + Intergenic
1133034590 16:3027839-3027861 ATCTTTTCTAGGGCAGGGATGGG - Exonic
1133097243 16:3455993-3456015 CTCTTTTTTTGGGCAGGGCGCGG - Intronic
1133137767 16:3723924-3723946 ATCTCAGGTTGGGCTGGGCATGG - Intergenic
1133179351 16:4041210-4041232 AGCTAGACTTGGGCTGGGCATGG + Intronic
1133228171 16:4352967-4352989 AATTTTTTTTTGGCTGGGCACGG - Intronic
1133448856 16:5886595-5886617 ATCGTCTCTTTGGCTGGGCGCGG + Intergenic
1133977658 16:10611474-10611496 ATCAGTTTTAGGGCTGGGCATGG + Intergenic
1134078255 16:11307609-11307631 AAATTTTCTTAGGCTGGGCGTGG + Intronic
1134802031 16:17093607-17093629 CTTTTTTCTGGGGGTGGGCAGGG + Intergenic
1134840094 16:17394828-17394850 AGCATTTGTTGGGCTGGGCATGG + Intronic
1135042210 16:19126372-19126394 ATTTTTTCATGGGCTGGGTGTGG - Intronic
1135054106 16:19216292-19216314 ATCTATTCTTGGGAGGGGCATGG - Intronic
1135066973 16:19318300-19318322 ATTTTTTTTAGGGCTGGGAATGG - Intronic
1135238381 16:20780053-20780075 ATGTTTGCTGAGGCTGGGCATGG - Intronic
1135344888 16:21680561-21680583 GGCTTTTCATAGGCTGGGCATGG + Intronic
1135414169 16:22256523-22256545 ATATATTTTTAGGCTGGGCACGG - Intronic
1135459663 16:22630687-22630709 ATCTATTCTTAGCCTGGGCGTGG + Intergenic
1135567068 16:23519331-23519353 ATCTTTTCCAGGGCTGGGCACGG - Intronic
1135851642 16:25969106-25969128 AACCTTTGTTGGGTTGGGCATGG - Intronic
1136178009 16:28531832-28531854 ATCAATTTTGGGGCTGGGCACGG + Intergenic
1136289611 16:29263594-29263616 TTTTATTTTTGGGCTGGGCACGG + Intergenic
1136400627 16:30016004-30016026 ATATATTATTGTGCTGGGCATGG - Intronic
1136651048 16:31671570-31671592 ATCTGTTTTTAGGCTGGGTATGG + Intergenic
1137271142 16:46902956-46902978 ATTATTTCTTGGGCCGGGCGTGG + Intronic
1137375531 16:47948895-47948917 ATGGTTTGTGGGGCTGGGCATGG + Intergenic
1137656623 16:50164747-50164769 AGGTTTTACTGGGCTGGGCATGG + Intronic
1137764484 16:50967469-50967491 TTCTTTTGTTGGGCTTGGCCGGG - Intergenic
1138975822 16:62206526-62206548 ATTTTTTCTTCCGATGGGCAAGG + Intergenic
1139400306 16:66676013-66676035 ATTTTTTTTTTAGCTGGGCATGG - Intronic
1139715574 16:68810571-68810593 TTTTTTTTTTAGGCTGGGCATGG + Intronic
1139801482 16:69526537-69526559 TTCTCTGCTTGGGGTGGGCAAGG + Intergenic
1139844864 16:69913321-69913343 AACTTTTTTTTGGCTGGGCGTGG - Intronic
1139915379 16:70425054-70425076 GTCTTGTATTGAGCTGGGCATGG + Intronic
1140376527 16:74449393-74449415 ATCTTCTCTTGGGAAGGCCAAGG + Intergenic
1140417751 16:74788391-74788413 ATTTTTTTTTGGGCCGGGCATGG + Intergenic
1140545281 16:75802060-75802082 ATCTTTTGGTGGGCAGGGCCTGG + Intergenic
1140749363 16:78009291-78009313 TTCTTTTTCTGAGCTGGGCACGG + Intergenic
1140882566 16:79211986-79212008 CACTTTTCTGGGGCTGGGCTAGG + Exonic
1141070711 16:80952098-80952120 ATCCTTATTTAGGCTGGGCACGG - Intergenic
1142658562 17:1411381-1411403 ATGTTTGCTGGGGCCGGGCACGG + Intergenic
1143153453 17:4821190-4821212 ATTTTTTTTTTGGCCGGGCACGG - Intronic
1143159785 17:4861788-4861810 ATCTTTGGTTGGGCCGGGCATGG - Intronic
1143383946 17:6515103-6515125 AAATGTTCTTGGGCCGGGCATGG + Intronic
1143413131 17:6724368-6724390 AACCTTTTCTGGGCTGGGCACGG + Intergenic
1143693874 17:8595719-8595741 AACTGTTCTTGGGCCGGGCTTGG - Intronic
1143799645 17:9368020-9368042 ATCCTTCTTTTGGCTGGGCATGG - Intronic
1143877721 17:10004719-10004741 ATGTCTTCCTAGGCTGGGCACGG + Intronic
1143944948 17:10582950-10582972 AACTTCTCTTGACCTGGGCATGG - Intergenic
1144430011 17:15182448-15182470 ATCTTCCCTTGTTCTGGGCAAGG + Intergenic
1145032230 17:19513159-19513181 ATATATTCTGGGGCTGGGCATGG - Intronic
1145228121 17:21148203-21148225 TTATTTTTTAGGGCTGGGCATGG - Intronic
1145918205 17:28589387-28589409 ATTTTATTTTAGGCTGGGCATGG - Intronic
1146200670 17:30855047-30855069 AACATTTTTAGGGCTGGGCATGG - Intronic
1146282412 17:31553284-31553306 CATATTTCTTGGGCTGGGCACGG - Intergenic
1146749174 17:35362022-35362044 TTGCTTTCTTGGGCTGGGCTTGG - Intronic
1146972517 17:37084317-37084339 AACTTTCTATGGGCTGGGCATGG - Intergenic
1147478166 17:40733926-40733948 GAGTTCTCTTGGGCTGGGCATGG - Intergenic
1147655855 17:42090602-42090624 AACCTATCTTAGGCTGGGCACGG + Intergenic
1147983474 17:44289829-44289851 ATATCTTATTGGGCTGGGCATGG + Intergenic
1148000984 17:44386968-44386990 ATTTTTTTATAGGCTGGGCATGG + Intronic
1148007882 17:44448983-44449005 ATCATTTCCTGGGCTAGGCGTGG + Intronic
1148043150 17:44724667-44724689 TCCTTTTTTTTGGCTGGGCATGG - Intronic
1148086003 17:44994211-44994233 AGCTTTACTTTGGCTGAGCAAGG + Intergenic
1148369515 17:47086744-47086766 ATTGGTTCTAGGGCTGGGCACGG - Intergenic
1148374899 17:47134186-47134208 ATGTTTTAATGGTCTGGGCATGG - Intronic
1148473483 17:47911249-47911271 ATCTTTGTTTTGGCTGGTCATGG + Intronic
1148573492 17:48690005-48690027 ATCTTTTCTTAGGTTGGGCATGG - Intergenic
1148832368 17:50442012-50442034 ACATTTTTTTTGGCTGGGCACGG + Intronic
1148948783 17:51290123-51290145 ATGTTTTGTTGCGCTGGGCACGG + Intronic
1149333327 17:55608750-55608772 ATCTGGTATGGGGCTGGGCATGG + Intergenic
1149669455 17:58393115-58393137 ACATTTTCTTGGGCCAGGCACGG + Intronic
1149736625 17:59000902-59000924 ATTCTTCTTTGGGCTGGGCACGG + Intronic
1149741158 17:59046828-59046850 ATTTGTTTTTCGGCTGGGCACGG - Intronic
1150095406 17:62370362-62370384 GTGTATTTTTGGGCTGGGCATGG + Intronic
1150096019 17:62376180-62376202 AAGTTTTCTTTGGCTGGGCACGG + Intronic
1150421342 17:65038715-65038737 ATGTATTTTTGGGCGGGGCACGG - Intronic
1150495650 17:65606091-65606113 ATTTCATCTTGGGCTGGGCGCGG + Intronic
1150514777 17:65796740-65796762 ATAATATCTTGGGTTGGGCATGG + Intronic
1150730030 17:67684401-67684423 CTGTTATGTTGGGCTGGGCAGGG - Intronic
1150858807 17:68779287-68779309 GTCATGTCTTGGGTTGGGCATGG - Intergenic
1151222263 17:72621881-72621903 ATTTTGTTTTAGGCTGGGCATGG - Intergenic
1151275708 17:73032495-73032517 AGGATTTTTTGGGCTGGGCATGG - Intronic
1151283661 17:73094551-73094573 AACCATTCTTAGGCTGGGCATGG + Intergenic
1151734500 17:75930632-75930654 TTATTTTCTTTGGCTGGGCACGG + Intronic
1152003374 17:77661583-77661605 TTTAATTCTTGGGCTGGGCATGG + Intergenic
1152048700 17:77956599-77956621 ATCATCTATAGGGCTGGGCATGG - Intergenic
1152084437 17:78209263-78209285 ATCCTTTTTTTGGCAGGGCACGG + Intergenic
1152512137 17:80797571-80797593 AACTTTTCTTTGGCTGGGCGTGG - Intronic
1153387642 18:4516355-4516377 ATATTTTGGTGGGCCGGGCACGG + Intergenic
1154203844 18:12320076-12320098 AACATTTTTTTGGCTGGGCACGG - Intronic
1154242704 18:12667168-12667190 ATATTATTTTGGGCTGGGCATGG + Intronic
1154408823 18:14123879-14123901 ATTTTCTTTTTGGCTGGGCATGG + Intronic
1154981030 18:21502488-21502510 CTAGTTTCTTGGGCTGGTCATGG - Intronic
1154984710 18:21538159-21538181 AGTTGTACTTGGGCTGGGCAGGG + Intronic
1155296281 18:24387343-24387365 AAATATTTTTGGGCTGGGCATGG - Intronic
1155899578 18:31372617-31372639 ATCTCTTCATGGGGTGGGCCAGG - Intergenic
1156238489 18:35228269-35228291 ATTTTTTGTGGGGCTGGGCACGG + Intergenic
1157088151 18:44603628-44603650 TTCTTCATTTGGGCTGGGCATGG - Intergenic
1157261693 18:46180969-46180991 GTCGTTTTTTGGGCTGGGCATGG + Intronic
1157458459 18:47860571-47860593 ATTTTTGATAGGGCTGGGCATGG - Intronic
1157525618 18:48378209-48378231 ATCTTCTGCTGGTCTGGGCAAGG - Intronic
1157646977 18:49284423-49284445 AACTTTGCTTGGGATGGTCATGG - Intronic
1157704286 18:49789691-49789713 CTCTGCTCTTGGGCTGGGCATGG + Intronic
1157882082 18:51330100-51330122 ATGTTCTCTTGGGCCAGGCATGG - Intergenic
1157895028 18:51457806-51457828 ACATATTCTTGGGCTGGGCGTGG + Intergenic
1157996219 18:52559399-52559421 AACCTCTCTTAGGCTGGGCATGG - Intronic
1158023843 18:52872378-52872400 ATCTTTTCTAAGTCTGGACAAGG + Intronic
1158150042 18:54357756-54357778 CTCCTTTCTGGGGCTGGGAATGG - Intronic
1158439289 18:57459847-57459869 ATATTTATTTGGGCCGGGCATGG - Intronic
1158538286 18:58328253-58328275 AGACTTTTTTGGGCTGGGCATGG - Intronic
1158939324 18:62392597-62392619 GACATTTCATGGGCTGGGCACGG - Intergenic
1159240363 18:65734905-65734927 AGCCTTTCTTGAGCTGGGCATGG - Intergenic
1160019481 18:75169487-75169509 ATCCCTTTCTGGGCTGGGCAGGG - Intergenic
1160389927 18:78522219-78522241 ACTTAATCTTGGGCTGGGCATGG + Intergenic
1160759935 19:778614-778636 AATTTTTTTTTGGCTGGGCATGG - Intergenic
1160817038 19:1040934-1040956 ATCCTTGCCTGGGCTGGGCCAGG + Intronic
1161045876 19:2134444-2134466 ATTTTTTTTAGGGCTGGGCGTGG + Intronic
1161377752 19:3948918-3948940 ATCCTACCCTGGGCTGGGCATGG + Intergenic
1161566010 19:5003199-5003221 ATCCCTGCTTGGGCCGGGCATGG + Intronic
1162255551 19:9486447-9486469 ATTTTCTTTTAGGCTGGGCACGG + Intronic
1162555872 19:11385155-11385177 TTATTCTCTTGGGCTGGGCCCGG + Intronic
1162565359 19:11443120-11443142 AGCTTTTTTGTGGCTGGGCATGG + Intronic
1162601194 19:11671082-11671104 ATTTGTCCTTGTGCTGGGCATGG + Intergenic
1162688906 19:12412747-12412769 ATCTTATCCTGGGCTGGGGGTGG + Intronic
1163056973 19:14727316-14727338 CTCTTTTCTTGGGCCGGGCTTGG - Intronic
1163108895 19:15145619-15145641 AGATATTCTAGGGCTGGGCATGG + Intergenic
1163372501 19:16909252-16909274 AAATTTTTTTTGGCTGGGCACGG + Intronic
1163522792 19:17801795-17801817 AAATTTTTTTTGGCTGGGCATGG + Intronic
1163624518 19:18381436-18381458 AATTTTTTTTAGGCTGGGCACGG - Intronic
1163814400 19:19455197-19455219 ATTTTTTTGGGGGCTGGGCACGG + Intronic
1163870482 19:19817089-19817111 ATATTTTATTTGGCTGGGCGTGG - Intronic
1164031246 19:21407577-21407599 AATTTTTATTAGGCTGGGCATGG - Intronic
1164116190 19:22221459-22221481 ATTTATTCAGGGGCTGGGCATGG + Intergenic
1164187773 19:22886341-22886363 TTATTTTGTTTGGCTGGGCACGG - Intergenic
1164199887 19:23008940-23008962 ATTTATTCAGGGGCTGGGCATGG + Intergenic
1164437877 19:28247816-28247838 ATATTATCTAGGGCTGGGCAAGG + Intergenic
1164957569 19:32400204-32400226 ATGAGTTCTAGGGCTGGGCATGG + Intergenic
1165287845 19:34857710-34857732 TCCTTTTCTCTGGCTGGGCATGG - Intergenic
1165306889 19:35008397-35008419 TACTTTACATGGGCTGGGCACGG + Intronic
1165380608 19:35476835-35476857 ATATTATGTTAGGCTGGGCATGG + Intergenic
1165843438 19:38803305-38803327 ATTTGTTCTTGGGCTGGACATGG - Intronic
1166385747 19:42379713-42379735 ATCTGTGCCTGGGCTAGGCATGG - Intergenic
1166596662 19:44056223-44056245 ATTTTTTCTTTGGCTGGGCGCGG + Intronic
1166707572 19:44916525-44916547 AGATGGTCTTGGGCTGGGCACGG + Intronic
1166842469 19:45706522-45706544 AAGTTCTCATGGGCTGGGCACGG - Intergenic
1167020370 19:46870286-46870308 TTCTTCTTCTGGGCTGGGCACGG + Intergenic
1167022560 19:46889026-46889048 CCCTGTTCTTGGACTGGGCATGG + Intergenic
1167252021 19:48404375-48404397 AGGTTTTATTAGGCTGGGCACGG + Intronic
1167627126 19:50598581-50598603 ATATTTTCACTGGCTGGGCATGG + Intergenic
1167874456 19:52399675-52399697 CTCTTTTCTTGGGATGGACTAGG + Intronic
1167952953 19:53042322-53042344 ATCTTTGTTTGGGCCGGGCGTGG - Intergenic
1168278595 19:55291246-55291268 ATTTTTTTTTTGGCTGGGCATGG + Intronic
1168375290 19:55872136-55872158 ATTTCTGTTTGGGCTGGGCACGG - Intronic
1168433003 19:56296024-56296046 ATGCTTTTTAGGGCTGGGCAGGG + Intronic
1168605559 19:57757124-57757146 AATTATTTTTGGGCTGGGCATGG - Exonic
1168665687 19:58203291-58203313 AGCTGTAATTGGGCTGGGCACGG + Intronic
925475735 2:4212398-4212420 AGCTTTCCCTAGGCTGGGCATGG + Intergenic
925603954 2:5639377-5639399 ATATATGCTTTGGCTGGGCATGG + Intergenic
926298816 2:11587933-11587955 ATCTTCTGATGGGCTGGGCACGG + Intronic
927172584 2:20382565-20382587 GTCCTTTTTTAGGCTGGGCATGG - Intergenic
927223507 2:20737961-20737983 ATCGATTCTTGGGCCGGACATGG + Intronic
927283219 2:21329266-21329288 ATTTCTTTTTGGGCTGGGCATGG - Intergenic
927353437 2:22145682-22145704 ATTCATACTTGGGCTGGGCATGG - Intergenic
927790610 2:26006534-26006556 ACCTTTGCTGAGGCTGGGCATGG - Intergenic
927872052 2:26629935-26629957 CTCTTTTCTTGGGTTGAGGATGG - Intronic
928004538 2:27552102-27552124 AGCTAGTCTAGGGCTGGGCACGG - Intronic
928528789 2:32169465-32169487 ATCTTTTTCTTGGCTGGCCATGG - Intronic
928951201 2:36814449-36814471 ATCAAGTCTTGGGCAGGGCATGG + Exonic
929087936 2:38186792-38186814 ATCTCTTGGTCGGCTGGGCACGG - Intergenic
929184018 2:39074575-39074597 ATATTTTCTCTGGCTGGGCACGG + Intronic
929426173 2:41846820-41846842 ATCTTCTCTGGGGCTGGGTGCGG - Intergenic
929478419 2:42277855-42277877 AGGTTTGCTTGGGCTGGGCATGG - Intronic
929638496 2:43550427-43550449 ATCTTTTCTTGGTCTTTGCGTGG - Intronic
929688745 2:44057247-44057269 AGCTTTTCTGGGGCCGAGCATGG + Intergenic
929831719 2:45352290-45352312 ATTTTTTCCTGGGCTTGACAGGG - Intergenic
930039591 2:47110301-47110323 ATTATATTTTGGGCTGGGCACGG + Intronic
930043172 2:47145018-47145040 AACTCTTCTGTGGCTGGGCACGG - Intronic
930061318 2:47291284-47291306 TTTTCTTCTTGGGCCGGGCATGG - Intergenic
930426348 2:51217493-51217515 ATCATTTTGTGGGCTGGGCATGG - Intergenic
930545044 2:52756833-52756855 TTAATTGCTTGGGCTGGGCACGG + Intergenic
930703646 2:54483902-54483924 ATCTGTATTGGGGCTGGGCATGG + Intronic
930792611 2:55350205-55350227 TTCTTAGCTTAGGCTGGGCACGG - Intronic
930807846 2:55509742-55509764 ACCTTAACCTGGGCTGGGCAAGG + Intergenic
930910463 2:56623288-56623310 ATATTTTCTTAGGCCGGGCGCGG - Intergenic
931139679 2:59443938-59443960 ATTATTTGCTGGGCTGGGCACGG + Intergenic
931234262 2:60400047-60400069 ATCTCTCCTGGGGCTGGGCGCGG + Intergenic
931403651 2:61954963-61954985 ATCCTTTATCAGGCTGGGCATGG - Intronic
931564759 2:63603945-63603967 GTTATGTCTTGGGCTGGGCATGG - Intronic
931726241 2:65113788-65113810 ATCTTTTGAGGGGCTGGGCATGG + Intronic
932762668 2:74449272-74449294 ATGTTTTTGTGGGCCGGGCATGG + Intergenic
932849501 2:75171139-75171161 ATGGTTTCATGGGCTGGGCCAGG + Intronic
933199936 2:79436919-79436941 ATATTTAATTGGGCCGGGCATGG - Intronic
933331628 2:80899638-80899660 ATATTTTCGTGGGCCGGGCGCGG + Intergenic
933362003 2:81298961-81298983 ATCTGTTCTTAGGCAGGGCGTGG - Intergenic
933513721 2:83274559-83274581 ATACTTTTTTGGGCAGGGCATGG - Intergenic
934679631 2:96273916-96273938 ATGTTAACGTGGGCTGGGCATGG + Intergenic
935067918 2:99667864-99667886 ATTTTTTTTTTGGCTGGGCGTGG + Intronic
935146725 2:100400528-100400550 CTTTTTTCTTTAGCTGGGCATGG - Intronic
935297709 2:101665208-101665230 ATGATTTCCTGGGCTGGGCAAGG - Intergenic
935982140 2:108638134-108638156 AAACATTCTTGGGCTGGGCATGG - Intronic
936158403 2:110064810-110064832 ATCTAATCCTAGGCTGGGCACGG - Intergenic
936186258 2:110306512-110306534 ATCTAATCCTAGGCTGGGCACGG + Intergenic
936287866 2:111194975-111194997 ATCTATGCTTGTGCTGGGCGTGG + Intergenic
936391307 2:112076628-112076650 ACTTTTTCTAGGGCTGAGCAGGG - Intronic
936446630 2:112601248-112601270 TTTTTTTTTTTGGCTGGGCATGG - Intergenic
936515740 2:113180369-113180391 ATGTTCTCTAGTGCTGGGCAGGG + Intronic
936644416 2:114352022-114352044 TTCTATTTTTGGGCTGGGCATGG - Intergenic
937430122 2:121831377-121831399 ATCATTCTTAGGGCTGGGCATGG + Intergenic
937578776 2:123458058-123458080 ATATTTTTTCAGGCTGGGCATGG + Intergenic
938096124 2:128465381-128465403 TTGTTTTCCTGGGCTGGGCCAGG + Intergenic
938422759 2:131157226-131157248 ACCTGGTCCTGGGCTGGGCATGG + Intronic
938784705 2:134615945-134615967 CTCTGCTCTTAGGCTGGGCATGG - Intronic
938796937 2:134725262-134725284 ATCTTTTCTGCAGCTGGGCATGG - Intergenic
938837634 2:135123017-135123039 TACTTGTCTTGGGCTGGGCACGG - Intronic
939438088 2:142204733-142204755 AGCTTTTACTGGGCTGGGCGCGG + Intergenic
939963832 2:148591528-148591550 ATAATTTCGTGGGCTGGGCGTGG + Intergenic
940015831 2:149102899-149102921 ATTTCTTCCTTGGCTGGGCATGG - Intronic
940175995 2:150878301-150878323 ACTCTTTCCTGGGCTGGGCATGG - Intergenic
940297647 2:152144825-152144847 ATCTTTGCCAGGGCTGGGCGCGG - Intronic
940331984 2:152485065-152485087 AAATATTCTGGGGCTGGGCATGG + Intronic
941207673 2:162594329-162594351 AACTTTCCTTGGGTTGGGGATGG - Intronic
941254800 2:163215043-163215065 ATCCTTTCTAGGGCCGGGCACGG - Intergenic
941255540 2:163226679-163226701 ATCATTTCTCAGGCTGGGCACGG + Intergenic
941552941 2:166939389-166939411 TTCTTTTCTTGGGCTGGGCACGG + Intronic
941727055 2:168872256-168872278 TTCTTTTTTCAGGCTGGGCATGG - Intronic
941898997 2:170659496-170659518 AACTTTTTTTTGGCTGGGCATGG - Intergenic
942036956 2:172019423-172019445 AACTTTCATGGGGCTGGGCATGG + Intronic
942189096 2:173453537-173453559 TTTTTTTTTTTGGCTGGGCACGG + Intergenic
942363551 2:175197966-175197988 ATATTTATTTGGGCCGGGCATGG + Intergenic
942959220 2:181810136-181810158 AACCAATCTTGGGCTGGGCACGG + Intergenic
943565306 2:189509711-189509733 ATGGTTTCATGGGCTGGGCCTGG + Intergenic
943654953 2:190498857-190498879 ATTTTTTTCTGGGCTGGGCATGG + Intronic
943660251 2:190552440-190552462 TTCTCTTCTTTGGCTGGTCAAGG + Intergenic
944240877 2:197483907-197483929 AACTTCTCTGTGGCTGGGCAAGG + Intergenic
944395233 2:199259167-199259189 AACTATAGTTGGGCTGGGCAGGG - Intergenic
944568338 2:201015167-201015189 ACCTTTTCTTGCGCAGTGCAAGG - Intronic
944766049 2:202865176-202865198 ATCTCCTCTTTGGCCGGGCATGG + Intronic
944909677 2:204297974-204297996 AGCTTCTTTTGGGCCGGGCACGG + Intergenic
945498091 2:210534287-210534309 ATCTTCACTTGTGCTGGGAAAGG + Intronic
946176026 2:217922428-217922450 TTCTGAGCTTGGGCTGGGCAGGG + Intronic
946340683 2:219065897-219065919 TTTTTTTCTAGGGCTGGGCTTGG + Intergenic
946644722 2:221820666-221820688 ATCTCTTCCTGGGCTTGGGAGGG - Intergenic
947380282 2:229538827-229538849 TATTTTTCTTGGGCCGGGCACGG - Intronic
947673183 2:231954731-231954753 ATGTTACGTTGGGCTGGGCACGG - Intergenic
947796922 2:232899316-232899338 ATCTCTGCTTGGTCTGGGAATGG + Intronic
948085507 2:235243471-235243493 ATGATTTTATGGGCTGGGCATGG + Intergenic
948392216 2:237620401-237620423 AAATTTTTTGGGGCTGGGCATGG - Intergenic
1168782986 20:510463-510485 ACATATTCTTGGGCTGGGCGAGG - Intronic
1169114133 20:3051981-3052003 ATCTTTCCCTGGGCCAGGCACGG + Intergenic
1170251110 20:14283788-14283810 CTCTTTTGTATGGCTGGGCATGG - Intronic
1170540584 20:17383454-17383476 CTGTTTTCTTGGGATGGACAAGG - Intronic
1170558956 20:17539400-17539422 ATATATTCATGGGCTGGGCATGG - Intronic
1170622729 20:18008989-18009011 ATTATTTTTTTGGCTGGGCACGG - Intronic
1171142513 20:22755297-22755319 TTCTGTTCTGTGGCTGGGCAAGG - Intergenic
1171480328 20:25450530-25450552 AGTTGTTCATGGGCTGGGCACGG + Intronic
1172280183 20:33702443-33702465 ATATTTTTTTAGGCTGGGCGTGG + Intergenic
1172522983 20:35580352-35580374 ATATATTTTTTGGCTGGGCATGG + Intergenic
1172535684 20:35671389-35671411 ATATTTTCTGTGGCTGGGCACGG - Intronic
1172536735 20:35679470-35679492 AACATCTCATGGGCTGGGCACGG - Intronic
1172908472 20:38387711-38387733 ATCTTTTTTTAGGCTGGGCATGG + Intergenic
1172923636 20:38510618-38510640 ATCTTTTATAGGGCCGGGCGCGG + Intronic
1172986445 20:38995232-38995254 AGTTTCTCCTGGGCTGGGCACGG + Intronic
1173233886 20:41226105-41226127 TACTTATCTTGGGCTGGGCGCGG + Intronic
1173626673 20:44477943-44477965 ATTTTTTCTTGGGCTGTGTGTGG - Intronic
1173804975 20:45918732-45918754 ATCTCTTTCTGGGCTAGGCATGG + Intergenic
1174241832 20:49142376-49142398 AATTTTTTTTTGGCTGGGCACGG - Intronic
1174614575 20:51825885-51825907 ATTTTTTTGTAGGCTGGGCACGG - Intergenic
1174632237 20:51967900-51967922 ATCTCCTCCTAGGCTGGGCATGG - Intergenic
1174815585 20:53684343-53684365 GGTTTTTCTTGGGCCGGGCATGG + Intergenic
1174820214 20:53720179-53720201 AGATATTCTTCGGCTGGGCATGG + Intergenic
1174903272 20:54523274-54523296 TTTATTTTTTGGGCTGGGCATGG + Intronic
1175069583 20:56322025-56322047 TTCTCTACCTGGGCTGGGCATGG - Intergenic
1175116214 20:56684415-56684437 GTCTTTTCTTGGGATGGAAAAGG - Intergenic
1175382426 20:58572888-58572910 ATGTTTTTTCCGGCTGGGCATGG - Intergenic
1175676007 20:60947561-60947583 ATATTTTTTTTGGCTGGGCGTGG - Intergenic
1176203130 20:63873032-63873054 CTCTTTACTAGGACTGGGCATGG - Intronic
1176204468 20:63880598-63880620 TTGTATTTTTGGGCTGGGCACGG + Intronic
1176317658 21:5263117-5263139 TTCATTTCTGGGGCCGGGCATGG + Intergenic
1176350559 21:5792249-5792271 TTCATTTCTGGGGCCGGGCACGG + Intergenic
1176357373 21:5912833-5912855 TTCATTTCTGGGGCCGGGCACGG + Intergenic
1176384469 21:6131642-6131664 TTCTGTTTTTAGGCTGGGCACGG + Intergenic
1176475525 21:7199892-7199914 TTCATTTCTGGGGCCGGGCATGG + Intergenic
1176524937 21:7858849-7858871 ATGCTATCTTTGGCTGGGCATGG + Intergenic
1176544880 21:8190319-8190341 TTCATTTCTGGGGCCGGGCACGG + Intergenic
1176563831 21:8373364-8373386 TTCATTTCTGGGGCCGGGCACGG + Intergenic
1176628247 21:9113496-9113518 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1176872431 21:14094421-14094443 TTTTTTTTTTAGGCTGGGCACGG + Intergenic
1177462724 21:21433973-21433995 ACCTTTTCCTGGGTTTGGCAGGG - Intronic
1177608891 21:23420275-23420297 AACTTCTTTTTGGCTGGGCATGG - Intergenic
1178577771 21:33810080-33810102 ATTTATTTTTGGGCTGGGCACGG - Intronic
1178602339 21:34005432-34005454 AACATTTTTTTGGCTGGGCATGG + Intergenic
1178658957 21:34488862-34488884 ATGCTATCTTTGGCTGGGCATGG + Intergenic
1179104095 21:38383278-38383300 AGCTTTACTGGGGCTGGGGAAGG - Exonic
1179560720 21:42214517-42214539 AGCTTGCCTTGGGCTGGGCCTGG - Intronic
1179739003 21:43406610-43406632 TTCTGTTTTTAGGCTGGGCACGG - Intergenic
1180404409 22:12537275-12537297 TTCATTCCTGGGGCTGGGCATGG - Intergenic
1180438908 22:15344565-15344587 ATATTCCCTTTGGCTGGGCAAGG - Intergenic
1180689083 22:17695608-17695630 AAATTTTTTTTGGCTGGGCATGG - Intronic
1180905701 22:19409571-19409593 ATCATTACTAAGGCTGGGCACGG - Intronic
1181344806 22:22211328-22211350 CTCTTTTCTCCTGCTGGGCAGGG - Intergenic
1181497274 22:23294687-23294709 ATATTTCTATGGGCTGGGCACGG - Intronic
1182029270 22:27144731-27144753 CTCTTTTCTTGGGGTGGGGGGGG + Intergenic
1182232840 22:28851893-28851915 ATCTGGTCCTGGGCTGGGCGTGG - Intergenic
1182401895 22:30084778-30084800 ATATTTGCTGAGGCTGGGCATGG - Intronic
1182523615 22:30901357-30901379 TTCTTTATGTGGGCTGGGCATGG - Intronic
1182746555 22:32610280-32610302 TTCTTTTTTTGGGGGGGGCAGGG - Intronic
1182800673 22:33029471-33029493 ATCATTTTTAGGGTTGGGCATGG - Intronic
1183213065 22:36462790-36462812 ATTTATTTTTGGGCCGGGCACGG + Intergenic
1183256428 22:36765357-36765379 ATCTTCCCTTCTGCTGGGCATGG + Intronic
1183421429 22:37713791-37713813 ATCTATTCCAGGGCTGGCCATGG - Intronic
1183848908 22:40566538-40566560 ATCATTTTGAGGGCTGGGCATGG + Intronic
1184066240 22:42123440-42123462 ATCTATAATTGGGCTGGGCAGGG - Intergenic
1184068708 22:42135592-42135614 ATCTATAATTGGGCTGGGCAGGG - Intergenic
1184122021 22:42457842-42457864 AGTTATTCTTAGGCTGGGCATGG + Intergenic
1184241340 22:43212677-43212699 ACCTTTTCCAGGGCCGGGCAAGG - Intronic
1184242036 22:43216335-43216357 AACTTATTTTGGGCCGGGCATGG - Intronic
1184749808 22:46478840-46478862 GTCTCATCTTCGGCTGGGCACGG - Intronic
1203249750 22_KI270733v1_random:106557-106579 TTCATTTCTGGGGCCGGGCACGG + Intergenic
950069385 3:10140066-10140088 ATTTATTTTTGAGCTGGGCACGG + Intergenic
950085120 3:10251856-10251878 TTTTTTTTTTGGGCTGGGCGTGG + Intronic
951146130 3:19229592-19229614 AATGTTTCTTGGGCTGGGCCTGG - Intronic
951224209 3:20102024-20102046 AATTTTTTTTAGGCTGGGCATGG + Intronic
951250273 3:20386368-20386390 AGCTTTCTTTGGCCTGGGCATGG - Intergenic
952323619 3:32300666-32300688 ATATTCTTTTAGGCTGGGCACGG + Intronic
952361696 3:32636633-32636655 ATGTTTTAATGGGGTGGGCAGGG - Intergenic
952679053 3:36070002-36070024 ATAGTTTCTTTGGCTGTGCATGG + Intergenic
952770998 3:37000299-37000321 AGCTCTTCTCAGGCTGGGCATGG + Intronic
952781365 3:37102790-37102812 ATATTTGTTTGGGCCGGGCATGG - Intronic
953072602 3:39536637-39536659 AGCTTATCTAGGGCCGGGCACGG - Intergenic
953185540 3:40634450-40634472 TTCTTTTCTTCTGCTGGGCTTGG - Intergenic
953324761 3:42003574-42003596 AAGTTTTTTTGGGCTGGGCATGG + Intergenic
953514780 3:43579425-43579447 AACTTGTCTGAGGCTGGGCACGG + Intronic
954073724 3:48161424-48161446 AGCATCTTTTGGGCTGGGCATGG + Intronic
954252378 3:49377856-49377878 AACTCTTTTTGGGCTGGGCACGG + Intronic
954395608 3:50291875-50291897 ATCCTTTCCTGGACTGGTCAAGG - Intronic
955276381 3:57551154-57551176 ATTTTTGTTTTGGCTGGGCACGG - Intergenic
955307981 3:57853649-57853671 ATATATCTTTGGGCTGGGCACGG + Intronic
955363302 3:58291547-58291569 AACTTTTCCTGGGCTGGGTGTGG - Intronic
955467559 3:59252839-59252861 AGCCATTCCTGGGCTGGGCATGG + Intergenic
955760473 3:62275519-62275541 GTGTTCTCTGGGGCTGGGCATGG + Intronic
956423770 3:69111729-69111751 ATATTATTCTGGGCTGGGCATGG - Intronic
956461085 3:69473246-69473268 ATGTATTCTTGGGCTTGACAAGG + Intronic
956482044 3:69682635-69682657 AACAGTGCTTGGGCTGGGCACGG - Intergenic
957137504 3:76308086-76308108 ATCCCTACTTTGGCTGGGCATGG + Intronic
957343532 3:78931534-78931556 ATGTTGTTTTTGGCTGGGCACGG - Intronic
957417448 3:79924485-79924507 ATGTATTTTTGGGCTGGGCATGG + Intergenic
957443191 3:80279853-80279875 ATCATTTCCTGGGCTGGGGGTGG - Intergenic
958096218 3:88948634-88948656 ATCTCTTCTTGCATTGGGCAGGG + Intergenic
958152592 3:89709781-89709803 ATGTATCCATGGGCTGGGCAAGG + Intergenic
958545211 3:95539654-95539676 ATGATTTATTGGGCTGGGCGTGG + Intergenic
958878322 3:99640468-99640490 ATCTTTTCTTGGGGTGGAGGGGG + Intronic
959686611 3:109154144-109154166 ATCTTTCCTTGGCCTAGGTATGG + Intergenic
959878044 3:111409565-111409587 TTCTTTTCTTCGGCTGGGTTTGG - Intronic
960215427 3:115029816-115029838 ATCTTATCTTGGGTTGGAGAAGG + Intronic
960904906 3:122590562-122590584 ATATTATTTGGGGCTGGGCACGG - Intronic
961127864 3:124437397-124437419 ATCTTTCATCTGGCTGGGCACGG + Intronic
961468440 3:127096192-127096214 AACATTTCTTGGGCCAGGCAGGG - Intergenic
961849348 3:129799518-129799540 ACATTTTCTGGGGCCGGGCACGG + Intronic
961853557 3:129846161-129846183 ATTCTCTTTTGGGCTGGGCATGG + Intronic
962228132 3:133633498-133633520 CTCTTTTCTTTGGCTGGACGTGG + Intronic
962518881 3:136179775-136179797 GGCTTATCTTGGGCTGGGCATGG + Intronic
963148986 3:142024082-142024104 ATCTTTTAATGGGCTGGGCATGG - Intronic
963318006 3:143781515-143781537 ATCTTTTCTTCAGCTTGTCATGG - Intronic
963478487 3:145836835-145836857 ATCCTCTCTTTGGCTGGGGACGG - Intergenic
964219959 3:154331857-154331879 AAAGTTTCTGGGGCTGGGCACGG + Intergenic
964735668 3:159914567-159914589 AGATTTTCTTGGGCTGAGGAAGG - Intergenic
965699462 3:171445003-171445025 ATAGTTTCCTTGGCTGGGCATGG - Intronic
966184744 3:177217454-177217476 TTTTTATCTTGGGCTGGGCCTGG - Intergenic
966613257 3:181889150-181889172 GTCTTTTTTTGGACGGGGCAGGG + Intergenic
967159125 3:186719448-186719470 ATGTTTGCTTGGGCCGGGCGCGG + Intronic
967654855 3:192034816-192034838 ATCTCTGCTTGGCCTGTGCATGG - Intergenic
967773168 3:193357102-193357124 CTCTGTTTCTGGGCTGGGCATGG - Intronic
968116742 3:196096233-196096255 ATATTTTCAAGGGCTGGGTATGG - Intergenic
968154249 3:196366219-196366241 AACTATTTTTAGGCTGGGCATGG + Intronic
968682979 4:1934373-1934395 ATCTTTTCCTAGGCCGGGCATGG - Intronic
968786505 4:2626012-2626034 ATGTGCTCCTGGGCTGGGCATGG - Intronic
969034571 4:4242807-4242829 AAATTTTCTTAGGCCGGGCATGG - Intronic
969946404 4:10787853-10787875 GTCTAGTGTTGGGCTGGGCATGG + Intergenic
970314166 4:14813552-14813574 TTTTTTTTTTTGGCTGGGCACGG + Intergenic
970393625 4:15642524-15642546 AAGTTTTCATAGGCTGGGCATGG - Intronic
970736147 4:19170571-19170593 TTCTTTTCTTGGGGTTGGGAGGG + Intergenic
970773648 4:19646448-19646470 ATATTTTCTTGGTTTGGGCTAGG + Intergenic
971334953 4:25713873-25713895 ATCTATTCTTTGGCCGGGCACGG - Intergenic
972097093 4:35361764-35361786 ATCTTTTCTTCTGCTGGGCTTGG + Intergenic
972486925 4:39550570-39550592 ATGTCTGCATGGGCTGGGCACGG - Exonic
973316412 4:48765131-48765153 ATCTTTTTCCTGGCTGGGCATGG - Intronic
973342763 4:49023060-49023082 TTCTTTTCTTGTGCTGGGTTTGG + Intronic
974006175 4:56559476-56559498 AAACTTCCTTGGGCTGGGCAAGG - Exonic
974267093 4:59599225-59599247 AGCTTTTGTTGGCCTGGGAAAGG - Intergenic
975255229 4:72226937-72226959 AAGTTCTTTTGGGCTGGGCACGG - Intergenic
975329107 4:73093662-73093684 TTGAGTTCTTGGGCTGGGCACGG - Intronic
975356573 4:73412733-73412755 AAATCTTCTTAGGCTGGGCAAGG - Intronic
975357149 4:73420916-73420938 TTCTTCTGTTGGGCTAGGCAAGG - Intronic
975748188 4:77494941-77494963 AGCTCTTCCTGGGCTGGGCGCGG - Intergenic
976324047 4:83750806-83750828 ATCTTTTCCTGGGGTTGACAAGG - Intergenic
976448059 4:85154363-85154385 ATATTATTTTAGGCTGGGCATGG - Intergenic
977813629 4:101387715-101387737 TTCTTTTCTTCCGCTGGGCTTGG + Intergenic
977819323 4:101453717-101453739 ATCCTTCTTTTGGCTGGGCACGG - Intronic
978000470 4:103551858-103551880 ATGACTTTTTGGGCTGGGCATGG + Intergenic
978211661 4:106144731-106144753 ATATTTTTTTGGGCTGGGCATGG + Intronic
978284930 4:107065398-107065420 ATGATTTCTTGGGTTGAGCAAGG + Intronic
978524450 4:109651373-109651395 GGCTATTCTAGGGCTGGGCATGG - Intronic
978849919 4:113322020-113322042 ATCTGTTTTTTGGCTGGGCACGG - Intronic
979382247 4:120020511-120020533 ATGTAATCTTGGGCTGGGCACGG - Intergenic
979437571 4:120711993-120712015 AAACATTCTTGGGCTGGGCATGG + Intronic
979536486 4:121826691-121826713 ATATAACCTTGGGCTGGGCACGG + Intronic
979597539 4:122550847-122550869 ATATCTTCTGGGGCTGGGCATGG + Intergenic
979619173 4:122779193-122779215 ATCTGTTATTTGGCTGGGCGCGG - Intergenic
980101468 4:128545425-128545447 ATATGCTTTTGGGCTGGGCATGG + Intergenic
980543108 4:134219832-134219854 ATTGTTTATTGGGGTGGGCAAGG - Intergenic
981336507 4:143574271-143574293 AACTATTCCTCGGCTGGGCATGG - Intergenic
981452294 4:144912178-144912200 TTTCTTTCCTGGGCTGGGCACGG - Intergenic
981818960 4:148864086-148864108 ATATCATCTGGGGCTGGGCACGG + Intergenic
981874056 4:149519712-149519734 ATCCTGTTTTGGGCTGGGCATGG + Intergenic
981948911 4:150382331-150382353 AACCATTCTGGGGCTGGGCACGG + Intronic
982349991 4:154404954-154404976 ATTTTCTCTTGGCATGGGCATGG + Intronic
982373214 4:154657175-154657197 ATTTTTTTTGTGGCTGGGCATGG + Intronic
982725992 4:158906920-158906942 GTTTTTTCTTGAGGTGGGCATGG - Exonic
982741676 4:159063266-159063288 AACTTATCTTGGGCCGGGCATGG + Intergenic
982755158 4:159209180-159209202 TTTTTTTTTTTGGCTGGGCATGG - Intronic
982757207 4:159235048-159235070 AATTTTTCATAGGCTGGGCACGG - Intronic
982794651 4:159630230-159630252 AATTCATCTTGGGCTGGGCATGG + Intergenic
982846771 4:160263064-160263086 ATCTTGTCTATGGCTGGGTAGGG + Intergenic
982909751 4:161124887-161124909 CTCTATTCTTTGGCAGGGCACGG - Intergenic
983365077 4:166776122-166776144 ACATTTTTCTGGGCTGGGCACGG + Intronic
983471805 4:168165965-168165987 ATTATTTCTAAGGCTGGGCATGG - Intronic
983921231 4:173347546-173347568 ATTATTTTTTGGGCTGGGCATGG - Intergenic
984417044 4:179475104-179475126 AACTTTTTTTAGGCTGGGCACGG + Intergenic
984794233 4:183643624-183643646 ATCTTCTTTCGGGCTGGGCATGG + Intronic
984911717 4:184679887-184679909 ATCTTTCCATGGGTGGGGCAGGG - Intronic
985088516 4:186340192-186340214 ATCTTTTCTTTGGTGGGACACGG + Intergenic
986182711 5:5408490-5408512 AGCTTTCTGTGGGCTGGGCACGG - Intergenic
986211118 5:5673321-5673343 AAGTTTTCTGCGGCTGGGCACGG - Intergenic
986222455 5:5781141-5781163 TTACTTACTTGGGCTGGGCATGG - Intergenic
986816780 5:11421248-11421270 ATCTTTTCTGGGAATGGGCAGGG - Intronic
987105855 5:14638233-14638255 TTGTCTTCTTTGGCTGGGCATGG - Intergenic
987290285 5:16502246-16502268 ATGCTTACTTAGGCTGGGCATGG - Intronic
987293766 5:16532234-16532256 AAGTTTTCCTGGGCTGGGCGTGG + Intronic
987332338 5:16868312-16868334 ATCTGCTCTTCAGCTGGGCACGG + Intronic
988010923 5:25484500-25484522 AACATTTATTGGGCTGGGTACGG - Intergenic
988974526 5:36501818-36501840 ATCTTTTCTTTGAGGGGGCAGGG - Intergenic
989481918 5:41940550-41940572 ATGTATTTTAGGGCTGGGCACGG - Intronic
989752847 5:44916392-44916414 AAGTTCTTTTGGGCTGGGCACGG - Intergenic
990112940 5:52350479-52350501 ATTTTTGAGTGGGCTGGGCATGG + Intergenic
990302809 5:54465797-54465819 ATTTAGTTTTGGGCTGGGCACGG + Intergenic
990406162 5:55493157-55493179 ATTTTTTAATTGGCTGGGCATGG + Intronic
990469039 5:56096790-56096812 ATGTATTTTTGGGCTGGGCGTGG + Intergenic
991613873 5:68476089-68476111 AGCTTTTTATGGGCTGGGCGCGG + Intergenic
991949138 5:71931086-71931108 ATATCTTGTTGGGCTGGGCTCGG - Intergenic
992292738 5:75296404-75296426 TTATATTTTTGGGCTGGGCATGG + Intergenic
992474779 5:77090561-77090583 ATCTTCTCTTCGGCTGGGTGCGG - Intergenic
992555907 5:77903451-77903473 AATGTGTCTTGGGCTGGGCATGG + Intergenic
992637013 5:78734684-78734706 GAATTTTCTTGGGCTGGGCATGG + Intronic
993523892 5:88940510-88940532 ATCATGTTGTGGGCTGGGCACGG - Intergenic
995147288 5:108800754-108800776 ATCTTTGCCTGGGCCGGGCGTGG + Intronic
995510975 5:112908843-112908865 ATCATTAGCTGGGCTGGGCATGG - Intronic
995613288 5:113933844-113933866 AGATAATCTTGGGCTGGGCACGG - Intergenic
995622790 5:114045896-114045918 ATATTTTCATAAGCTGGGCATGG + Intergenic
996534673 5:124565129-124565151 ATTTTCTTTTAGGCTGGGCATGG - Intergenic
997370273 5:133355365-133355387 GTCTAGTTTTGGGCTGGGCATGG + Intronic
997385009 5:133465581-133465603 ATCAGTTCTTGCTCTGGGCAGGG + Intronic
997477441 5:134152828-134152850 AAATGTTCCTGGGCTGGGCACGG - Exonic
997575213 5:134970447-134970469 ATCTTATAATGGGCTGGGCATGG - Intronic
997846367 5:137289940-137289962 ATCTTTTCTTATGCTCGGTATGG - Intronic
998024944 5:138808039-138808061 ATAATGTCTTAGGCTGGGCACGG - Intronic
998398731 5:141836361-141836383 GACTTTTCTCGGGCTGGGGAGGG + Intergenic
998455923 5:142273018-142273040 AACCTTTCTAGGGCTGGGCACGG + Intergenic
998508451 5:142691128-142691150 ATGTTTACTTAGGCTGGGCGTGG + Intronic
998812948 5:145984864-145984886 ATCTTGGCTTCAGCTGGGCATGG + Intronic
998840551 5:146249393-146249415 ATGTTAAATTGGGCTGGGCACGG + Intronic
998844820 5:146297915-146297937 AACTATTCTGTGGCTGGGCACGG + Intronic
999080454 5:148838527-148838549 GACTATTCTTGGCCTGGGCAAGG + Intergenic
999174324 5:149621170-149621192 ATCTTTTCTAAGGCTGGGCAAGG + Intronic
999221960 5:149987798-149987820 ATCATGTGTTAGGCTGGGCACGG + Intronic
999314745 5:150576318-150576340 CTCTGTTCTTGGCCTGGGCAGGG - Intergenic
999345352 5:150813560-150813582 AAATTTTTTTGGGCCGGGCACGG - Intergenic
999734712 5:154504320-154504342 TGATTTTCGTGGGCTGGGCATGG - Intergenic
1000002512 5:157152438-157152460 ATGTTTTTATTGGCTGGGCATGG - Intronic
1000643355 5:163732131-163732153 ATGTTTATTTGGGCTGGGCATGG + Intergenic
1001022869 5:168198484-168198506 AAATTTTATTGGGCAGGGCATGG - Intronic
1001498883 5:172212954-172212976 AACTGCTCTAGGGCTGGGCACGG - Intronic
1001507257 5:172289558-172289580 ATTTCTTTTTGGGCTGGGCACGG + Intergenic
1001617269 5:173052870-173052892 ATATTATTTGGGGCTGGGCATGG - Intergenic
1001978281 5:176018991-176019013 ATATTATATTGGGCTGGGCGTGG + Intronic
1002239136 5:177824771-177824793 ATATTATATTGGGCTGGGCGTGG - Intergenic
1002486934 5:179545263-179545285 ATGTTTGCCTAGGCTGGGCACGG - Intergenic
1002819791 6:714013-714035 GTCTTTTCCCAGGCTGGGCATGG + Intergenic
1003122582 6:3330076-3330098 GTGTGTTCTGGGGCTGGGCAGGG - Intronic
1003574468 6:7279535-7279557 CTCTTATCTTGGGCTGGGCGCGG + Intronic
1003944509 6:11061833-11061855 TTCCCTTCTTTGGCTGGGCATGG + Intergenic
1004373513 6:15072924-15072946 ATGTTCTCAGGGGCTGGGCACGG - Intergenic
1004608336 6:17214836-17214858 TTCTTTTTTTGGGAGGGGCAGGG - Intergenic
1004730191 6:18350308-18350330 TGCTTTTTTGGGGCTGGGCACGG + Intergenic
1004951537 6:20678271-20678293 TGTTCTTCTTGGGCTGGGCATGG + Intronic
1005028810 6:21490601-21490623 TTCTTTTTTAAGGCTGGGCATGG - Intergenic
1005952532 6:30642350-30642372 CAGATTTCTTGGGCTGGGCATGG + Intronic
1006028132 6:31160316-31160338 AACTTGTCCAGGGCTGGGCATGG + Intronic
1006037837 6:31227995-31228017 AACTGTCCTTGGGTTGGGCACGG + Intergenic
1006121423 6:31808706-31808728 ATATTTTCTGGGGCTGGGCACGG + Intergenic
1006769573 6:36541188-36541210 ATATATTTGTGGGCTGGGCACGG - Intronic
1006806138 6:36790831-36790853 ATTTTTTTTGGGGCCGGGCACGG - Intronic
1007440069 6:41851662-41851684 AAATTTACCTGGGCTGGGCAAGG + Intronic
1007532274 6:42553641-42553663 ATTTTATCTTGGGCTGGGCGTGG - Intergenic
1007652259 6:43430379-43430401 TTCTATTTCTGGGCTGGGCATGG - Intronic
1007753774 6:44085680-44085702 ATCTAGCCTTGAGCTGGGCATGG - Intergenic
1007790951 6:44307846-44307868 ATCTTTTGTGGGGGTGGGCAGGG + Intronic
1007832186 6:44647130-44647152 GTGTTTTCTTGGGGTAGGCAAGG + Intergenic
1007966353 6:46006960-46006982 ATGTCTTTTGGGGCTGGGCATGG - Intronic
1008695275 6:54028719-54028741 ATCTTTGCATGGGGTGGGGAAGG + Intronic
1008699237 6:54078979-54079001 ATTATTTCTTGGGCCGGGCGCGG - Intronic
1008956113 6:57217596-57217618 TTCGTATCTTAGGCTGGGCACGG - Intronic
1009417844 6:63435260-63435282 ATCTTCTCTTTGGCTGAACAAGG - Intergenic
1009473733 6:64061696-64061718 AGTTTTTATTAGGCTGGGCATGG + Intronic
1009904330 6:69849702-69849724 ATCTTTACTAGGGCTGGGCGTGG - Intergenic
1009985271 6:70774737-70774759 ATTTTTTTTTCGACTGGGCATGG + Intronic
1010073566 6:71773078-71773100 ATTTTGTCTTGGGCCAGGCATGG - Intergenic
1010201744 6:73288328-73288350 CAGTTTTCTTGGGCCGGGCACGG + Intronic
1010203601 6:73303886-73303908 ATTATTTTGTGGGCTGGGCACGG + Intronic
1010433259 6:75802176-75802198 AATATTTCTTTGGCTGGGCATGG + Intronic
1011442792 6:87404831-87404853 ATTTTTTATTGAGCCGGGCACGG - Intergenic
1011483959 6:87823074-87823096 ATATTTTCTTGGACCAGGCATGG - Intergenic
1011652613 6:89520809-89520831 CATTTGTCTTGGGCTGGGCATGG + Intronic
1011656982 6:89560876-89560898 ATCTTGTCTAGGGCAAGGCAGGG + Intronic
1011943841 6:92876165-92876187 TTATTTTATTGGACTGGGCATGG - Intergenic
1012545281 6:100412244-100412266 ATCACATCTTGGGCTGGGCATGG + Intronic
1012720384 6:102735345-102735367 ATATTTTTTTAGGCTGGGTACGG + Intergenic
1012844185 6:104368725-104368747 TTTTTTTTTTTGGCTGGGCATGG + Intergenic
1012998640 6:105998722-105998744 ATCTTTTCTTTGTCTGCCCAAGG + Intergenic
1013121175 6:107142536-107142558 CACTTTTTATGGGCTGGGCATGG - Intergenic
1013549982 6:111197994-111198016 AGCCTATCTTAGGCTGGGCACGG + Intronic
1014172930 6:118298882-118298904 TACTTTTATTGTGCTGGGCATGG + Intronic
1014204479 6:118642621-118642643 AGGCTTTCTTGGGTTGGGCACGG + Intronic
1014211463 6:118712662-118712684 ATCCTTTCCTGGGCTGGGCGCGG - Intergenic
1014421260 6:121248433-121248455 ATCTTTTCTTCTGCTGGGTTTGG - Intronic
1014851082 6:126340410-126340432 ATCCCTTCTCGGGCTGGGAATGG + Exonic
1015110642 6:129588404-129588426 ATATTTGGTTAGGCTGGGCATGG - Intronic
1015168081 6:130221142-130221164 ATCTTTTCACTGGCTGGGCGTGG - Intronic
1015174317 6:130289788-130289810 ATCTTTTCTTGGGCTGGGCACGG - Intronic
1016134523 6:140523141-140523163 ATCTTTTTTGGGGTTGGGGAGGG + Intergenic
1016336338 6:143009107-143009129 AATGTTTCATGGGCTGGGCATGG + Intergenic
1016394906 6:143613263-143613285 ATCTTTACATGGGCCGGGCGCGG - Intronic
1016490265 6:144592657-144592679 AGCTTTTCATTGGCTGGGCACGG - Intronic
1017045139 6:150340223-150340245 AGCTGTATTTGGGCTGGGCATGG + Intergenic
1017166278 6:151411247-151411269 ATCTCTTATAGGGCCGGGCATGG - Intronic
1017318068 6:153055564-153055586 ATTTTTTTTTGAGCTGAGCAAGG + Intronic
1017645370 6:156535107-156535129 AAATTTTTTTTGGCTGGGCATGG + Intergenic
1017767907 6:157622079-157622101 ATATTCTTTTCGGCTGGGCATGG + Intronic
1018554312 6:165034411-165034433 GCTGTTTCTTGGGCTGGGCAGGG - Intergenic
1018607378 6:165612265-165612287 ATATTTTGTTGGGTTGGGGAAGG - Intronic
1018748099 6:166778473-166778495 ATTGTTTTTTAGGCTGGGCATGG + Intronic
1018811076 6:167298821-167298843 TTTTTTTTTTTGGCTGGGCATGG + Intronic
1018985720 6:168635578-168635600 AAGTTTACTGGGGCTGGGCATGG + Intronic
1019599337 7:1873568-1873590 GGCTCTTCTGGGGCTGGGCAGGG + Intronic
1019615059 7:1955579-1955601 ATCTCTCTTTTGGCTGGGCATGG - Intronic
1020165228 7:5802383-5802405 AGCCTCTTTTGGGCTGGGCATGG + Intergenic
1020735131 7:11938813-11938835 ATATTTTGTTGGGCCGGGCATGG - Intergenic
1021095944 7:16536161-16536183 TAGTTTTTTTGGGCTGGGCATGG - Intronic
1021290129 7:18833024-18833046 ATTTTTTTTAAGGCTGGGCATGG - Intronic
1021306954 7:19044262-19044284 ATCCTCTTCTGGGCTGGGCATGG + Intronic
1021380735 7:19962674-19962696 AACCTATCTTGGGCTGGACACGG - Intergenic
1023378498 7:39582321-39582343 ATTTTTTTTTTGGCTGGGCATGG - Intronic
1023841134 7:44098198-44098220 ACACTTTCTAGGGCTGGGCATGG - Intergenic
1024231199 7:47365154-47365176 ATGTGTTATTGGGCTGGGCGCGG + Intronic
1024646075 7:51371461-51371483 AATTTTTGTGGGGCTGGGCATGG - Intergenic
1024776484 7:52793127-52793149 AGCATTTATTGGGCCGGGCATGG + Intergenic
1025036929 7:55599315-55599337 AATTTTTGTGGGGCTGGGCATGG - Intergenic
1025147985 7:56521598-56521620 TTTATTACTTGGGCTGGGCACGG - Intergenic
1025270505 7:57508438-57508460 ATCTTTTCCTGAGTTGTGCAGGG - Intergenic
1025973486 7:66350303-66350325 ATCATTTGTTCGGCTGGGCGCGG - Intronic
1026358740 7:69583357-69583379 ATCCATTCCTGGGCCGGGCACGG + Intergenic
1026556904 7:71416319-71416341 ATGTTTTATCAGGCTGGGCATGG + Intronic
1026594760 7:71725075-71725097 CTCTTGTTCTGGGCTGGGCATGG + Intergenic
1026950157 7:74341467-74341489 AACTTTCCTGAGGCTGGGCACGG - Intronic
1027059083 7:75071144-75071166 ATGTGTTCTTGGGCCAGGCACGG - Intronic
1027133414 7:75607517-75607539 TTTTTTTTTTAGGCTGGGCATGG - Intronic
1027240792 7:76326696-76326718 TTCATTGCTTGGGCTGGGGAGGG + Intergenic
1027376414 7:77555622-77555644 AGCGTTTCTTAGGCCGGGCACGG + Intronic
1027515563 7:79137751-79137773 ATCTGTATTTGGGCTGGTCATGG - Intronic
1027539644 7:79452526-79452548 AGCGTTTCTGGGGCTGGGCTGGG - Intronic
1028449225 7:90962194-90962216 ATCTAGTGTGGGGCTGGGCATGG + Intronic
1028610180 7:92701693-92701715 ATATTTTTTTTGGCTGGGCGCGG - Intronic
1028711840 7:93918290-93918312 TTTTTTTCTTGGGCAGGGGAAGG - Intergenic
1029142668 7:98422682-98422704 AAATTTTTTTTGGCTGGGCATGG + Intergenic
1029170374 7:98625853-98625875 GTCTTCTCAAGGGCTGGGCATGG + Intronic
1029426831 7:100500221-100500243 ATATTTTTTTAGGCTGGGCATGG - Intergenic
1029613311 7:101639656-101639678 ATATTTTCTTAGGCCGGGCGCGG + Intergenic
1029769290 7:102643352-102643374 ATTTTTTTTTGGGGGGGGCAGGG + Intronic
1029891033 7:103930756-103930778 ATGTGTTATGGGGCTGGGCACGG - Intronic
1030041583 7:105455757-105455779 ATAATTTACTGGGCTGGGCATGG + Intronic
1030491408 7:110239832-110239854 AACTTATTTTGGGCTGGGCACGG + Intergenic
1030632362 7:111909667-111909689 ATCTTTTTAGGGGATGGGCATGG + Intronic
1030929822 7:115508467-115508489 ATCTGTCCTTGGAGTGGGCAGGG + Intergenic
1031124711 7:117760075-117760097 ATTTGTTCTTGGGTTGGGCCAGG - Intronic
1031355714 7:120784191-120784213 AACTTAATTTGGGCTGGGCATGG + Intergenic
1031524769 7:122810882-122810904 ATATTTTTTTAGGCTGGGCATGG - Intronic
1031601766 7:123718683-123718705 ATATTATATGGGGCTGGGCATGG - Intronic
1031667126 7:124498354-124498376 AACTTTTTATAGGCTGGGCATGG + Intergenic
1032142422 7:129344862-129344884 ATCCTTCCTTCAGCTGGGCATGG + Intronic
1032185523 7:129722102-129722124 ATCTTTTTCTAGGCTGGGCGTGG + Intronic
1032232718 7:130089435-130089457 CTCTTTTTTTTGGCGGGGCATGG - Intronic
1032281224 7:130503516-130503538 ATATTTTCTTGGGCTGGGTGAGG + Intronic
1032388790 7:131542329-131542351 TTCTTTTCTTGTTCTGGGCATGG - Intronic
1032492938 7:132337977-132337999 ATCTTCTCTTGTGGTGGGGAAGG + Intronic
1032719097 7:134536443-134536465 AGTTTTTCTTGCGCTGGGGAGGG + Intronic
1032724071 7:134575213-134575235 AGATTTTCTTGGGCTGGGGAGGG + Intronic
1032980594 7:137277858-137277880 ATATATTTTTTGGCTGGGCATGG - Intronic
1033108302 7:138551259-138551281 ATGTTCACTTAGGCTGGGCACGG + Intronic
1033213636 7:139478885-139478907 ATCTTTTGATAGGCTGGGCTTGG - Intronic
1033995108 7:147336361-147336383 GGCTTTTCTTGTGCTGAGCATGG - Intronic
1034332804 7:150297559-150297581 GACTTTTCTTTGGCCGGGCACGG + Intronic
1034665233 7:152812319-152812341 GACTTTTCTTTGGCCGGGCACGG - Intronic
1034810607 7:154128677-154128699 AAATAGTCTTGGGCTGGGCACGG - Intronic
1034899409 7:154898296-154898318 CCCTTTACTTGGGGTGGGCAAGG - Intergenic
1034954570 7:155326713-155326735 GTGTTTTGTGGGGCTGGGCAGGG - Intergenic
1036172885 8:6507186-6507208 ATCATTAATAGGGCTGGGCATGG - Intronic
1036446456 8:8825461-8825483 ACCTGTTCTTAGGCTGGGCATGG - Intronic
1036467702 8:9016971-9016993 AACTTATCTCTGGCTGGGCATGG - Intronic
1036823720 8:11959750-11959772 ATTTTTTGTTTGGCAGGGCACGG - Intergenic
1037032757 8:14129054-14129076 ACCTTCTCTTGGGTCGGGCATGG + Intronic
1037163590 8:15800276-15800298 ATTTTCTCTCAGGCTGGGCATGG + Intergenic
1037453006 8:19036043-19036065 ATATTTTTTTTGGCTGGGCATGG - Intronic
1037995874 8:23352102-23352124 ATCCTGTCCAGGGCTGGGCACGG - Intronic
1038114589 8:24539146-24539168 TTTTTTTCTCGGGCAGGGCATGG + Intergenic
1038262226 8:26005986-26006008 TTTTTTTCTTGCGCTGGGGAGGG - Intronic
1038291949 8:26257665-26257687 ACACTTTTTTGGGCTGGGCATGG - Intergenic
1038293435 8:26270055-26270077 ATCAGTTCTTGGGCTGGGAGCGG - Intergenic
1038463920 8:27742572-27742594 TACCTTTCTTGGGCTGGGCACGG + Intronic
1039052420 8:33506983-33507005 ATATTACTTTGGGCTGGGCATGG - Intronic
1039161435 8:34626205-34626227 ATCCATCCTGGGGCTGGGCACGG + Intergenic
1039437327 8:37568920-37568942 ATCTGAGCTGGGGCTGGGCATGG + Intergenic
1039529263 8:38245139-38245161 AGTCTCTCTTGGGCTGGGCATGG + Intronic
1040032689 8:42840673-42840695 ATCTCAGCTGGGGCTGGGCATGG + Intronic
1040867764 8:52067601-52067623 TTCTTTTCTTCGGCTGGGTTTGG + Intergenic
1041187986 8:55321698-55321720 AACATATCTTGGGCCGGGCATGG + Intronic
1042131474 8:65590724-65590746 ATCTTTTCATAGGCTGGGCGCGG - Intergenic
1042167281 8:65958165-65958187 ATGTTTTCTTAGGCTGGGTGCGG - Intergenic
1042247482 8:66722560-66722582 ATCTTTGCAGAGGCTGGGCACGG - Intronic
1042522019 8:69723539-69723561 ATGTTAACTTGGGATGGGCATGG - Intronic
1042537522 8:69873575-69873597 AGCTTTTTTTGGGCCAGGCACGG - Intergenic
1042550287 8:69988419-69988441 ATCATTTTTATGGCTGGGCACGG - Intergenic
1042616016 8:70650136-70650158 AGGTTTACTTAGGCTGGGCATGG - Intronic
1043130728 8:76457624-76457646 ACCATTTTATGGGCTGGGCACGG - Intergenic
1043389538 8:79779125-79779147 ATATGTTCATAGGCTGGGCACGG + Intergenic
1044563580 8:93638467-93638489 ACCCTTTCTAGGACTGGGCATGG + Intergenic
1044585677 8:93867297-93867319 ATCATTGTTTTGGCTGGGCACGG - Intronic
1044650929 8:94494299-94494321 ATTTTTTTTTTGGCTGGGCATGG + Intronic
1044970656 8:97616391-97616413 ATTGTGTCTTGGGCTGGGCACGG + Intergenic
1044984373 8:97744883-97744905 AACGTTTTTTGGGCTGGGCAGGG + Intergenic
1044985459 8:97752876-97752898 GTCTGTGCTTGGGCCGGGCACGG + Intergenic
1045098086 8:98819111-98819133 AACGTTCATTGGGCTGGGCACGG - Intronic
1045188030 8:99857968-99857990 CTCTCTTCGTGGGCTGGGCATGG + Intronic
1045300185 8:100904037-100904059 ACATTTTCATTGGCTGGGCATGG - Intergenic
1046175591 8:110571188-110571210 ATAGTTTCATGGGCTGGGCCAGG - Intergenic
1046307381 8:112386785-112386807 ATCTTTAGTTGGGCCGGGCGCGG - Intronic
1047141703 8:122148066-122148088 ATCTTTTTTTGGGGAGGGGAAGG + Intergenic
1048012763 8:130471573-130471595 ATCTTGTCTTAGGCTAAGCATGG - Intergenic
1048022019 8:130548076-130548098 TTTTTTTTTTGTGCTGGGCATGG + Intergenic
1048274349 8:133054975-133054997 ATTTTCTGTAGGGCTGGGCAGGG - Intronic
1048600109 8:135910778-135910800 ATCTATTCTAAGGCTGGGCAAGG + Intergenic
1048661380 8:136606403-136606425 GTCTTTGCTTTGGCTTGGCAGGG + Intergenic
1048901972 8:139047328-139047350 AGCATTACATGGGCTGGGCATGG - Intergenic
1048929709 8:139303134-139303156 ATGCGTTTTTGGGCTGGGCATGG - Intergenic
1049052894 8:140212788-140212810 AAGTTTTTTTTGGCTGGGCATGG + Intronic
1049441309 8:142611003-142611025 CTGTGTGCTTGGGCTGGGCAGGG - Intergenic
1049565806 8:143338275-143338297 ATTTTTTTTTTGGCTGGGCTTGG + Intronic
1049993761 9:1015404-1015426 ATATTTTCTGGGGCTGGGCATGG + Intergenic
1050247890 9:3710422-3710444 ATCTTATAATAGGCTGGGCATGG - Intergenic
1050375534 9:4968644-4968666 ATGATCTCTTGGGCTGGGCGCGG - Intergenic
1050849000 9:10260283-10260305 GTGTTTTCTTGGGCCGGGTAAGG - Intronic
1052402902 9:28023740-28023762 ATCTCTTCTTGGCTTTGGCAGGG - Intronic
1052457097 9:28713865-28713887 ATCTCCACTGGGGCTGGGCATGG + Intergenic
1052470650 9:28890603-28890625 ATCTCTACTAGGGCTGGGGAAGG + Intergenic
1052921868 9:33977325-33977347 ATTTTTTGTTTGGCTGGGCGCGG - Intronic
1053121608 9:35551411-35551433 AGCTGTCCTTGGGGTGGGCATGG + Intronic
1053144416 9:35702801-35702823 ATTCTTTCTTCTGCTGGGCATGG - Intronic
1053388019 9:37710674-37710696 AAATTTTTTTGGGTTGGGCACGG + Intronic
1053395357 9:37769015-37769037 ATCTATTTTGAGGCTGGGCACGG + Intronic
1053556250 9:39140033-39140055 AACACTGCTTGGGCTGGGCATGG - Intronic
1055046722 9:71934051-71934073 ACCATTACCTGGGCTGGGCATGG + Intronic
1055076135 9:72216963-72216985 AGCTATTCCTGGGCCGGGCACGG - Intronic
1055107985 9:72532248-72532270 ATGCTTTACTGGGCTGGGCATGG + Intronic
1055119823 9:72646852-72646874 GTGTTCTGTTGGGCTGGGCATGG + Intronic
1055532579 9:77200194-77200216 ATATTGTTTTAGGCTGGGCATGG + Intronic
1055687518 9:78792928-78792950 TTACTTTCTTGGGATGGGCAGGG + Intergenic
1055943364 9:81671221-81671243 ATGTATTCTTAGGCTGGGTATGG + Intronic
1056713606 9:89010721-89010743 ATCTCTGCCTGGGCAGGGCAGGG - Intergenic
1056903984 9:90628835-90628857 ATATATTTTTAGGCTGGGCAAGG - Intronic
1056919206 9:90771304-90771326 ATCTTTTCTTGATCTGGACAAGG + Intergenic
1057001169 9:91511296-91511318 GTCTTTTGTTAGGCTGGGCATGG + Intergenic
1057213780 9:93217245-93217267 AAGATTTTTTGGGCTGGGCACGG - Intronic
1058288603 9:103210191-103210213 ATGGTTTCATGGGCTGGGCCTGG - Intergenic
1058395060 9:104542412-104542434 ATTTATTTTTTGGCTGGGCATGG - Intergenic
1058531063 9:105905086-105905108 ATAAGTTCTTGGGCCGGGCATGG + Intergenic
1058619979 9:106872651-106872673 GTCTTTTCTGAGGCCGGGCATGG - Intronic
1058993217 9:110274815-110274837 ATTTGTTCTTAGGCTGGACATGG + Intergenic
1059203007 9:112435982-112436004 ATTATTTCTAGGGCTGGACACGG + Intronic
1059298271 9:113291920-113291942 ATCTTTTGTTTGGCCGGGCGTGG + Exonic
1059484974 9:114619916-114619938 ATTTATTTTTAGGCTGGGCATGG + Intronic
1059707972 9:116841528-116841550 ATCTTTACTACTGCTGGGCATGG - Intronic
1059862324 9:118478600-118478622 ATCTCTTTCTGGGCTGGGCACGG - Intergenic
1060421996 9:123475891-123475913 ATGTTTGGGTGGGCTGGGCATGG + Intronic
1060647821 9:125296948-125296970 AAAATTTCTTGGGTTGGGCACGG - Intronic
1060686505 9:125618839-125618861 AATTTGTCTTAGGCTGGGCATGG + Intronic
1061024567 9:128039788-128039810 TTTTTTTTTTAGGCTGGGCACGG - Intergenic
1061114344 9:128599423-128599445 ATCAATTTCTGGGCTGGGCATGG - Intronic
1061131061 9:128708088-128708110 AGGTTTTCTTGGGCCAGGCATGG + Intronic
1061131462 9:128710781-128710803 AACATTCCTTGGGCCGGGCATGG - Intronic
1061499559 9:130994077-130994099 ATTTTCTCTTGGGATGTGCAGGG - Intergenic
1061553181 9:131349751-131349773 ATCTTTTCCTGGGGAGGGAAAGG - Intergenic
1061888993 9:133607894-133607916 AGCACTTCCTGGGCTGGGCAAGG - Intergenic
1203751093 Un_GL000218v1:81176-81198 ATTTTTTTATAGGCTGGGCATGG - Intergenic
1203410958 Un_KI270579v1:2581-2603 TTCATTTCTGGGGCCGGGCATGG + Intergenic
1185482442 X:457908-457930 ACTTTGTTTTGGGCTGGGCACGG + Intergenic
1186398730 X:9236868-9236890 ATCATTTATGTGGCTGGGCATGG - Intergenic
1187127901 X:16470967-16470989 ACCTGCCCTTGGGCTGGGCATGG - Intergenic
1187321691 X:18244945-18244967 ATCTATTCTTGGGAGGTGCAAGG + Intronic
1187703857 X:21990142-21990164 AGCTTTTCTTAGGCCAGGCACGG + Intronic
1187862193 X:23693365-23693387 ATATATTTTTGGGCTGGGCACGG - Intergenic
1188041245 X:25371963-25371985 ATGTTTATTTCGGCTGGGCACGG + Intergenic
1188412761 X:29894781-29894803 ATATTTTCATGGGGTGGGGAAGG + Intronic
1188506640 X:30890548-30890570 ATTTTCTCTTTGGCTGGGCGCGG - Intronic
1188721211 X:33525967-33525989 ATCTACTCTCGGGCCGGGCACGG - Intergenic
1189166693 X:38867799-38867821 TTGTTTTGTTGGGCTGGGCATGG - Intergenic
1189430320 X:40940562-40940584 ACCCTTTTTTGGGCCGGGCACGG + Intergenic
1189441426 X:41039619-41039641 ATTTTCTCTTAGGCCGGGCATGG - Intergenic
1189537337 X:41949243-41949265 TACTTTTGTTGGGCTGGGCGTGG + Intergenic
1189987942 X:46570624-46570646 ATTTTTTTTTAGGCTGGGCGCGG - Intergenic
1190185455 X:48229649-48229671 ATTTGTTCTTGGGCTGGGTGCGG - Intronic
1190306302 X:49084397-49084419 AAGTTATCATGGGCTGGGCATGG + Intronic
1190366849 X:49703102-49703124 ACCTTTTTTTAGGCTGGCCATGG + Intergenic
1190733296 X:53238666-53238688 ATTATTTCATGGGCTAGGCATGG - Intronic
1190791597 X:53705797-53705819 ATCTTTTCTTGGTCTGGGATTGG - Intergenic
1192367093 X:70482955-70482977 ATATTTTCCTGGGCAGGGCGCGG - Intronic
1192556497 X:72094070-72094092 AGCTATACTAGGGCTGGGCACGG - Intergenic
1192571757 X:72211982-72212004 ATCATCTCTGTGGCTGGGCATGG + Intronic
1192739573 X:73879937-73879959 ATTTTTTCTTGGGCTGGGCATGG - Intergenic
1192931591 X:75812094-75812116 TTCTTTTCTTCTGCTGGGCTTGG - Intergenic
1193110481 X:77724520-77724542 AGATATTTTTGGGCTGGGCACGG - Intronic
1193115256 X:77769574-77769596 AACAGTTTTTGGGCTGGGCACGG - Intronic
1193197173 X:78646268-78646290 TTCTTTTCTTTGGCTGGGTTTGG - Intergenic
1193471469 X:81908978-81909000 ATATATTTTTTGGCTGGGCATGG - Intergenic
1193736513 X:85163287-85163309 ATCTTTTCTTCTGCTGGGTTTGG + Intergenic
1193866566 X:86739162-86739184 ATATTTTAATAGGCTGGGCATGG - Intronic
1193869163 X:86775827-86775849 ATCTTATCTTGGGCCAGGTATGG + Intronic
1194273615 X:91852303-91852325 ACCTAATTTTGGGCTGGGCATGG - Intronic
1195032987 X:100944651-100944673 AAGTTTTATTTGGCTGGGCATGG - Intergenic
1195033585 X:100949656-100949678 ATCTTATTTCTGGCTGGGCATGG - Intergenic
1195368819 X:104152726-104152748 ATCTGTTCTCAGGCTGGGCGCGG - Intronic
1196080284 X:111623202-111623224 ACATTATTTTGGGCTGGGCATGG - Intergenic
1196118673 X:112024694-112024716 ATCTTTTCTTGTGCTGTTCATGG - Intronic
1196437211 X:115685591-115685613 ATGTCTTCTTGTGCTGGGCACGG + Intergenic
1196835441 X:119809428-119809450 ATCTTTTTGAGGGCTGGGCATGG + Intergenic
1197026777 X:121760323-121760345 ATCTTATCTTGAACAGGGCAAGG + Intergenic
1197532709 X:127649918-127649940 AACTTTAATTCGGCTGGGCACGG - Intergenic
1197580993 X:128283477-128283499 ATATTTTTTTAGGCTGGGCGCGG - Intergenic
1198119512 X:133578396-133578418 AACCTTTCTCTGGCTGGGCATGG + Intronic
1198320513 X:135514906-135514928 AGCTCTTCATGGGCTGGGCATGG + Intergenic
1200590857 Y:5073726-5073748 ACCTAATTTTGGGCTGGGCATGG - Intronic
1200830230 Y:7681535-7681557 GTCTTTTCTGGGGGTAGGCAGGG - Intergenic
1201336031 Y:12880724-12880746 ATCTTTTCTTGGCCTGGCCCCGG + Intergenic
1202111710 Y:21427756-21427778 GTCTTTTCTGGGGGTGGGCAGGG - Intergenic
1202116749 Y:21476381-21476403 GTCTTTTCTGAGGGTGGGCAGGG + Intergenic
1202237355 Y:22726832-22726854 AACTTATTTTGGGCTGGGCGCGG - Intergenic