ID: 1015174318

View in Genome Browser
Species Human (GRCh38)
Location 6:130289793-130289815
Sequence TAAAAATCTTTTCTTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1465
Summary {0: 1, 1: 2, 2: 11, 3: 155, 4: 1296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174318_1015174325 11 Left 1015174318 6:130289793-130289815 CCCAGCCCAAGAAAAGATTTTTA 0: 1
1: 2
2: 11
3: 155
4: 1296
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166
1015174318_1015174324 5 Left 1015174318 6:130289793-130289815 CCCAGCCCAAGAAAAGATTTTTA 0: 1
1: 2
2: 11
3: 155
4: 1296
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174318_1015174322 1 Left 1015174318 6:130289793-130289815 CCCAGCCCAAGAAAAGATTTTTA 0: 1
1: 2
2: 11
3: 155
4: 1296
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174318 Original CRISPR TAAAAATCTTTTCTTGGGCT GGG (reversed) Intronic
900492173 1:2955866-2955888 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
900730800 1:4258306-4258328 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
901124717 1:6920877-6920899 AAAAAATGGTTTCGTGGGCTGGG - Intronic
901145105 1:7059444-7059466 TAAAAATCTTTTGTAGAGATGGG - Intronic
901273210 1:7969872-7969894 TAAAAATGTTTTCTTGAGGTCGG - Intronic
901339658 1:8484716-8484738 TAAAATTGTTTTATTTGGCTGGG - Intronic
901517357 1:9757534-9757556 TTAAAACCTTTTGTTCGGCTGGG - Intronic
901593623 1:10367385-10367407 TAAAAAACTTTTATCTGGCTGGG - Intronic
901706793 1:11079687-11079709 TAAGAAGCTTTTCTGCGGCTGGG - Intronic
901832378 1:11900382-11900404 TAAAATACTTTTGTTAGGCTGGG + Intergenic
902971151 1:20051920-20051942 TAAAAATCTATGGCTGGGCTTGG + Intronic
903106052 1:21081135-21081157 TAAAAATATGTACTTGGGCTGGG + Intronic
903209291 1:21807473-21807495 TAAAAAACTAATTTTGGGCTGGG - Intergenic
903439422 1:23376350-23376372 TAAAAATATTTTTTTGAGATAGG - Intergenic
903441453 1:23391094-23391116 GAAAAATCTTAGCTTGGGCTTGG - Intronic
903491542 1:23732420-23732442 CAAAAATCTACTCTTAGGCTGGG - Intergenic
903822793 1:26115900-26115922 TAAAAGTCTGCTTTTGGGCTGGG + Intronic
904270550 1:29347203-29347225 GAAAAATATTTTCTTGAGTTTGG - Intergenic
904526455 1:31137273-31137295 TAAAAAAGTTTTTTTTGGCTGGG + Intergenic
904540108 1:31227118-31227140 TAAAAAGATTTCCTTTGGCTGGG - Intronic
904661049 1:32085455-32085477 TAAAAATCTCTTATTTGGCTGGG + Intronic
904888762 1:33762062-33762084 TACATACCTTTTCTAGGGCTTGG - Intronic
905164947 1:36075001-36075023 TAAAATATCTTTCTTGGGCTGGG + Intergenic
905562176 1:38936196-38936218 TAAAAATATTTGTTTAGGCTGGG - Intronic
905640918 1:39589202-39589224 AAAAAATTTTTTCTGGGGCCTGG + Intergenic
905725847 1:40251393-40251415 TAATAATCTTTTCCTGTCCTTGG + Exonic
905926880 1:41757410-41757432 AAAAAATATTTTTTTGGGCCGGG - Intronic
906081698 1:43094287-43094309 GAAAATTCTTTTCTTGGGCCGGG - Intergenic
906414475 1:45609903-45609925 TAGAAATTTTGTCGTGGGCTGGG + Intronic
906435750 1:45795145-45795167 TAAAAATTTTTTTTTTGGCTGGG + Intronic
906638007 1:47422922-47422944 TAAGAATATATTCTTGGGCCAGG + Intergenic
906976315 1:50576960-50576982 TTAAAATCTGTTTTTAGGCTGGG - Intronic
907315385 1:53567625-53567647 AAAAAATGGTTTCGTGGGCTGGG + Intronic
907346876 1:53789518-53789540 TAAAAAACTTGGCTGGGGCTGGG + Intronic
907466422 1:54640812-54640834 CAAAAATCCTTCCTTTGGCTGGG - Intergenic
907584934 1:55608559-55608581 CAAAAAATTTTTCATGGGCTGGG - Intergenic
907853279 1:58277333-58277355 TAAAAGTCTTTGCATCGGCTGGG - Intronic
908032866 1:60020152-60020174 GAAAAATAGTTTCGTGGGCTGGG + Intronic
908076652 1:60526779-60526801 TAAAAATACTTACTTAGGCTGGG - Intergenic
908199211 1:61777267-61777289 TTAAAAGCTTTTCTAAGGCTGGG + Intronic
908276547 1:62478706-62478728 TAAAAATTTTTTACTGGGCTGGG - Intronic
908582323 1:65529106-65529128 TATAAAACTTTTTTTGGGCCAGG - Intronic
908601533 1:65744914-65744936 AAAAAATGATTTCATGGGCTGGG + Intergenic
908607937 1:65820968-65820990 GAAAAATAATTTCCTGGGCTGGG - Intronic
908715706 1:67067575-67067597 GAAAAATGGTTTCATGGGCTGGG + Intergenic
908885165 1:68780672-68780694 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
908904618 1:68993801-68993823 TAAAAATCTGTGTTTGGGTTTGG + Intergenic
908963552 1:69730128-69730150 GAAAAATGGTTTCTTGGGCCAGG - Intronic
909436338 1:75647096-75647118 GAAAAATGGTTTCTTGGGCCAGG + Intergenic
909710882 1:78647691-78647713 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
909867068 1:80686539-80686561 GAAAAATGGTTTCATGGGCTGGG - Intergenic
909944294 1:81646313-81646335 GAAAAATTATTTCTTGGACTAGG + Intronic
910000800 1:82340155-82340177 TAAAAAGCATTTCCTGGGGTGGG + Intergenic
910260082 1:85285570-85285592 TAATATTCTTTTCTGAGGCTGGG - Intergenic
910562308 1:88603889-88603911 TAAAAATCCTATGTCGGGCTGGG + Intergenic
910642751 1:89481115-89481137 TAAAAGTGGTTTCTTGGGCCAGG - Intergenic
910715504 1:90225411-90225433 AAAAAATGGTTTCTTGGGCCAGG + Intergenic
910946362 1:92596064-92596086 TAACAATATTTTGCTGGGCTTGG + Intronic
911178010 1:94836561-94836583 TACAATTCTTTTGTTGGGGTTGG + Intronic
911193822 1:94973864-94973886 TAAAAAAGTTCTCTTGGGCTGGG + Intergenic
911428439 1:97752052-97752074 AAAAAATCTTTTTTTAGGCCAGG - Intronic
911511251 1:98809586-98809608 AAAAAATGGTTTCCTGGGCTAGG - Intergenic
911641547 1:100295321-100295343 TAAAAATCTTCGTTTGGGCATGG + Intergenic
911695906 1:100890318-100890340 GAAAAATGGTTTCATGGGCTGGG - Intronic
912055841 1:105597138-105597160 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
912068621 1:105779444-105779466 GAAAAATGATTTCCTGGGCTGGG + Intergenic
912073130 1:105839245-105839267 TAAAAATGGTTTCATGGGCCTGG + Intergenic
912218366 1:107642863-107642885 TTAAAATGTTTACTTGGACTTGG - Intronic
912396579 1:109349468-109349490 AAAAAAACATTTCTGGGGCTAGG + Intronic
912438361 1:109678449-109678471 TAAAAATCTGTATATGGGCTGGG + Intronic
912660546 1:111525566-111525588 TAAAACTAATTTCTTTGGCTAGG + Intronic
912735895 1:112149367-112149389 GAAAAATGGTTTCATGGGCTGGG + Intergenic
912789268 1:112635715-112635737 TAAAATTATTTCCTTGGGCCGGG - Intronic
912897348 1:113606260-113606282 TAAAAATTATTTCTTGGGCTGGG - Intronic
912916695 1:113822664-113822686 TAAAAAGGGTTTCTTGGGCCGGG + Intronic
912937900 1:114020092-114020114 AAAAAATGGTTTCATGGGCTGGG + Intergenic
913242025 1:116837758-116837780 AAAAAATGATTTCATGGGCTTGG + Intergenic
914213415 1:145602772-145602794 TAGAAATATTTTATGGGGCTGGG - Intergenic
914513595 1:148354735-148354757 GAAAAATCTTTTCTTCTGCTTGG + Intergenic
914732458 1:150383610-150383632 TTAAAATCTCTTCTTTGGCTGGG - Intronic
914811150 1:151029273-151029295 TAAAATTCCCTTCTTGAGCTAGG + Intronic
915028376 1:152854668-152854690 TAAAAATATATTCTTGGGTCTGG + Intergenic
915175738 1:154013191-154013213 AAAAAATGTTATTTTGGGCTAGG - Intronic
915365990 1:155316321-155316343 TAAAAACCATGTCTTGAGCTGGG + Intronic
915434843 1:155896502-155896524 TAAAAATCCACTCTTGGGCCAGG + Intergenic
915499528 1:156305638-156305660 TTAAAATTTTTGTTTGGGCTGGG + Intergenic
915579602 1:156805522-156805544 TAAAAAATTTTTTTTTGGCTGGG - Intergenic
915818997 1:159001308-159001330 TAAACATCCTTTCTTGTTCTTGG - Intronic
915828283 1:159102065-159102087 GAAAAATCACTTCCTGGGCTGGG + Intronic
915959563 1:160254027-160254049 TAAAAATTATTTCCTGGGATGGG + Intronic
916001650 1:160622190-160622212 TAAAAACCTGTTCTTGCACTGGG - Intronic
916040387 1:160956367-160956389 AAAAACTCTTTTTTTGGGCTGGG + Intergenic
916045405 1:160996470-160996492 TAAAAATCTCATCCTTGGCTAGG + Exonic
916477355 1:165183138-165183160 AAAAAATGGTTTCATGGGCTAGG + Intergenic
916569900 1:166016123-166016145 TAAAAAGCCTATCTTAGGCTGGG + Intergenic
916702007 1:167306396-167306418 TTAAAATTTTTTCTTGTACTAGG + Intronic
917035485 1:170743269-170743291 AAAAAATGGTTTCATGGGCTGGG - Intergenic
917228919 1:172814627-172814649 GAAAAATGGTTTCATGGGCTGGG - Intergenic
917246113 1:173003217-173003239 TAAAGTCCTTTTCTTGGGCTGGG + Intergenic
917426961 1:174924588-174924610 ACAAAATCTTTTCTGGGCCTGGG - Intronic
917892406 1:179452892-179452914 TAAAAATGGTTTCGTGGGCTGGG + Intronic
917894519 1:179474897-179474919 TAAAAATGGTTTCTTGGGTCAGG + Intronic
917949204 1:180012206-180012228 AAAAAATGTTCTATTGGGCTTGG + Intronic
918166012 1:181948553-181948575 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
918633484 1:186747572-186747594 AAAAAATGGTTTCATGGGCTGGG + Intergenic
918650758 1:186959894-186959916 TAAAAATCTTTTTTTTGGCATGG - Intronic
918740955 1:188129590-188129612 CTAAAATCTTTTCTTCTGCTTGG - Intergenic
918996275 1:191764400-191764422 TTAAAATGTTTTTCTGGGCTGGG - Intergenic
919006801 1:191909161-191909183 GAAAAATGTTTTCATGGGCTGGG - Intergenic
919027951 1:192201763-192201785 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
919125572 1:193388845-193388867 GAAAAATGGTTTCATGGGCTGGG - Intergenic
919242696 1:194935699-194935721 AAAAAGTTGTTTCTTGGGCTGGG + Intergenic
919388755 1:196954872-196954894 GAAAAATATTTTCATGGGCCTGG - Intronic
919659336 1:200228702-200228724 TAAAAATGGATTCATGGGCTGGG + Intergenic
919829398 1:201529890-201529912 TAAAACTCTTTTCTCTGTCTGGG - Intergenic
920011330 1:202869841-202869863 TGAAAATGGTTACTTGGGCTGGG - Intergenic
920238306 1:204524481-204524503 TAAAAATCTATTTTCCGGCTGGG + Intronic
920337490 1:205254914-205254936 TTAAAATGTTAGCTTGGGCTGGG + Intronic
920913547 1:210239295-210239317 TAGAAATCTTTTCCTAGCCTGGG + Intronic
921083440 1:211763874-211763896 TAAAAATTCCTTCTTGGGCTGGG + Intronic
921123456 1:212156703-212156725 TAAAAATATTATTTTGGCCTAGG - Intergenic
921250580 1:213293794-213293816 TGGAAATCTTTTCTTGGAGTTGG + Intergenic
921370056 1:214413170-214413192 TAAAAAGCTTTCGTTGGGCTGGG - Intronic
921443160 1:215213311-215213333 TAAAAAAATTCTCCTGGGCTGGG + Intronic
921669239 1:217908064-217908086 TAAGAATCTTCTCTTGGTATAGG + Intergenic
921764530 1:218954922-218954944 TAAAAATATTTTATTTGGATTGG - Intergenic
922274403 1:224063606-224063628 TTAAAATGCTTTATTGGGCTGGG - Intergenic
922371068 1:224910816-224910838 GAAAAATTATTTCATGGGCTTGG - Intronic
922510978 1:226167088-226167110 TAAAAACCGATTGTTGGGCTGGG - Intronic
922576541 1:226664698-226664720 TGAAAATATTTTCTTCAGCTGGG - Intronic
922623946 1:227018207-227018229 AAAAATTCTGTTCTTTGGCTGGG - Intronic
923026631 1:230209544-230209566 TACAAATCTATTGTTGGGCCAGG + Intronic
923339218 1:232993728-232993750 GAAAAATGGTTTCATGGGCTGGG + Intronic
923479141 1:234366379-234366401 TAAAAATCTTAGGTAGGGCTGGG + Intergenic
923741091 1:236655776-236655798 AAAAAATCTTTTAATGGGTTGGG + Intergenic
923778483 1:237000531-237000553 TAAAAATATTTTGTTAGTCTGGG - Intergenic
924236956 1:242007059-242007081 TAAAAATCCTGCCTTGGGGTAGG - Intergenic
924433653 1:244019779-244019801 TAAAAATCTGCTTTTGGGCCGGG + Intergenic
924762693 1:247003915-247003937 TAAAAATTTTTTCTTAGGGCCGG + Intronic
924798859 1:247312464-247312486 TAATAGTCTGTTCATGGGCTGGG + Intronic
1062966761 10:1613300-1613322 AAAAAATCTTTTCATGGAATGGG - Intronic
1063127066 10:3144629-3144651 TAAAAATTTTTTGTTGAGATGGG - Intronic
1063335703 10:5211097-5211119 AAAAAATGGTTTCATGGGCTGGG - Intronic
1063390060 10:5644197-5644219 TAAAAATATATGCTTGGGCCAGG + Intronic
1063481526 10:6380681-6380703 AAAAAATGGTTTCGTGGGCTAGG - Intergenic
1063891640 10:10635757-10635779 TAAAAACCTTTTCATAGGCATGG - Intergenic
1063923158 10:10951442-10951464 TAAAAATCTTTTTTTTGTGTTGG - Intergenic
1063998604 10:11643787-11643809 TCAAAATCTCTTCTTGGTCTGGG + Intergenic
1064088843 10:12366357-12366379 TAAGAATCAGTTGTTGGGCTGGG + Intronic
1064116037 10:12578248-12578270 AAAAAATGTTTTGTAGGGCTGGG + Intronic
1064259962 10:13777484-13777506 TCAAAATCTTTCCTTGGGCTTGG - Intronic
1064412380 10:15118240-15118262 TAAAAAACCTTTCACGGGCTGGG + Intronic
1064559481 10:16582134-16582156 TAAAAATATTTTAGAGGGCTGGG + Intergenic
1064562784 10:16609141-16609163 TAAAAATCTGATTTTAGGCTGGG - Intronic
1064628498 10:17285575-17285597 TAAACTTCTTTTCTTAAGCTGGG - Intergenic
1064770907 10:18722030-18722052 TAAAAATATTTTTTTGGGCTGGG + Intergenic
1064790122 10:18949689-18949711 CAAAAATCTTTTCTTTGTTTGGG - Intergenic
1065159934 10:22909036-22909058 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1065244178 10:23740958-23740980 TAAAAATCTTATTTTATGCTTGG + Intronic
1065373280 10:25011963-25011985 AAAAAATGGTTTCATGGGCTGGG + Intronic
1065495733 10:26325613-26325635 TAAAAATGTCTTCTTTGGCTAGG - Intergenic
1066025467 10:31354452-31354474 TAAAACACTTTTCTTGGGGGAGG + Intronic
1066286404 10:33970673-33970695 TACAAATGTTTTCCTTGGCTGGG - Intergenic
1066636804 10:37511353-37511375 TAAAAATGGTTTCATGGGCTGGG + Intergenic
1067106837 10:43372187-43372209 TGAACATCGGTTCTTGGGCTAGG - Intronic
1067141659 10:43662971-43662993 TAAACCTCTTTTCTTCAGCTGGG - Intergenic
1067196257 10:44121819-44121841 AAAAAATGTTATTTTGGGCTGGG - Intergenic
1067428995 10:46229945-46229967 TGAAAATTTTTTCTTCTGCTTGG - Intergenic
1067573291 10:47387080-47387102 TAAAAATGGTTTCGTGGGCCAGG - Intergenic
1068011319 10:51455258-51455280 AAAAAATGGTTTCATGGGCTAGG - Intronic
1068091123 10:52433378-52433400 TAAAAATCTTCTCTTAGATTTGG + Intergenic
1068172236 10:53409537-53409559 TGAAAATATTTTCTTTGGTTTGG - Intergenic
1068215615 10:53978480-53978502 GAAAAATGGTTTCCTGGGCTGGG - Intronic
1068222091 10:54057571-54057593 AAAAAATGGTTTCCTGGGCTGGG - Intronic
1068298048 10:55101081-55101103 TTAAAATATTTTTATGGGCTTGG + Intronic
1068507778 10:57924638-57924660 TAAAAACCTTTTTTTTGGCCGGG - Intergenic
1068663178 10:59645508-59645530 TAAAAATTATTTCTTTTGCTTGG + Intergenic
1069211752 10:65770288-65770310 TAAAAATCTTTCCTTTACCTGGG - Intergenic
1069407881 10:68121869-68121891 TAAAAATACTTTTTTGGACTGGG - Exonic
1069519055 10:69103253-69103275 TAAAAATGATTTCTTGGGCCGGG + Intronic
1069588082 10:69622446-69622468 AAAAAACCTTTTCTTGGGCACGG + Intergenic
1069938271 10:71934713-71934735 TAAAGAACTTATCTGGGGCTGGG - Intergenic
1070020294 10:72578558-72578580 TAAAAATACTTTATTGGGCCAGG - Intronic
1070073879 10:73116302-73116324 TTAAATTCATTTCTTAGGCTGGG - Intronic
1070222897 10:74469533-74469555 TAAAAATTTTTTGTAGAGCTGGG + Intronic
1070261234 10:74857846-74857868 TAAAAATTTTTTCTAGAGATGGG - Intronic
1071098950 10:82012338-82012360 AAAAAATGGTTTCATGGGCTGGG - Intronic
1071245071 10:83753040-83753062 GAAAAATGCTTTCATGGGCTGGG - Intergenic
1071330749 10:84557170-84557192 TAAAAAATTTTTTTTTGGCTGGG + Intergenic
1071540204 10:86475883-86475905 TAAAAAGCATTGATTGGGCTAGG + Intronic
1071587583 10:86839955-86839977 AAAAAATCTTATCCTGGGCTGGG - Intronic
1071990170 10:91093593-91093615 AAAGAATGGTTTCTTGGGCTAGG - Intergenic
1072035829 10:91561901-91561923 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
1072104760 10:92263372-92263394 TAAAAATGCTTTATTGGGCTGGG - Intronic
1072243095 10:93515569-93515591 TAAAAATGTTCTCTAGGGATAGG + Intronic
1072368930 10:94744486-94744508 AAAAAATGGTTTCCTGGGCTGGG + Intronic
1072440108 10:95446854-95446876 TTAAAATCTAATCTTGGGCCGGG + Intronic
1072847682 10:98850439-98850461 TAAAAATATTATTTTGGGCCGGG + Intronic
1073306967 10:102510524-102510546 TAAAAAGATTTTTTTTGGCTGGG + Intronic
1073418025 10:103400924-103400946 TTTAAATCTTTTGTAGGGCTTGG + Intronic
1073520583 10:104125096-104125118 TAAAAATATTTTTTTAGGCTGGG - Intronic
1073627269 10:105112299-105112321 TAAAAATCTTTTTTGGGGTGGGG + Intronic
1073627959 10:105119068-105119090 AAAAATTGTTTTCATGGGCTGGG + Intronic
1073880266 10:107973138-107973160 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1074223593 10:111462061-111462083 AAAAAATGGTTTCATGGGCTAGG + Intergenic
1074242095 10:111649921-111649943 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1074249803 10:111733204-111733226 TAAAAATATTATTTAGGGCTGGG + Intergenic
1074802343 10:117013467-117013489 TAAAAATATTTTTCTGGGCCAGG - Intronic
1075102023 10:119513160-119513182 TAAAAAATTTTTCTGAGGCTGGG + Intronic
1075760936 10:124856055-124856077 TAAATATCTTTTTTTAGGCCGGG - Intergenic
1075783284 10:125031191-125031213 TAAAAAAGTTTTCTTGGGCCGGG + Intronic
1075835808 10:125451781-125451803 GGAAAATCTGTTCTTGGGGTAGG - Intergenic
1075881497 10:125855743-125855765 TAAAAAGTTTATCTTGGGCCAGG - Intronic
1076926851 10:133495078-133495100 TAAAAATGGCTTCCTGGGCTAGG - Intergenic
1077569644 11:3328833-3328855 AAAAAATCTTTGGTTGGGTTTGG - Intergenic
1077583960 11:3436183-3436205 TAAAAATGTAAGCTTGGGCTGGG - Intergenic
1077854666 11:6111472-6111494 TAAAGTTCTTATCTTGAGCTTGG - Intergenic
1078322943 11:10353128-10353150 AAAAAATCTTACCTTGGGATGGG + Intronic
1078334504 11:10452855-10452877 TAAATAACTTTTCTGTGGCTCGG - Intronic
1078853403 11:15185506-15185528 AAAAAATCTTTTCTTGGTTGAGG - Intronic
1078999747 11:16741383-16741405 TAAAAGTCGTTTCATTGGCTTGG + Intronic
1079014711 11:16858785-16858807 TAAAAATCTTTTTTTAGGTTGGG - Intronic
1079397582 11:20078751-20078773 TAGAAATGTTTTCCTAGGCTGGG - Intronic
1079499885 11:21091173-21091195 TGAAGATCTTTTCTGGAGCTGGG + Intronic
1079556226 11:21761201-21761223 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
1079990040 11:27236716-27236738 TAATAGTCTTTTTTTGGGCCGGG - Intergenic
1080424246 11:32141589-32141611 TAAAAATATTTCCTTTGGCTGGG - Intergenic
1080982420 11:37424182-37424204 AAAAAATGATTTCATGGGCTGGG - Intergenic
1081238873 11:40679497-40679519 AAAAAATTGTTTCATGGGCTGGG + Intronic
1081246368 11:40771387-40771409 GAAAAATGGTTTCCTGGGCTGGG - Intronic
1081675349 11:44965359-44965381 TACAAATGTTTCCTTGGACTGGG - Intergenic
1081830774 11:46111171-46111193 TAAAAAATATTTCTTGGGCCAGG + Intronic
1081948588 11:47021848-47021870 TAAAAGTCTTTTCTGGGACAAGG + Intronic
1082035279 11:47640710-47640732 TAAAAATAGTTACTTGGGCCGGG - Intronic
1082682661 11:56195910-56195932 TGAACATCTTTTCATGTGCTTGG - Intergenic
1082732651 11:56818872-56818894 TAAAAATCTGTGCTTTGGCTGGG - Intergenic
1083223192 11:61266960-61266982 TAAAAATATTTCTCTGGGCTGGG + Intronic
1083341922 11:61963743-61963765 TAAGAATCTTGTCTTGGGCTGGG + Exonic
1083367994 11:62153214-62153236 TAAAATGCTTTTCTTGGCATGGG - Intergenic
1083689281 11:64397009-64397031 TAAAAAACTTAGCTGGGGCTGGG - Intergenic
1083866093 11:65454154-65454176 TAAAAAGCCTCTCTGGGGCTGGG + Intergenic
1083912008 11:65715463-65715485 TAAAAAGCAATTCCTGGGCTGGG + Intronic
1084048165 11:66582551-66582573 TAAGAAAATTTTTTTGGGCTGGG - Intergenic
1084240867 11:67818856-67818878 TAAAAATGTAAGCTTGGGCTGGG - Intergenic
1085236461 11:75019360-75019382 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1085690757 11:78661966-78661988 TTAAAATCTTTTCTTTTGGTGGG - Intronic
1085792397 11:79507259-79507281 TAAGAAACCTTTCTTGGGCCGGG - Intergenic
1086013243 11:82131659-82131681 TTAAAATATTTTATTGGACTAGG + Intergenic
1086083179 11:82926382-82926404 CAAAAATATTTACTTGGGCCAGG - Intronic
1086237815 11:84653223-84653245 TAAAAATCTAATATTGGGCAAGG - Intronic
1086356933 11:86010615-86010637 TCAAAATGTTTTCGTTGGCTGGG - Intronic
1086385876 11:86306702-86306724 TAAAAATATTTTTTTTGGCCGGG + Intronic
1086614352 11:88797433-88797455 TAAAAACCCAATCTTGGGCTGGG - Intronic
1087098526 11:94342950-94342972 TAAAAATGTTATCCTAGGCTGGG - Intergenic
1087278577 11:96184887-96184909 TAAAAAACATTTTTTGGGCTGGG - Intronic
1087437912 11:98145659-98145681 GAAAAATGGTTTCTTGGGCTGGG - Intergenic
1087563529 11:99822179-99822201 TAAAAATCTTTGCTCTGTCTGGG - Intronic
1087734914 11:101820980-101821002 TAAAAATGTTAACATGGGCTGGG - Intronic
1087831969 11:102829230-102829252 TAATTATCTTTTCTTTGGTTGGG - Intergenic
1087877439 11:103375011-103375033 GAAAAATGGTTTCTTGGGCCAGG + Intronic
1088040546 11:105375895-105375917 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1088148499 11:106714806-106714828 GAAAATTCTTTTCCAGGGCTGGG - Intronic
1088153817 11:106780333-106780355 AAAAAATGTTTTCATAGGCTGGG + Intronic
1088276590 11:108093222-108093244 TAAGCATCTTTTCTTTGCCTTGG + Intronic
1088323196 11:108574202-108574224 TAAAAATCTTTTTGTAGGTTGGG - Intronic
1088517075 11:110648776-110648798 TTAAAAACATTTCATGGGCTGGG - Intronic
1088768026 11:113004196-113004218 TAAAAATGTTTTCTTGTGGCCGG + Intronic
1089822901 11:121245085-121245107 AAAAAAGCTTTTCTTTGGCATGG - Intergenic
1089879570 11:121760721-121760743 GAAAAATCATGTCTTGGGGTGGG + Intergenic
1090649739 11:128795843-128795865 TGAAAATGCTTTCTAGGGCTGGG - Intronic
1092093641 12:5824061-5824083 AAAAAATGGTTTCATGGGCTGGG - Intronic
1092234974 12:6801199-6801221 TAAAAAAATTTTTTTTGGCTAGG - Intronic
1092350875 12:7754749-7754771 TAATAGTCTCTTCTTGGGCCAGG - Intergenic
1093230588 12:16537811-16537833 AAAAAATGGTTTCCTGGGCTGGG - Intronic
1093581307 12:20786790-20786812 AAAAAATTGTTTCATGGGCTGGG + Intergenic
1094352436 12:29541950-29541972 TAAAAATCTATTGTGGGGCCAGG - Intronic
1094353256 12:29549973-29549995 TGAAAATTGTTTCTTGGGGTGGG + Intronic
1095216662 12:39557625-39557647 TAAAAATGGTTTCCTGGGCCAGG + Intronic
1095232814 12:39761960-39761982 TAAAAAACATTTGTTGGGTTAGG + Intronic
1095847166 12:46758781-46758803 TAAAAATGGTTTCATGGGCCAGG + Intergenic
1096149638 12:49300695-49300717 TAAAAATTATTTTTTGGGCTGGG - Intergenic
1096246255 12:49989092-49989114 AGAAAATCATTTCTGGGGCTGGG - Intronic
1096279297 12:50238209-50238231 TTAAAAACTTTTCTGAGGCTTGG + Intronic
1096398600 12:51286827-51286849 AAAAAATCTTTTTTTGAGATGGG + Intronic
1096399002 12:51289718-51289740 TAAAAATTTTTTTTTGAGATAGG + Intronic
1096969127 12:55651480-55651502 AAAAAATGGTTTCTTGGGTTGGG + Intergenic
1096972183 12:55675944-55675966 TAATAAAAATTTCTTGGGCTTGG + Intergenic
1097028149 12:56073549-56073571 TTAAAATCTCATCTTAGGCTGGG - Intergenic
1097136836 12:56864240-56864262 GAAAAATTGTTTCTTGGGCCAGG + Intergenic
1097212517 12:57383148-57383170 TAAAAAAATTTTTTTTGGCTGGG - Intronic
1097252708 12:57646414-57646436 TAAAAGTTTTTTTTTAGGCTGGG - Intergenic
1097329641 12:58318872-58318894 AAAAAGTGGTTTCTTGGGCTGGG - Intergenic
1097368080 12:58742184-58742206 GAAAAATGGTTTCATGGGCTGGG + Intronic
1097443942 12:59646257-59646279 GAAAAATCATTTCCTGGGCTGGG + Intronic
1097575621 12:61389230-61389252 AAAAAATGACTTCTTGGGCTGGG - Intergenic
1097825995 12:64175219-64175241 TATAAATCTTTTCTTATTCTTGG - Intergenic
1097839376 12:64306662-64306684 TAAGAATCTTTCCTGCGGCTGGG - Intronic
1097839558 12:64308367-64308389 TAAAAATGTTTTCTTAGTTTTGG + Intronic
1097886664 12:64735717-64735739 TAAAAGTGTTTTCTTGAGGTTGG - Intronic
1098020338 12:66149143-66149165 TAGAAATTTTTTTCTGGGCTGGG + Intronic
1098203734 12:68084063-68084085 AAAAAATTGTTTCATGGGCTAGG - Intergenic
1098245419 12:68512352-68512374 TAGAAATCTTTTCCTGGACTGGG + Intergenic
1098300808 12:69052327-69052349 TAAAAAACTTTTTTTTGGCCGGG - Intergenic
1098543056 12:71681344-71681366 TTAAAATATTGTTTTGGGCTGGG + Intronic
1098616072 12:72524403-72524425 AAAAAATCTTGTCTAGGGCATGG - Intronic
1098645753 12:72899022-72899044 TAAGACTCTTTTATTGGGGTAGG - Intergenic
1098672446 12:73248247-73248269 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1098743199 12:74200803-74200825 TAAAAATGGTTTCCTGGGCCAGG - Intergenic
1098774858 12:74600125-74600147 GAAAAATGTTTTCATGGGCTGGG + Intergenic
1098911733 12:76215805-76215827 TAAAAATATTATCTGGGGCCGGG - Intergenic
1098926924 12:76360892-76360914 AAAAAATGGTTTCATGGGCTGGG - Intronic
1098934819 12:76466661-76466683 TAAAAATCTTTTTCCAGGCTGGG + Intronic
1098937548 12:76498107-76498129 TAAAAATCAGTATTTGGGCTGGG + Intronic
1099105105 12:78486914-78486936 AAAAAATGTTTTCATGGGCTTGG - Intergenic
1099234286 12:80064186-80064208 TAAAAATTTTTTCCTGGGGTGGG + Intergenic
1099384444 12:81997650-81997672 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1099647865 12:85382372-85382394 TAAAAACCATTTGTTGGGCAAGG + Intergenic
1099932618 12:89091473-89091495 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1100072258 12:90735183-90735205 GAAAAATAGTTTCGTGGGCTGGG - Intergenic
1100406855 12:94279567-94279589 GGAAAATCTTTTCTTTGGCTTGG - Exonic
1100473940 12:94918546-94918568 TAAAAATCTTCTTTTAGGCCGGG + Intronic
1100712504 12:97273527-97273549 CAAAAGGCTTTTCTTGGGGTAGG + Intergenic
1100787636 12:98095825-98095847 AAAAAATGGTTTCTTGGGCTGGG + Intergenic
1100952942 12:99872841-99872863 TAAAAATGTTTACTTAGGATTGG - Intronic
1101069155 12:101054780-101054802 TAAAAATGTTCTCTTAGGCCGGG - Intronic
1101192702 12:102351652-102351674 TTAATCTCTTTTCTTGAGCTGGG + Intergenic
1101258003 12:102998402-102998424 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1101409106 12:104454682-104454704 TAACAAAATTTTCTTAGGCTAGG + Intergenic
1102208390 12:111106309-111106331 TAAAAATATTAGCTGGGGCTGGG - Intronic
1102698181 12:114816204-114816226 AAAAAAATTTTTCATGGGCTGGG - Intergenic
1103019714 12:117524366-117524388 TAAAAATATTTTCTGGGGTTAGG + Intronic
1103167973 12:118786847-118786869 TAAAAGTTTTTTCTAGTGCTGGG + Intergenic
1103349213 12:120271674-120271696 TTAAAATCTTTTTTTGGGACAGG + Intergenic
1103396029 12:120607895-120607917 TAAAATTCTGTTCCTCGGCTGGG - Intergenic
1103582591 12:121926497-121926519 TAAAAATCTTTTTTAGAGATGGG + Intronic
1103776020 12:123366868-123366890 TAAAAGTTTTTTGTTGGGCCGGG - Intergenic
1103810872 12:123612686-123612708 AAAAAATCTATCCTTTGGCTGGG + Intronic
1103883439 12:124183963-124183985 TAGAAAGTGTTTCTTGGGCTGGG + Intronic
1104240571 12:126985026-126985048 TAAAAATGGTTTCATGGGCCGGG - Intergenic
1104543043 12:129685269-129685291 AAAAAATGGTTTCTTGGGCTGGG + Intronic
1104770562 12:131360628-131360650 TAATCATCTTTTCATGTGCTTGG - Intergenic
1104777299 12:131397966-131397988 GTAAAATGTTTTTTTGGGCTGGG - Intergenic
1105230167 13:18486950-18486972 TAAAAATATTCCCTTTGGCTGGG - Intergenic
1105343031 13:19545880-19545902 TAAAAATCTGTCCATGGGCAGGG + Intergenic
1105427790 13:20309973-20309995 TAGAAATTATTTTTTGGGCTGGG - Intergenic
1105556764 13:21454418-21454440 TCAAATTATTTTCTTGGGCTGGG - Intronic
1105644597 13:22303471-22303493 GAAAAATGGTTTCTTGGGCTGGG - Intergenic
1105656650 13:22448365-22448387 TTAAAATTTTTTTGTGGGCTGGG + Intergenic
1105716019 13:23065694-23065716 TAAAATTATTTTCTTGGTCTTGG - Intergenic
1105764042 13:23540673-23540695 TAAATATCTCTTTCTGGGCTGGG - Intergenic
1105910083 13:24856123-24856145 TTTAAATCCTTTCTTGGGCCAGG + Intronic
1106628553 13:31445821-31445843 TAAAAATATTTTGTTTTGCTAGG - Intergenic
1106632197 13:31486565-31486587 TAAAAATGTTTTCTTGGGCTGGG - Intergenic
1106734757 13:32577846-32577868 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1106833274 13:33608200-33608222 TAAAAATGTTTTCATGGGCTGGG - Intergenic
1106842598 13:33700397-33700419 TAAGCATCTTTTCATGAGCTTGG + Intergenic
1107473218 13:40710807-40710829 GAAAATTCTTTTCTTGAGGTGGG + Intergenic
1107543134 13:41411853-41411875 TAAAGTGCTTTTCTTAGGCTGGG + Intergenic
1107689519 13:42938616-42938638 TAAAAATCTGTTGTTAGGCTGGG + Intronic
1107722292 13:43261558-43261580 TAAAAATCATGTCTTTGACTTGG + Intronic
1107785896 13:43957532-43957554 TAAAAATATTTTCTCAGGCCAGG + Intergenic
1108456011 13:50614487-50614509 AAAAAATATCTTCTTTGGCTGGG + Intronic
1108557266 13:51606175-51606197 TAAAAATCCTATCATGTGCTAGG - Intronic
1108874179 13:55025015-55025037 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1108979731 13:56495360-56495382 TTAAGAACTTTTCTTGGGCCTGG - Intergenic
1109006309 13:56882374-56882396 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1109076811 13:57846151-57846173 TAAAAGTAGTTTCATGGGCTGGG - Intergenic
1109084418 13:57951513-57951535 AAAAAATGGTTTCGTGGGCTGGG - Intergenic
1109227718 13:59716468-59716490 TAAAAATGTTTCCTGGGGCCGGG - Intronic
1109247463 13:59973308-59973330 TAACAAGTTTTTCTTGGTCTGGG - Intronic
1109294485 13:60513279-60513301 AAAAAATGGTTTCATGGGCTGGG - Intronic
1109681268 13:65756263-65756285 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1109733257 13:66444854-66444876 TAAAAATACTTTCTAAGGCTGGG - Intronic
1109815781 13:67582524-67582546 TAAAAATCTTTTTTTTGGTGGGG + Intergenic
1109951889 13:69510760-69510782 AAAAAATGGTTTCTTGGGCTGGG + Intergenic
1110185564 13:72670617-72670639 AAAAAATCTTTCCTTAAGCTAGG - Intergenic
1110208169 13:72942703-72942725 TAAAAATCCTTTAGTAGGCTGGG + Intronic
1110250710 13:73377506-73377528 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1110359627 13:74610592-74610614 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
1110511401 13:76355663-76355685 AAAAAATGGTTTCTTGGGCCGGG + Intergenic
1110871578 13:80458526-80458548 TAAAAATCATTTCTTGTCTTTGG - Intergenic
1110918046 13:81047859-81047881 TAAAAATATTTTCTTTGTATTGG - Intergenic
1111036190 13:82677439-82677461 GAAAAATGGTTTCCTGGGCTAGG - Intergenic
1111271450 13:85892472-85892494 CAAAAATGGTTTCTTGGGCCAGG + Intergenic
1111385431 13:87521311-87521333 AAAAAATGTTTTTGTGGGCTGGG + Intergenic
1111407552 13:87828809-87828831 TCAAAATCATTTATTGAGCTTGG + Intergenic
1111566621 13:90025553-90025575 TAAATATTTTTTCTTAGTCTGGG + Intergenic
1111601663 13:90482034-90482056 TAAAAATGGTTTCCTGGTCTGGG - Intergenic
1111614357 13:90644182-90644204 AAAAAATGTTTTCCTGGGCCTGG - Intergenic
1111716687 13:91887331-91887353 AAAAAATGTTTTCCTGGGCCAGG - Intronic
1111922471 13:94426882-94426904 GAAAAATCTTGTTTGGGGCTGGG + Intergenic
1112050341 13:95639293-95639315 TGAAAATCTTCTCTTAGGCCAGG + Intronic
1112217095 13:97443561-97443583 TAAAAATTTTTTCTAGAGATGGG + Intronic
1112356985 13:98681803-98681825 TAAAAATCCTTTGTTTGGCTGGG - Intergenic
1112511439 13:100012949-100012971 TAAAAATCAATTATTTGGCTGGG + Intergenic
1113193769 13:107781104-107781126 TAAAAATTTCTTCTTGTGCCAGG + Intronic
1113497575 13:110743895-110743917 CAAAAATGGTTTCATGGGCTGGG - Intergenic
1113501909 13:110782373-110782395 TAAAAATGGTTTCATGGGCCAGG - Intergenic
1114014410 14:18413762-18413784 TAAAAATATTCCCTTTGGCTGGG - Intergenic
1114290152 14:21281391-21281413 TAAAAATCTACTCTTGGCCCAGG + Intergenic
1114431099 14:22661601-22661623 TCAAATTCTGTTCTTAGGCTGGG + Intergenic
1114649613 14:24276073-24276095 TAAAAATTTTTTTTTGGCCACGG + Intergenic
1114800074 14:25764064-25764086 TAAAAATATCTTCTCGGGCCAGG - Intergenic
1114840121 14:26253294-26253316 TCCAAATCTTTTCAGGGGCTGGG + Intergenic
1114917833 14:27289249-27289271 TAAATATGATTTCTTGGGCCAGG - Intergenic
1115007181 14:28499449-28499471 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
1115327315 14:32154442-32154464 TAAAAAACTTTTCCTGGGCCAGG - Intronic
1115419946 14:33183128-33183150 TAGAAATCCATTCTTGGGCTGGG + Intronic
1115644102 14:35355371-35355393 TAAAAATCTATACCTAGGCTGGG + Intergenic
1115765081 14:36614933-36614955 TAAAAATCAATTGTGGGGCTGGG + Intergenic
1115932170 14:38509007-38509029 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1115996534 14:39201341-39201363 CAAAAATGTTCTCTTGGGCCAGG + Intergenic
1116038966 14:39662386-39662408 TAAAAATCTTTTTTTGGGGTGGG - Intergenic
1116415562 14:44672975-44672997 TAAAAATCATTTCATGGGCCAGG - Intergenic
1116437075 14:44907941-44907963 TAAAAATATATTCTGGGGCTGGG - Intergenic
1116642701 14:47485643-47485665 GAAAAGTGGTTTCTTGGGCTGGG + Intronic
1116783837 14:49266947-49266969 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1117084147 14:52181524-52181546 AAAAAATCATTTTGTGGGCTGGG - Intergenic
1117250256 14:53929624-53929646 TAAAAATATAGTCTGGGGCTGGG - Intergenic
1117283824 14:54266692-54266714 TAAACCTCTTTCCTTTGGCTGGG + Intergenic
1117385085 14:55203911-55203933 TAAAAAACTATTTTTAGGCTGGG + Intergenic
1117632706 14:57710100-57710122 GAAAAATGGTTTCCTGGGCTGGG + Intronic
1117684994 14:58244009-58244031 TAAAAAACTTGGCTTGCGCTGGG - Intronic
1117728805 14:58700586-58700608 TAAAAATCATTTTTTAGGCCGGG - Intergenic
1118071942 14:62255079-62255101 TAAAAATCAATTCTTTGGCCAGG - Intergenic
1118382975 14:65232794-65232816 TTAAAATTTTTTTTTGGGCCGGG + Intergenic
1118460507 14:65982864-65982886 TAAAACTGTTTTGTGGGGCTGGG + Intronic
1118533388 14:66731808-66731830 AAAAAATGGTTTCGTGGGCTGGG + Intronic
1118641459 14:67796499-67796521 TCAAAATCCTTTCTTCGGCCTGG - Intronic
1118657529 14:67968201-67968223 AAAAAATGGTTTCATGGGCTGGG - Intronic
1118956787 14:70489884-70489906 GAAAAATGGTTTCATGGGCTGGG - Intergenic
1119007337 14:70943766-70943788 AAAAAATGGTTTCTTGGGCGAGG + Intronic
1119035311 14:71225426-71225448 TAAAAATATTATCTTGAGTTTGG + Intergenic
1119305820 14:73607431-73607453 GAAAAATGATTTCTTGGTCTGGG - Intergenic
1119308159 14:73624422-73624444 TAAAAAAATTTTTTTGGGCGGGG - Intergenic
1119812312 14:77532487-77532509 TAAAAATCTGATTCTGGGCTGGG + Intronic
1120103996 14:80473865-80473887 GAAAAATGATTTCATGGGCTGGG - Intergenic
1120247953 14:82027929-82027951 AAAAAATGATTTCATGGGCTGGG - Intergenic
1120388421 14:83875152-83875174 TAAAAATCCTTTCTTGCCTTAGG + Intergenic
1120485915 14:85112994-85113016 AAAAAATAGTTTCATGGGCTAGG - Intergenic
1120661618 14:87257634-87257656 TAAAAATGGTTTCATGGGCCAGG + Intergenic
1121592001 14:95122325-95122347 TAAATAAATTTTCTGGGGCTTGG - Intronic
1121651900 14:95564880-95564902 TAAAAATCTTTAGTTGAGATGGG - Intergenic
1122442450 14:101741361-101741383 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1122627785 14:103092979-103093001 TAAAATTCGTATGTTGGGCTGGG + Intergenic
1122696721 14:103557696-103557718 TTAAAAACTCTTCCTGGGCTGGG + Intronic
1123128094 14:105964200-105964222 GAAAAATGTTTTCATGGGCTGGG + Intergenic
1123147757 14:106150546-106150568 AAAAAATGATTTCATGGGCTGGG + Intergenic
1123408618 15:20040356-20040378 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1123517949 15:21047066-21047088 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1123712142 15:22996347-22996369 TAAAAAAAATGTCTTGGGCTGGG + Intronic
1124665885 15:31592392-31592414 TAAACATTTTTTCTTAGCCTAGG + Intronic
1125143903 15:36443093-36443115 TAAAAAGTATTTTTTGGGCTGGG - Intergenic
1125181327 15:36883471-36883493 TAAAAACATTTCCTTGGACTCGG + Intergenic
1125299979 15:38244954-38244976 TAAAAATCCTGTTTTGGGGTGGG + Intergenic
1125455226 15:39851872-39851894 TGGAAATCTTTTTTTGGTCTTGG - Intronic
1125521782 15:40352030-40352052 TAAAAAAATTTTTTTTGGCTGGG - Intronic
1125904645 15:43379742-43379764 TAAAAAGCTTTCCTTGGCTTTGG + Intronic
1126488831 15:49213820-49213842 TTTAAAACTTTTTTTGGGCTGGG + Intronic
1126524754 15:49639554-49639576 TAAACATTTTTTCTTGAGGTGGG - Intronic
1126820390 15:52497255-52497277 TAACATTTTTTTCTCGGGCTGGG - Intronic
1127415865 15:58756700-58756722 TAAAAATCCCTTCTGGGCCTGGG + Intergenic
1127704800 15:61536107-61536129 TAAAACACTTTCCTTGTGCTAGG + Intergenic
1127781793 15:62322944-62322966 TAAAAATGTATTATTTGGCTGGG - Intergenic
1127791044 15:62398955-62398977 GAAAAATGGTTTCGTGGGCTGGG + Intronic
1128013981 15:64326319-64326341 TAAAAATATTTTCTTGGGCCAGG - Intronic
1128026597 15:64442578-64442600 TAGAATTCTTTTCTCTGGCTAGG - Intronic
1128035981 15:64526944-64526966 TCAAAATCTCATATTGGGCTGGG - Intronic
1128198522 15:65783021-65783043 TAAAGATCTTTAGTTGGGCAAGG + Intronic
1128670366 15:69570240-69570262 TAAAAATCATTTGCTGGGCCAGG + Intergenic
1128881812 15:71250788-71250810 TAAAAATCTATGATTGGCCTGGG + Intronic
1129629286 15:77240322-77240344 TACAAATGTTTTGTTTGGCTGGG + Intronic
1129763212 15:78144043-78144065 TAAAAATGTTTTTTTTGGCCAGG + Intronic
1129871011 15:78941495-78941517 TAAAAATTTATTCTGGAGCTGGG + Intronic
1131028548 15:89166589-89166611 CAAAAATTATCTCTTGGGCTGGG + Intronic
1131201701 15:90402973-90402995 ACAAAATGTTTTTTTGGGCTGGG + Intronic
1131213259 15:90516063-90516085 TAAAAACTTTTTATTTGGCTGGG - Intergenic
1131700956 15:94934905-94934927 GAAAAATGGTTTCCTGGGCTAGG - Intergenic
1132200636 15:99952324-99952346 TATAAATCTATTCTTGGGGCTGG + Intergenic
1133151394 16:3834861-3834883 TTAAAAGCTTTTCTTGGGCCAGG + Intronic
1133243331 16:4429514-4429536 TAAAAATCTTTTTGTAGGCCGGG - Intronic
1133269872 16:4605579-4605601 TAAAAATCAGATCTGGGGCTGGG + Intergenic
1134265344 16:12687778-12687800 AAAAAAGCTTTCTTTGGGCTTGG + Intronic
1134611815 16:15615074-15615096 TAAAAATAGTTTCAGGGGCTGGG - Intronic
1134840093 16:17394823-17394845 TATAAAGCATTTGTTGGGCTGGG + Intronic
1135099584 16:19594346-19594368 TAAAAATCCTTGCCTTGGCTAGG + Intronic
1135388912 16:22071713-22071735 TACAAGTCTTTTATTTGGCTGGG + Intronic
1135426549 16:22341814-22341836 TAAAAACCTATTTTTAGGCTGGG + Intergenic
1135459662 16:22630682-22630704 TTAAAATCTATTCTTAGCCTGGG + Intergenic
1135919074 16:26631992-26632014 TAAAAATGGTTTAATGGGCTGGG - Intergenic
1136015471 16:27397515-27397537 TAAGCATCTTTTCATGTGCTTGG - Intergenic
1136472028 16:30487386-30487408 AAAAAACCTCTTCATGGGCTGGG - Intronic
1136548390 16:30968020-30968042 TCATACTCTTTTCTTGGGCCAGG + Intronic
1136651047 16:31671565-31671587 TAAGAATCTGTTTTTAGGCTGGG + Intergenic
1136690993 16:32028893-32028915 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1136791581 16:32972455-32972477 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1136878235 16:33881477-33881499 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1137234427 16:46602924-46602946 TAAAAATAACTTTTTGGGCTGGG - Intronic
1137271141 16:46902951-46902973 TTAAAATTATTTCTTGGGCCGGG + Intronic
1137438319 16:48476723-48476745 AAAAAATCTTTTCTAGGCTTTGG - Intergenic
1137440447 16:48494357-48494379 TAAGAATCTATAGTTGGGCTGGG + Intergenic
1137993669 16:53185678-53185700 GAAAAATGTTTTCTTGGGCTGGG + Intronic
1138362160 16:56440339-56440361 TAATAATCTTGTCTTGGTATTGG - Intronic
1138574212 16:57897126-57897148 TAAAATTTTTTTCTAGAGCTGGG - Intronic
1138959145 16:62008106-62008128 TAAAAATATTTTGTAGAGCTGGG + Intronic
1139079427 16:63497365-63497387 AAAATATCTTTGCTTCGGCTGGG - Intergenic
1139637766 16:68268708-68268730 TAAAAATTTTTTTGTTGGCTGGG + Intronic
1139715372 16:68809172-68809194 CAAAACCCATTTCTTGGGCTTGG + Intronic
1139831901 16:69806193-69806215 TAAAAATCTTTTCTAGAGACAGG - Intronic
1139844865 16:69913326-69913348 AAAAAAACTTTTTTTTGGCTGGG - Intronic
1140029230 16:71321263-71321285 TAATAACCCTTTCTTTGGCTGGG - Intergenic
1140146934 16:72320170-72320192 GAAAAATGGTTTCATGGGCTGGG - Intergenic
1140417750 16:74788386-74788408 AAAAAATTTTTTTTTGGGCCGGG + Intergenic
1140460309 16:75134435-75134457 TAAAAATGTTTTTTGGGGATGGG - Intergenic
1140620227 16:76720851-76720873 TAAAAATGTTATAATGGGCTTGG + Intergenic
1140807502 16:78546508-78546530 AAATAATCTTTTCTTGGGCAAGG - Intronic
1141214169 16:82008889-82008911 CAAAAATGGTTTCCTGGGCTGGG + Intronic
1141451794 16:84108560-84108582 GAAAGTGCTTTTCTTGGGCTGGG - Intronic
1141719676 16:85749441-85749463 TAAAAATTTTTTAATGAGCTGGG - Intronic
1142198458 16:88749730-88749752 AAAAATGCTATTCTTGGGCTGGG + Intronic
1203093790 16_KI270728v1_random:1233916-1233938 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1142511642 17:399191-399213 TAAAAAACTAGTATTGGGCTAGG + Intergenic
1142950333 17:3473084-3473106 GAAAAATCTATTTTTGGGGTGGG - Intronic
1143379424 17:6486703-6486725 TAAAGACCTTGCCTTGGGCTTGG + Intronic
1143420610 17:6788789-6788811 TAAGAGTCTATTCTGGGGCTGGG - Intronic
1143693875 17:8595724-8595746 TAAACAACTGTTCTTGGGCCGGG - Intronic
1143721230 17:8811289-8811311 AAAAAATGGTTTCATGGGCTGGG - Intronic
1143973609 17:10813765-10813787 AAAAAATTTTTTATTTGGCTAGG + Intergenic
1144399696 17:14884102-14884124 AAAAAATGGTTTCTTGGGCTGGG - Intergenic
1144663829 17:17088843-17088865 GAAAAATCTTTTCTTTGGCCGGG + Intronic
1144869233 17:18358604-18358626 TTAAAATATGTACTTGGGCTGGG + Intronic
1145079670 17:19884246-19884268 TAAAAAACTGTTCGTAGGCTAGG - Intergenic
1145918429 17:28591434-28591456 TAAAAATCTTTTGTAGGGATGGG + Intronic
1145927284 17:28657691-28657713 TAAAAATTTTTTTTTAGGCTGGG - Intronic
1145960789 17:28885541-28885563 GTGAAATCTATTCTTGGGCTTGG - Intronic
1146204141 17:30887419-30887441 TAAAAATCTGTGCTATGGCTGGG + Intronic
1146293338 17:31629031-31629053 TAAAAATCCCTTTGTGGGCTGGG - Intergenic
1146304162 17:31717680-31717702 AAAAAATCTTTTTTCTGGCTGGG - Intergenic
1146304206 17:31717980-31718002 AAAAAATCTTTTTCTGGGCCGGG - Intergenic
1146571726 17:33958648-33958670 GAAAAATGCTTTCATGGGCTGGG - Intronic
1146959125 17:36957632-36957654 TGAAATACTTTTCTTTGGCTTGG + Intronic
1147348737 17:39823586-39823608 CAAAAATGGTTTCCTGGGCTGGG + Intronic
1147688775 17:42302636-42302658 TAAAAATGTTTACTGAGGCTGGG + Intronic
1147731057 17:42602513-42602535 TAAGAAGCTTTTCCAGGGCTGGG - Intronic
1147983473 17:44289824-44289846 TCAAAATATCTTATTGGGCTGGG + Intergenic
1148006708 17:44437650-44437672 TAAAAAGTTTTTTTTGGGGTTGG - Intronic
1148007881 17:44448978-44449000 AAAATATCATTTCCTGGGCTAGG + Intronic
1148154196 17:45413334-45413356 TGAGACCCTTTTCTTGGGCTTGG + Intronic
1148390566 17:47269151-47269173 AAAAAATGGTTTCCTGGGCTGGG - Intronic
1148573493 17:48690010-48690032 TTAAAATCTTTTCTTAGGTTGGG - Intergenic
1148710882 17:49679830-49679852 TTAAAAATTATTCTTGGGCTGGG + Intergenic
1148832367 17:50442007-50442029 TAAAAACATTTTTTTTGGCTGGG + Intronic
1149113495 17:53063057-53063079 AAAAAATGTTTTCATGCGCTGGG + Intergenic
1149135523 17:53359350-53359372 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1149669454 17:58393110-58393132 TAAATACATTTTCTTGGGCCAGG + Intronic
1149741159 17:59046833-59046855 TAAAAATTTGTTTTTCGGCTGGG - Intronic
1149896645 17:60433470-60433492 AAAAAATGTTTTCCTGGGCCAGG - Intergenic
1149905138 17:60519309-60519331 TAAAAATAATTTTTTAGGCTAGG + Intronic
1149906712 17:60533310-60533332 TTTAAATCTTTTTTTGGGCCAGG + Intergenic
1150020651 17:61608872-61608894 TAAAAATCTTATGCTGGGCGTGG - Intergenic
1150048049 17:61932555-61932577 TAAAAATCTGTTTTTGGGTTGGG - Intergenic
1150332326 17:64304266-64304288 AAAAAATCTTTTGCTGGGCACGG + Intergenic
1150495649 17:65606086-65606108 GAAAAATTTCATCTTGGGCTGGG + Intronic
1150725413 17:67647604-67647626 TAAAAATAGCTTCCTGGGCTGGG - Intronic
1151731795 17:75915711-75915733 TAAAAACATTTTTTTGGGCCGGG + Intronic
1151734499 17:75930627-75930649 AAAAATTATTTTCTTTGGCTGGG + Intronic
1152512138 17:80797576-80797598 TTAAAAACTTTTCTTTGGCTGGG - Intronic
1152831643 17:82500912-82500934 AAAAAATTTTTTTTTTGGCTGGG - Intergenic
1153392073 18:4573907-4573929 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1153455054 18:5271527-5271549 AAATAATGTTTTTTTGGGCTGGG - Intergenic
1153846039 18:9050819-9050841 AAAAAATGTTTTCTGGGGCCAGG + Intergenic
1153854597 18:9133770-9133792 TAAAAATGTTCTCTGGGGTTGGG + Intronic
1154081668 18:11263264-11263286 TAAAAATATTATTTTAGGCTGGG - Intergenic
1154095046 18:11406458-11406480 TGAAAAACTATTCTGGGGCTGGG - Intergenic
1154523239 18:15252891-15252913 TAAAAATATTCCCTTTGGCTGGG + Intergenic
1155278293 18:24211261-24211283 TAAAAATGTTATTTAGGGCTGGG - Intronic
1155296282 18:24387348-24387370 TAAAAAAATATTTTTGGGCTGGG - Intronic
1155341831 18:24820939-24820961 TAAAATTCTTTTTTTGGATTTGG + Intergenic
1155601668 18:27555956-27555978 AAAAAATCTTTAGTTGGGCATGG + Intergenic
1155628669 18:27865201-27865223 TAAAAATAAATCCTTGGGCTGGG - Intergenic
1155842920 18:30668374-30668396 GAAAAATGGTTTCATGGGCTGGG - Intergenic
1155967952 18:32053612-32053634 TAAAAATTTTTTCTAGAGATGGG - Intronic
1156153028 18:34266223-34266245 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1156686868 18:39660717-39660739 TAAAAATCTCTTCGGGGGCAAGG - Intergenic
1157003124 18:43550603-43550625 TAAAAGTGTTTTCATGGGCTGGG - Intergenic
1157011108 18:43650064-43650086 TAAATATTTTATATTGGGCTTGG - Intergenic
1157093968 18:44669627-44669649 TAAAATTCTGTTTGTGGGCTAGG - Intergenic
1157261692 18:46180964-46180986 TAAATGTCGTTTTTTGGGCTGGG + Intronic
1157930566 18:51817337-51817359 TAAAAATCTTTTCATGTATTTGG + Intergenic
1158270680 18:55712336-55712358 TAAAAATTTTATTTTGGGCCAGG + Intergenic
1158856592 18:61548932-61548954 TAATAATGTTTTCTTAGGTTAGG + Intronic
1159138185 18:64361476-64361498 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1159204521 18:65232924-65232946 GAAAAATGCTTTCCTGGGCTGGG + Intergenic
1160233663 18:77068309-77068331 TAAAGATCTTCATTTGGGCTTGG - Intronic
1160601385 18:80015082-80015104 AAAAAATGTTTTTGTGGGCTGGG - Intronic
1161078524 19:2298832-2298854 TAAAAAAAATTTCTTGGGCCGGG - Intronic
1161131526 19:2592561-2592583 TAAAAATTTTTTCTAGAGATAGG - Intronic
1161141418 19:2650480-2650502 TAAAAATGATTCCTAGGGCTGGG - Intronic
1161475498 19:4482630-4482652 TAAAAATCTTTCCTTTAGCAGGG - Intronic
1161484433 19:4527365-4527387 TAAAAATTTTTTTTTAGGCCGGG - Intronic
1162002705 19:7757554-7757576 AAAAAATGGTTTCGTGGGCTGGG + Intergenic
1162688903 19:12412742-12412764 AAACAATCTTATCCTGGGCTGGG + Intronic
1163056975 19:14727321-14727343 TAAACCTCTTTTCTTGGGCCGGG - Intronic
1163107392 19:15132929-15132951 TAAAAATGTATGGTTGGGCTGGG + Intergenic
1163172866 19:15544763-15544785 TTAAAAGCTTTGCTTGGGCCGGG + Intronic
1163522791 19:17801790-17801812 TAAAAAAATTTTTTTTGGCTGGG + Intronic
1164001856 19:21107532-21107554 TAGAAATCTTGTCTATGGCTGGG - Intronic
1164145104 19:22507804-22507826 TAAAAATGTTTATTTAGGCTGGG + Intronic
1164614272 19:29656973-29656995 TAAAAATCTAAACTTGGGCCGGG - Intergenic
1164833152 19:31338501-31338523 AAAAAATCTTTTGGTTGGCTTGG - Intronic
1165505644 19:36227091-36227113 AAAAAATTTTTTTTTTGGCTGGG + Intronic
1165990665 19:39810843-39810865 TAAAAATGTTTCCTTTTGCTTGG + Intergenic
1166012031 19:39949763-39949785 TCAATATCTTTTCTAGGACTGGG + Intergenic
1167952954 19:53042327-53042349 TTAAAATCTTTGTTTGGGCCGGG - Intergenic
1168255756 19:55164182-55164204 TAAACCTCTTTTCTTGGGGCCGG + Intronic
1168278594 19:55291241-55291263 TAAAGATTTTTTTTTTGGCTGGG + Intronic
1168429215 19:56264287-56264309 CAAAAAGTCTTTCTTGGGCTGGG - Intronic
1168655096 19:58121700-58121722 TGAAAAAATTTTCTTAGGCTGGG - Intergenic
1168668908 19:58226591-58226613 TAAAAATGTTACCTTTGGCTGGG - Intergenic
925443571 2:3908682-3908704 AAAAAATGGTTTCATGGGCTAGG - Intergenic
925498944 2:4483246-4483268 AAAAAATGGTTTCATGGGCTGGG + Intergenic
925661626 2:6209204-6209226 AAAAAATATTTTCTTGGGCCAGG + Intergenic
925821149 2:7801129-7801151 AAAAAATAGTTTCCTGGGCTGGG + Intergenic
926484000 2:13432616-13432638 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
926655321 2:15397836-15397858 AAAAAATCTTTGCCTGGACTTGG + Intronic
926709150 2:15862563-15862585 TAAAAACATTCTGTTGGGCTGGG - Intergenic
926949507 2:18226668-18226690 GAAAAACGGTTTCTTGGGCTGGG + Intronic
927255210 2:21035368-21035390 TAGATATCTTTTGTTGGTCTTGG + Intronic
927317827 2:21706195-21706217 TAACAATCTTTCCTTGGCCCTGG + Intergenic
927329088 2:21841559-21841581 GAAAAATGTTTTCATGGGCTGGG + Intergenic
927549676 2:23986911-23986933 TTAAAAGCTTTTTTTTGGCTGGG + Intronic
927789200 2:25997163-25997185 TATCAATCTTTTATTTGGCTTGG + Intergenic
928609889 2:32982593-32982615 GAAAAATGGTTTCTTGGGCTAGG + Intronic
929184017 2:39074570-39074592 TAAAAATATTTTCTCTGGCTGGG + Intronic
929426174 2:41846825-41846847 TAAGGATCTTCTCTGGGGCTGGG - Intergenic
929478420 2:42277860-42277882 TTAAAAGGTTTGCTTGGGCTGGG - Intronic
930039590 2:47110296-47110318 TAAAAATTATATTTTGGGCTGGG + Intronic
930214416 2:48679981-48680003 TGAAAATCTTTGCTGAGGCTAGG + Intronic
930481457 2:51952930-51952952 GAAAAATGGTTTCTTGGGCTGGG - Intergenic
930536145 2:52648440-52648462 AAAAAATGGTTTCATGGGCTGGG - Intergenic
930585638 2:53263885-53263907 AAAAAATGGTTTCATGGGCTAGG - Intergenic
930817102 2:55609384-55609406 TTAAGACCTTTTCATGGGCTGGG + Intronic
930942157 2:57026015-57026037 AAAAAATGTTTTCATGGGCTGGG - Intergenic
931061287 2:58532500-58532522 TAAAAATTTTTTGTAGAGCTGGG + Intergenic
931139678 2:59443933-59443955 TAAAAATTATTTGCTGGGCTGGG + Intergenic
931364162 2:61604213-61604235 AACAAATTTTTTCTTAGGCTGGG + Intergenic
931555887 2:63504391-63504413 TAAAAATATTTTTCTGGGCAGGG + Intronic
931594163 2:63923015-63923037 TAAAAAGATTTTTTGGGGCTGGG + Intronic
931626217 2:64258261-64258283 AAAAAATGTTTTGTTGGTCTAGG - Intergenic
931641938 2:64388775-64388797 CAAAAATCTTTTGTTGGGGTGGG + Intergenic
931726240 2:65113783-65113805 AAAAAATCTTTTGAGGGGCTGGG + Intronic
932256329 2:70290688-70290710 TAAAAATATATTTATGGGCTGGG + Intronic
932849500 2:75171134-75171156 AAAAAATGGTTTCATGGGCTGGG + Intronic
933006679 2:77004266-77004288 GAAAAATGGTTTCCTGGGCTGGG + Intronic
933331627 2:80899633-80899655 TAGAAATATTTTCGTGGGCCGGG + Intergenic
933344533 2:81066249-81066271 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
933709109 2:85312840-85312862 TTAAAGTCTTTTTTGGGGCTGGG + Intergenic
933739176 2:85519767-85519789 TAAAAATCATTGCTTTGGCTGGG - Intergenic
933935533 2:87200606-87200628 TAAAAATTTTATTTTAGGCTGGG - Intergenic
933947227 2:87297113-87297135 AAAAAGTGGTTTCTTGGGCTGGG - Intergenic
934017101 2:87899540-87899562 GAAAAATGGTTTCTTGGGCCAGG + Intergenic
934159749 2:89237567-89237589 TAAAAATCTTCTTTCGGGCTGGG + Intergenic
934207530 2:89944864-89944886 TAAAAATCTTCTTTCGGGCTGGG - Intergenic
934700811 2:96438759-96438781 GAAAAATGGTTTCATGGGCTAGG + Intergenic
934960448 2:98668246-98668268 GAAAAATGGTTTCCTGGGCTGGG + Intronic
935008104 2:99101461-99101483 AAGAAAGCTTGTCTTGGGCTGGG - Intronic
935947041 2:108296083-108296105 TCAAAAGCCGTTCTTGGGCTGGG - Intronic
936115255 2:109697192-109697214 TAAAAGGCATTTCTTTGGCTGGG + Intergenic
936158404 2:110064815-110064837 TAAAAATCTAATCCTAGGCTGGG - Intergenic
936186257 2:110306507-110306529 TAAAAATCTAATCCTAGGCTGGG + Intergenic
936332965 2:111564455-111564477 AAAAAGTGGTTTCTTGGGCTGGG + Intergenic
936357615 2:111765293-111765315 TAAAAATTTTATTTTAGGCTGGG + Intergenic
936606300 2:113959357-113959379 TAACAATATTTTATTGGGCCAGG - Exonic
936674483 2:114699335-114699357 TCAAAATATGTTCTTGTGCTAGG - Intronic
936721486 2:115256555-115256577 AAAAAATGTTTTCATGGGCCAGG - Intronic
936765221 2:115839378-115839400 TAAAAATGTTAGCTTAGGCTGGG + Intronic
936843557 2:116802873-116802895 AAAAAATGGTTTCATGGGCTGGG - Intergenic
936897558 2:117445652-117445674 AAAAAATGGTTTCATGGGCTAGG + Intergenic
937430121 2:121831372-121831394 TAAAAATCATTCTTAGGGCTGGG + Intergenic
937578775 2:123458053-123458075 TAAAAATATTTTTTCAGGCTGGG + Intergenic
937730362 2:125222784-125222806 AAAAAATGTTTTTTTGGGCTGGG - Intergenic
937761027 2:125603915-125603937 AAAAAATGGTTTCTTGGGCTGGG + Intergenic
937774380 2:125758388-125758410 TAGGTATCTTTTTTTGGGCTAGG - Intergenic
937902473 2:127031662-127031684 ATAAAATTTTATCTTGGGCTGGG - Intergenic
938052925 2:128191561-128191583 TAAAAAACTTTTGTTCGGCCAGG + Exonic
938165340 2:129021129-129021151 AAAACATGGTTTCTTGGGCTGGG + Intergenic
938522543 2:132085763-132085785 TAAAAATATTCCCTTTGGCTGGG + Intergenic
938603989 2:132873406-132873428 TAAAAAACATTTTTTCGGCTGGG - Intronic
938880024 2:135576100-135576122 TAAAAATGGTATCTTGGGCTGGG + Intronic
939065394 2:137478123-137478145 TCTAAATCTTTTCTTAGACTTGG + Intronic
939118910 2:138092350-138092372 TAAATATCTTTGCTTGATCTTGG + Intergenic
939155915 2:138524314-138524336 AAAAAATGGTTTCATGGGCTGGG - Intronic
939201214 2:139037470-139037492 TAAAAATGCTTTGTTGAGCTTGG + Intergenic
939438087 2:142204728-142204750 TAAAAAGCTTTTACTGGGCTGGG + Intergenic
939605811 2:144253927-144253949 GAAAAATGGTTTCCTGGGCTGGG + Intronic
939781854 2:146459066-146459088 CAAAAATGGTTTCCTGGGCTGGG - Intergenic
939902040 2:147862445-147862467 TAAAATTGTTTTCCTGGGCAGGG + Intronic
939963831 2:148591523-148591545 TAAAAATAATTTCGTGGGCTGGG + Intergenic
939971293 2:148664201-148664223 TAAAAATAATTTATTAGGCTGGG + Intronic
940328291 2:152448515-152448537 TAAAACTCTCTTCTTTGACTTGG + Intronic
940501919 2:154504293-154504315 GAAAAATGGTTTCATGGGCTGGG + Intergenic
940596208 2:155795961-155795983 GAAAGATGTTTTCCTGGGCTGGG - Intergenic
940691303 2:156923955-156923977 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
940954110 2:159709685-159709707 TAAAAAGCTTCTCTTTGGCAAGG - Intergenic
941165526 2:162079135-162079157 CAAAAATGGTTTCATGGGCTAGG - Intergenic
941168182 2:162105838-162105860 TAAAAATCTTATTCTGGGCCTGG + Intergenic
941552940 2:166939384-166939406 GAAAATTCTTTTCTTGGGCTGGG + Intronic
941609726 2:167645874-167645896 TAAAAATGTGTACTTGGGGTGGG + Intergenic
941636238 2:167937639-167937661 AAAAAAGGTTTTCTTGAGCTGGG - Intergenic
941649784 2:168080739-168080761 AAAAAATGGTTTCTTGGGCTGGG + Intronic
941888356 2:170552818-170552840 GAAAAATGGTTTCCTGGGCTGGG + Intronic
941898998 2:170659501-170659523 TTAAAAACTTTTTTTTGGCTGGG - Intergenic
941967234 2:171312375-171312397 GAAAAATGGTTTCTTGGGCTGGG + Intergenic
941996809 2:171608869-171608891 AAAAAATTTTTTTTTGTGCTGGG - Intergenic
942204604 2:173607727-173607749 ATAAAACCTTGTCTTGGGCTGGG - Intergenic
942428263 2:175882116-175882138 TAAAAACCTTATATTAGGCTGGG + Intergenic
942713173 2:178861338-178861360 TAAAAATTTTTTGTAGGGCCGGG + Intronic
943372071 2:187028131-187028153 GAAAAATGATTTCTTGAGCTAGG + Intergenic
943812828 2:192210860-192210882 TTAAAAGATTTTGTTGGGCTTGG + Intergenic
943949776 2:194118681-194118703 TATAATTTTTTTCTTGGGTTTGG - Intergenic
944303907 2:198157506-198157528 AAAAAATGGTTTCATGGGCTTGG + Intronic
944376164 2:199044675-199044697 TAAAAATCCTTTCTGGAACTTGG + Intergenic
944417187 2:199490660-199490682 TAAAAATCTGTCTTTAGGCTGGG - Intergenic
944477953 2:200126090-200126112 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
944800133 2:203231018-203231040 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
945078010 2:206059885-206059907 TTAAAATTTTTTCTTGTTCTTGG - Intronic
945330781 2:208536875-208536897 AAAAAATGCTTTCATGGGCTTGG - Intronic
945366058 2:208955799-208955821 CAAAGATCATTTTTTGGGCTGGG + Intergenic
945591403 2:211736409-211736431 TAAAAATGTATTGTTGGGCAGGG + Intronic
945837613 2:214851438-214851460 TATAATTCGTTTCTTGGCCTTGG + Intergenic
946038691 2:216765675-216765697 TAAAAATAATTTCTTGGCATTGG - Intergenic
946112380 2:217431441-217431463 CAGAAATCTATTCTTGTGCTTGG - Intronic
946256030 2:218442622-218442644 TAGAAATGTGTTCTTAGGCTGGG - Intronic
946706640 2:222464776-222464798 TAAAACCCTGTGCTTGGGCTGGG - Intronic
946843387 2:223838690-223838712 TAAGAATCATTTCCTGGGCCAGG + Intergenic
946867143 2:224051996-224052018 AAAAAATCTATTCTTGGATTAGG - Intergenic
947110806 2:226717467-226717489 TAAAAATCTTTCCCTGCTCTAGG + Intergenic
947255557 2:228159921-228159943 TAGGAATCTGTTCTGGGGCTAGG + Intronic
947406804 2:229786712-229786734 TAAAAAAATCTTCTTGGGCCCGG - Intronic
947473869 2:230424184-230424206 TCAAATTCTTTTCTGGGGCAAGG - Intronic
947564997 2:231188101-231188123 TAAAAATGTTTGGTTTGGCTGGG + Intergenic
947775049 2:232701870-232701892 TAATAAACTCTTCTTTGGCTGGG + Intronic
947775068 2:232701988-232702010 TAAAAATCTTTTTTAGAGATGGG - Intronic
947888525 2:233595484-233595506 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
947888749 2:233596877-233596899 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
948881793 2:240862036-240862058 TAAAGATCTTATCTTAGGCCCGG + Intergenic
1169114132 20:3051976-3051998 TAAAAATCTTTCCCTGGGCCAGG + Intergenic
1169609645 20:7364583-7364605 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1169642981 20:7776319-7776341 AAAAAATGTTTTCATGGGCCAGG + Intergenic
1169765677 20:9145555-9145577 TAATTATCTTTTCTTGAGGTTGG + Intronic
1169798096 20:9486736-9486758 TAAAAATATTTTCTAAGGCTTGG + Intergenic
1170171969 20:13424788-13424810 TGAGAATCTTTTCGTGGTCTGGG - Intronic
1170622730 20:18008994-18009016 TAAAAATTATTTTTTTGGCTGGG - Intronic
1172127790 20:32635518-32635540 TAATAATCATTTCCTCGGCTGGG + Intergenic
1172280182 20:33702438-33702460 AAAAAATATTTTTTTAGGCTGGG + Intergenic
1172341899 20:34164620-34164642 TAAAATACTTTTCATGGGCTGGG - Intergenic
1172380190 20:34483110-34483132 TAAAAATGGTTTCATGGGCCGGG - Intronic
1172812027 20:37654946-37654968 TAAAAATGGTTTCATGGGCCAGG - Intergenic
1172908471 20:38387706-38387728 TTTAAATCTTTTTTTAGGCTGGG + Intergenic
1172923635 20:38510613-38510635 TGAAAATCTTTTATAGGGCCGGG + Intronic
1173245951 20:41337608-41337630 TAAAAATTTTTTGTAGGGATGGG - Intergenic
1173362068 20:42353751-42353773 TAAAAATATTTAATTAGGCTAGG + Intronic
1173522005 20:43707007-43707029 TAAAAAAATTTTTTTTGGCTGGG - Intronic
1173747867 20:45451830-45451852 CAAAAACCTTTTCCTGGGCCGGG - Intergenic
1173804974 20:45918727-45918749 GAAAAATCTCTTTCTGGGCTAGG + Intergenic
1173962554 20:47086368-47086390 TAAACCTCTTTTCTTTAGCTGGG - Intronic
1174043712 20:47718110-47718132 TAAAAATCATTTCTGAGGCCAGG - Intronic
1174491030 20:50895821-50895843 AAAAAATATTTTTTAGGGCTCGG - Intronic
1174614576 20:51825890-51825912 TAAAAATTTTTTTGTAGGCTGGG - Intergenic
1174922664 20:54721505-54721527 CAAAAATCATTTCTCGGGCTTGG - Intergenic
1174950130 20:55033641-55033663 TTACAATATTTTCTTGGGATAGG + Intergenic
1176156691 20:63625889-63625911 TAAAAATATTTTCTTGGGCCAGG - Intronic
1176774152 21:13115295-13115317 TAAAAATATTCCCTTTGGCTGGG - Intergenic
1177212000 21:18083091-18083113 AAAAAATTGTTTCATGGGCTGGG + Intronic
1177367240 21:20153967-20153989 GAAAAATTGTTTCATGGGCTGGG - Intergenic
1177570749 21:22883189-22883211 TAAAAATCACTTTGTGGGCTAGG - Intergenic
1177573766 21:22924041-22924063 TAAAAATACTTGTTTGGGCTGGG + Intergenic
1177798077 21:25800070-25800092 TAAAAACGTATTTTTGGGCTAGG - Intergenic
1177843292 21:26258680-26258702 TAAAAACATCATCTTGGGCTGGG + Intergenic
1177854178 21:26383338-26383360 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1177881726 21:26702583-26702605 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
1177908557 21:27001145-27001167 TAAAAATTTTTTCTAGAGATGGG - Intergenic
1177942589 21:27429664-27429686 TGAAAATCTCTTCTTGAGCTGGG + Intergenic
1177991608 21:28041752-28041774 TATCAATCTTTTCTTGCCCTTGG - Intergenic
1178099619 21:29253400-29253422 AAAAAATGGTTTCATGGGCTGGG - Intronic
1178190127 21:30270651-30270673 TAAAAGTCATTGCCTGGGCTTGG + Intergenic
1178251690 21:31009417-31009439 TAAAAATCTGTTGCTGGGCGCGG - Intergenic
1178255806 21:31051486-31051508 AATAAAACTTTTCATGGGCTGGG - Intergenic
1178257134 21:31064356-31064378 TAAAAATCATAGCCTGGGCTGGG - Intergenic
1179104097 21:38383283-38383305 AAAAAAGCTTTACTGGGGCTGGG - Exonic
1179203819 21:39253969-39253991 AAAATATCATTTCTTAGGCTGGG + Intronic
1179271988 21:39858622-39858644 GAAAAATGGTTTCTTGAGCTGGG - Intergenic
1179651289 21:42810731-42810753 TCAAAATCTATTCTTTGGCTGGG + Intergenic
1179796302 21:43786255-43786277 AAAAAATCTCTTCTCGGGCTGGG - Intergenic
1180438909 22:15344570-15344592 TAAAAATATTCCCTTTGGCTGGG - Intergenic
1180689084 22:17695613-17695635 TAAAAAAATTTTTTTTGGCTGGG - Intronic
1181152091 22:20891791-20891813 TAAAAATTTTTTCTAGAGGTGGG - Intergenic
1181290550 22:21789465-21789487 TAAAAACCTTTTCTGGGTTTGGG + Intronic
1181516000 22:23413695-23413717 TAAAAATACTCTCTTGGGCGGGG - Intergenic
1181564228 22:23724494-23724516 TAATTATCTTTTTTTTGGCTGGG + Intergenic
1182095934 22:27625796-27625818 TAAAAAATCTTTTTTGGGCTGGG - Intergenic
1182232841 22:28851898-28851920 AAAAAATCTGGTCCTGGGCTGGG - Intergenic
1182410136 22:30177973-30177995 TAAAAAGCTCCTCCTGGGCTGGG - Intergenic
1182980086 22:34661606-34661628 AAAAGATTTTTTGTTGGGCTTGG - Intergenic
1183025898 22:35065867-35065889 TAAACATGTTTTATTGGGCCTGG + Intergenic
1184066242 22:42123445-42123467 AAAAAATCTATAATTGGGCTGGG - Intergenic
1184068710 22:42135597-42135619 AAAAAATCTATAATTGGGCTGGG - Intergenic
1184157589 22:42678541-42678563 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1184507205 22:44911425-44911447 AAAAAATGTTTTCTTAGGCTGGG + Intronic
1184553645 22:45219883-45219905 CCAAAATCACTTCTTGGGCTGGG - Intronic
1184574279 22:45349627-45349649 TAAAAATCAGTCCTTGGTCTAGG - Intronic
949123898 3:422097-422119 TAAAAAGTTCTTCTTGGGCCAGG + Intergenic
949220533 3:1628461-1628483 TAACAGTCTTTTCTTTGGTTAGG - Intergenic
950085119 3:10251851-10251873 AAAAATTTTTTTTTTGGGCTGGG + Intronic
950380602 3:12611389-12611411 TAAAAATCTTTTGTAGAGATGGG + Intronic
950853146 3:16081827-16081849 AAAAAATGGTTTCATGGGCTGGG - Intergenic
950905622 3:16535336-16535358 TACTCATCTTTTCTTGGCCTTGG - Intergenic
950913180 3:16616268-16616290 AAAAAATGTTTTTGTGGGCTGGG + Intronic
951411924 3:22376086-22376108 TAAAAAACTTTTCCAGGGCCGGG - Intergenic
951605066 3:24423884-24423906 TAAATATCTTGTCTTCTGCTGGG - Intronic
952018883 3:28993078-28993100 TAAAAATGTCTTCTCAGGCTGGG + Intergenic
952060075 3:29497302-29497324 TAAAAATGTTTTCCCAGGCTAGG - Intronic
952077391 3:29713757-29713779 TAAAAATCTGTTATTGGGCCAGG + Intronic
952148085 3:30555522-30555544 GAAAAATGTTTTCCTGGGCATGG - Intergenic
952201246 3:31130263-31130285 TAAAAAACTTTTCTTGGGCTGGG - Intergenic
952220016 3:31315668-31315690 CAAAAATGATTTCGTGGGCTGGG + Intergenic
952416406 3:33094913-33094935 TTAAAATATTCTCTAGGGCTGGG + Intronic
952575792 3:34773054-34773076 AAAAAATTATTTCTTGGGCTGGG + Intergenic
953491792 3:43359233-43359255 TAAGAATTTTATCTTAGGCTGGG - Intronic
954252377 3:49377851-49377873 TAAAGAACTCTTTTTGGGCTGGG + Intronic
954398527 3:50306589-50306611 TAAAAAAATTTTTTTTGGCTGGG + Intronic
954570153 3:51633868-51633890 TAAAACTCTCTTTTTGGACTTGG + Intronic
954694551 3:52414711-52414733 TTAAAATCTATTTTTAGGCTGGG + Intronic
954964881 3:54601496-54601518 TAAAAATCTTGTCCAGGGCATGG - Intronic
955276382 3:57551159-57551181 TAAAAATTTTTGTTTTGGCTGGG - Intergenic
955363303 3:58291552-58291574 TCAAAAACTTTTCCTGGGCTGGG - Intronic
955418211 3:58712335-58712357 TCACAATCTTCCCTTGGGCTAGG - Intergenic
955465296 3:59230584-59230606 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
955471513 3:59291220-59291242 AAAATATCATTTCTTAGGCTGGG + Intergenic
955498709 3:59562987-59563009 TAAAAACCTTCTAGTGGGCTTGG - Intergenic
956035755 3:65089618-65089640 GCAAAACCATTTCTTGGGCTTGG + Intergenic
956072950 3:65473973-65473995 AAAAAATCTTTTGTTGGGCATGG + Intronic
956786980 3:72650986-72651008 TCACAGTCTCTTCTTGGGCTGGG - Intergenic
957030539 3:75235820-75235842 AAAAAATGGTTTCATGGGCTGGG + Intergenic
957063688 3:75503522-75503544 TAAACTTATCTTCTTGGGCTAGG + Intergenic
957267242 3:77983013-77983035 AAAAAATAGTTTCCTGGGCTGGG - Intergenic
957417447 3:79924480-79924502 TAAATATGTATTTTTGGGCTGGG + Intergenic
957686720 3:83511783-83511805 CAAAAATAATTTCTTTGGCTAGG - Intergenic
957765773 3:84622022-84622044 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
957866487 3:86031026-86031048 TATAAATTTTTTCTTAGGGTGGG + Intronic
957870900 3:86089584-86089606 AAAAAATGGTTTCATGGGCTGGG - Intergenic
957987513 3:87590408-87590430 AAAAAATTGTTTCATGGGCTGGG - Intergenic
958006015 3:87812712-87812734 GAAAAATGGTTTCTTGGGCCTGG + Intergenic
958042564 3:88244556-88244578 AAAAAATGGTTTCATGGGCTGGG + Intergenic
958052440 3:88365612-88365634 TAAGGATCTTTTCTTGGGAAGGG - Intergenic
958545210 3:95539649-95539671 TGAAAATGATTTATTGGGCTGGG + Intergenic
958604328 3:96338796-96338818 AAAAAATGGTTTCTTGGGCCAGG + Intergenic
958754489 3:98234546-98234568 GAAAAATGGTTTCATGGGCTGGG + Intergenic
958767844 3:98392227-98392249 TAAAAATGTATTTCTGGGCTTGG + Intergenic
958910234 3:99985882-99985904 TAAAAAGCTTTTCTCAGGCCCGG - Intronic
958928064 3:100180131-100180153 AAAAAATGGTTTCGTGGGCTAGG - Intergenic
959142701 3:102505713-102505735 GAAAAATGATTTCCTGGGCTGGG + Intergenic
959212353 3:103402617-103402639 TAAATATATTTTCTCTGGCTAGG + Intergenic
959730048 3:109590815-109590837 AAAAAATGTTTTCATGGGCTAGG - Intergenic
959770504 3:110089888-110089910 TAACATTGTTTTCATGGGCTTGG - Intergenic
959818561 3:110704459-110704481 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
959851775 3:111096589-111096611 GAAAAATGGTTTCTTGGGCTGGG + Intronic
959901063 3:111662244-111662266 GAAAAATGGTTTCCTGGGCTAGG - Intronic
960031277 3:113057369-113057391 TGAAAATTATCTCTTGGGCTTGG - Intergenic
960255337 3:115505685-115505707 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
961029743 3:123591152-123591174 GAAAAATAGTTTCCTGGGCTAGG - Intergenic
961178883 3:124860469-124860491 GAAAAATCTTTCTTTGGGTTTGG + Intronic
961228506 3:125277525-125277547 TCAAAGTAATTTCTTGGGCTTGG + Intronic
961468442 3:127096197-127096219 AAAAAAACATTTCTTGGGCCAGG - Intergenic
961849347 3:129799513-129799535 TAAAAACATTTTCTGGGGCCGGG + Intronic
961852301 3:129833281-129833303 TAAAAATCCTATCTTAGGCCAGG + Intronic
961959889 3:130843865-130843887 TGAAAATATTTTCTTCGACTAGG + Intergenic
962267333 3:133953330-133953352 TAAAAATATTTCTATGGGCTGGG - Intronic
962440229 3:135406518-135406540 AAAAAGTGGTTTCTTGGGCTGGG - Intergenic
963148987 3:142024087-142024109 CAAAAATCTTTTAATGGGCTGGG - Intronic
963282439 3:143397954-143397976 CAAAAATATTTGCTTTGGCTGGG - Intronic
963478489 3:145836840-145836862 TCAAAATCCTCTCTTTGGCTGGG - Intergenic
963515825 3:146306696-146306718 AAAAAATTGTTTCTTGGGCTGGG - Intergenic
963625642 3:147669106-147669128 TGAAACTCTTTTCTTTGGTTTGG + Intergenic
964026469 3:152080212-152080234 GAAAAATGTTTTTTTGGGCAGGG - Intergenic
965203673 3:165693044-165693066 AAAAAATGGTTTCATGGGCTGGG - Intergenic
965281905 3:166765131-166765153 ACAAAATGTTTTCATGGGCTGGG - Intergenic
965328817 3:167343608-167343630 CAAACATCTTTTCATGTGCTTGG - Intronic
965531732 3:169777117-169777139 TAAAAATTGTCTTTTGGGCTGGG - Intronic
965747823 3:171943853-171943875 TAAAACTCTCTTCTCAGGCTGGG - Intergenic
965809722 3:172579184-172579206 TAAAAATGATTTATTGGGCCAGG + Intergenic
965989550 3:174800263-174800285 AAAAAATGGTTTCGTGGGCTGGG + Intronic
966097230 3:176218692-176218714 TACAAATCCTTGCTTGTGCTTGG - Intergenic
966340170 3:178916431-178916453 TGAAATTCTTTTCTTCTGCTTGG - Intergenic
966471659 3:180296264-180296286 TAACAATCTGTTCTTGGACTAGG + Intergenic
966488266 3:180496805-180496827 AAAAAATCTTTTCGTGTGTTGGG - Intergenic
966965616 3:184989558-184989580 TAAAAATCAATTAATGGGCTGGG - Intronic
967159124 3:186719443-186719465 TAGAAATGTTTGCTTGGGCCGGG + Intronic
967475104 3:189907524-189907546 AAAACATCTTTTCTTCCGCTGGG - Intergenic
967670197 3:192224498-192224520 GAAAAATCTGTTCTGGGACTAGG + Intronic
967764761 3:193266913-193266935 TAGAAATGTTTTCTTGGGAATGG + Intronic
967908275 3:194519948-194519970 AAAAAATGGTTTCTTGGGCCAGG + Intergenic
968116743 3:196096238-196096260 AAAAAATATTTTCAAGGGCTGGG - Intergenic
968590487 4:1456581-1456603 AAAAAATGGTTTCATGGGCTTGG - Intergenic
968682980 4:1934378-1934400 AAAAAATCTTTTCCTAGGCCGGG - Intronic
968999146 4:3965930-3965952 TAAAAATGTAAGCTTGGGCTGGG - Intergenic
970240340 4:14002527-14002549 AAAAAATGGTTTCGTGGGCTGGG + Intergenic
970302051 4:14691974-14691996 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
970382151 4:15518866-15518888 AAAAAATGTTTTCTTAGGCCAGG - Intronic
970462025 4:16284220-16284242 AAAAAATGGTTTCGTGGGCTAGG + Intergenic
970596385 4:17604099-17604121 TAAAAATTTCTTTTTGGGCCGGG - Intronic
970714248 4:18902561-18902583 TATAAATCTTATTTTGTGCTTGG - Intergenic
970773647 4:19646443-19646465 AAAAAATATTTTCTTGGTTTGGG + Intergenic
970973503 4:22014455-22014477 TAAAAATTCTTGCTGGGGCTGGG + Intergenic
971037463 4:22709751-22709773 TAAAAATATTTCCTTTTGCTTGG + Intergenic
971526691 4:27628642-27628664 TAAAAATATTTTATTTGGTTTGG + Intergenic
971598982 4:28568665-28568687 GAAAAATCATTTCATGGGCTGGG - Intergenic
971601333 4:28595748-28595770 AAAAAATGGTTTCATGGGCTGGG + Intergenic
971943643 4:33246173-33246195 GAAAAATGGTTTTTTGGGCTAGG - Intergenic
972000634 4:34028257-34028279 GAAAAATTTGGTCTTGGGCTGGG + Intergenic
972101941 4:35431382-35431404 AAAAAATGGTTTCATGGGCTGGG + Intergenic
972308657 4:37857439-37857461 TAACAAACTTTTCTTAGGCAAGG + Intronic
972348143 4:38211005-38211027 TAAAAATATGTTCCTAGGCTGGG + Intergenic
972395727 4:38658105-38658127 TAAAAATAATCACTTGGGCTGGG - Intergenic
972434349 4:39017472-39017494 TAAAAATACATACTTGGGCTGGG - Intronic
972469128 4:39386621-39386643 TAAAAATCATGTCCTCGGCTGGG - Intergenic
972486926 4:39550575-39550597 TAAAAATGTCTGCATGGGCTGGG - Exonic
972748835 4:41968754-41968776 TAAAAATGGTTTTGTGGGCTGGG + Intergenic
972809157 4:42563622-42563644 AGAAAATGTTTTCATGGGCTAGG + Intronic
972890705 4:43553368-43553390 GAAAAATGCTTTCCTGGGCTGGG + Intergenic
972945270 4:44246561-44246583 TTAAAAACTTTTCTTTGGCTCGG + Intronic
973962125 4:56121897-56121919 AAAAAACCTTTTGTTGGTCTAGG - Intergenic
974071402 4:57127526-57127548 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
974125645 4:57692823-57692845 AAAAAATAGTTTCTTGGGCTGGG + Intergenic
974388132 4:61229730-61229752 TAAAAATGTTTTGTAGAGCTAGG - Intronic
974517443 4:62936003-62936025 AAAAAATGGTTTCTTGGGCTGGG + Intergenic
974555862 4:63446379-63446401 AAAAAATGGTTTCATGGGCTGGG - Intergenic
974628497 4:64453841-64453863 AAAAAATGATTTCTTGGGCCAGG - Intergenic
974748114 4:66102659-66102681 AAAAAATGGTTTCTTGGTCTGGG + Intergenic
974924238 4:68277795-68277817 CAAAAAACGTTTCTTGGGCCAGG + Intergenic
975118081 4:70701266-70701288 AAAAAATCCTTTGGTGGGCTGGG - Intergenic
975144043 4:70947902-70947924 TAAAATTCTTCTCTGTGGCTGGG - Intronic
975257528 4:72255489-72255511 AAAAAATGGTTTCATGGGCTGGG + Intergenic
975361347 4:73475333-73475355 AAAAAATGGTTTCATGGGCTGGG - Intergenic
975578371 4:75885567-75885589 TAAAAATAATATCTTAGGCTGGG + Intronic
975639775 4:76488721-76488743 TAATACTTTTTTCCTGGGCTTGG - Intronic
975657889 4:76659875-76659897 TAAAAAAGTTTTCTCAGGCTGGG - Intronic
975785054 4:77878582-77878604 TAAAAATCTTATTTTAGGCCAGG + Intronic
976172390 4:82317889-82317911 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
976225287 4:82790942-82790964 TAAAAAATGATTCTTGGGCTGGG + Intronic
976283383 4:83347154-83347176 GAAAAATGGTTTCATGGGCTGGG - Intergenic
976607653 4:86997465-86997487 TAAAAATGCATACTTGGGCTGGG + Intronic
976625938 4:87181931-87181953 AAAAAATCAATTCTTGGGCCGGG + Intronic
976652360 4:87449657-87449679 TAAAAATACTACCTTGGGCTTGG - Intronic
976742961 4:88376087-88376109 TAAATAATTTATCTTGGGCTAGG - Intergenic
976952431 4:90849967-90849989 GAAAAATGGTTTCATGGGCTGGG + Intronic
977050099 4:92119118-92119140 AAAAAATGGTTTCTTGGGCCAGG + Intergenic
977657999 4:99545802-99545824 TAAAAATCTTATCTAAGCCTGGG + Intergenic
978226202 4:106338354-106338376 AAAAAATGGTTTCCTGGGCTGGG + Intronic
978265886 4:106823522-106823544 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
978548960 4:109903624-109903646 TAAAAATATTTTGTTGAGATGGG - Intergenic
978743705 4:112167150-112167172 TAATAATTTTTTCTTGGCCAAGG + Intronic
978912588 4:114082195-114082217 TAAAAATATTTTGTCGGGCCGGG + Intergenic
979065954 4:116133052-116133074 TAAAAATGTTTTTGTGGGCCAGG - Intergenic
979137472 4:117127829-117127851 GAAAAATTGTTTCATGGGCTGGG + Intergenic
979139236 4:117151443-117151465 AAAAAATGTTTTCATGGGCCAGG - Intergenic
979382248 4:120020516-120020538 TAAGAATGTAATCTTGGGCTGGG - Intergenic
979414264 4:120417221-120417243 AGAAAATGGTTTCTTGGGCTGGG + Intergenic
979588966 4:122455756-122455778 TAAAAATCTTTTCTTGTTTTAGG - Intronic
979936284 4:126700785-126700807 TCAAAATCTGTTCATGGGTTTGG - Intergenic
979947081 4:126845626-126845648 TAAAAATATTTTTTTAGGCCGGG + Intergenic
980518400 4:133896330-133896352 TATAAAACTTTTTTTGAGCTAGG + Intergenic
980586068 4:134817363-134817385 GAAAAATAGTTTCCTGGGCTAGG - Intergenic
980654098 4:135759584-135759606 AAAAAATGATTTCCTGGGCTGGG - Intergenic
981393306 4:144217248-144217270 TAAAAATGGTTTCATGGGCCAGG - Intergenic
981611481 4:146597855-146597877 AAAAAATGGTTTCCTGGGCTAGG - Intergenic
981799374 4:148637628-148637650 AAAAAATGTTTTCGTGGGCCAGG - Intergenic
981862870 4:149378894-149378916 CAAAAATGGTTTCATGGGCTGGG + Intergenic
983223237 4:165062825-165062847 GAAATATCTTTTTTTGGGCTGGG - Intergenic
983590515 4:169405806-169405828 TAAAAAAATTTTTTTTGGCTAGG + Intronic
983597014 4:169480871-169480893 GATAAATATTTTCATGGGCTGGG - Intronic
983863297 4:172734744-172734766 TAAAAATGGTTTCCTGGGCCAGG + Intronic
983874715 4:172862884-172862906 AAAAAATGGTTTCCTGGGCTGGG + Intronic
983889446 4:173015900-173015922 CAAAAATGGTTTCTTGGGCCAGG + Intronic
983921232 4:173347551-173347573 TTAAAATTATTTTTTGGGCTGGG - Intergenic
983921237 4:173347587-173347609 TTAAAATTATTTTTTGGGCTGGG - Intergenic
984139983 4:175993074-175993096 CAAAAATCTTTGCTTGACCTTGG + Intronic
984699841 4:182811832-182811854 TAAAAATGGTTTTGTGGGCTGGG - Intergenic
985583465 5:712612-712634 AAAAAATATTTTCTTTGGCCAGG + Intronic
985596980 5:796910-796932 AAAAAATATTTTCTTTGGCCAGG + Intronic
985737245 5:1591151-1591173 TAAAAATGTTTCATTGGGATAGG - Intergenic
986129116 5:4910629-4910651 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
986137866 5:4999461-4999483 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
986191306 5:5498524-5498546 CAAAAGACATTTCTTGGGCTGGG + Intergenic
986418412 5:7551225-7551247 TAAAAATCTTATTTGGGGTTGGG + Intronic
986533365 5:8761650-8761672 TAAAAATTGTTTCATGGGCTGGG + Intergenic
986577036 5:9222967-9222989 TACAAAGCTTTTATTGGGATAGG + Intronic
986623888 5:9705860-9705882 TAAAAGTCTTTTTTTGGGGGGGG - Intronic
986686108 5:10276411-10276433 TAAAATACTTCTCCTGGGCTGGG + Intronic
986911645 5:12565111-12565133 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
987003758 5:13688451-13688473 GAAAAATTGTTTCCTGGGCTGGG + Intergenic
987293765 5:16532229-16532251 TCAAAAAGTTTTCCTGGGCTGGG + Intronic
987315512 5:16719666-16719688 TAAAAATATTTATTTGGGCCAGG + Intronic
987332337 5:16868307-16868329 TAAAAATCTGCTCTTCAGCTGGG + Intronic
987381938 5:17293664-17293686 TAAAAATTATTTCTAGGGCTGGG + Intergenic
987613733 5:20244987-20245009 TAAAAATCTTATATTTGACTTGG + Intronic
987650427 5:20733409-20733431 GAAAAATTGTTTCTTGGGTTGGG - Intergenic
987690675 5:21262592-21262614 TTAAAATTTTGTCTTGGGCCAGG - Intergenic
987788526 5:22534020-22534042 TAAAAATTTTTTCATTGTCTTGG - Intronic
987794334 5:22607688-22607710 GAAAAATGGTTTCATGGGCTGGG + Intronic
987873717 5:23652372-23652394 TAAAAAGCATTTCTTGGGATTGG - Intergenic
988061426 5:26175448-26175470 GAAAAAGGGTTTCTTGGGCTGGG + Intergenic
988080633 5:26410614-26410636 AAAAAATGGTTTCCTGGGCTAGG + Intergenic
988134848 5:27157872-27157894 TAAAAATGGTTTCTTGGGCCAGG + Intergenic
988247418 5:28705016-28705038 TAAAAATTTTTTTTTAGCCTAGG + Intergenic
988362672 5:30255728-30255750 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
988366744 5:30310210-30310232 GAAAAATGGTTTCATGGGCTGGG + Intergenic
988391200 5:30634417-30634439 TAAAAATATTTTATTGTGGTAGG + Intergenic
988571356 5:32370220-32370242 AAAAAATCTGTTATTGTGCTGGG - Intronic
988600064 5:32631502-32631524 TAAATTTCTCTTCTAGGGCTTGG - Intergenic
988667438 5:33344837-33344859 TAAAAAGCTTTTATGGTGCTTGG - Intergenic
988679582 5:33471913-33471935 AAAAAATGTTTTCTTTGGCTGGG + Intergenic
988745122 5:34128047-34128069 GAAAAATTTTTTCTTGGGTTGGG + Intergenic
988898192 5:35701135-35701157 TAACATCCTTTTCTTGGACTGGG + Intronic
988911256 5:35845947-35845969 AAAAAATGGTTTCGTGGGCTGGG - Intergenic
988978779 5:36542965-36542987 TAAAAAGGTTTTATTTGGCTGGG + Intergenic
989198758 5:38742249-38742271 TAAAACTCTTTCCTTTGGCCAGG + Intergenic
989254453 5:39351232-39351254 TAAAAATGATTTCATGGACTAGG - Intronic
989501913 5:42177618-42177640 GAAAAATGATTTCTTGGGCCAGG - Intergenic
989536501 5:42570678-42570700 TCAAAATTCTTCCTTGGGCTGGG - Intronic
990078582 5:51883029-51883051 TAAAAATCTTTTCATGATCCAGG + Intergenic
990083366 5:51944661-51944683 AAAAAATGGTTTCATGGGCTAGG + Intergenic
990112939 5:52350474-52350496 TAAAAATTTTTGAGTGGGCTGGG + Intergenic
990213751 5:53508290-53508312 GAAAAATGGTTTCATGGGCTGGG - Intergenic
990372627 5:55136239-55136261 TAAAAATATTTTTTGGGGCTGGG - Intronic
990723931 5:58732276-58732298 TAAAAAAATTTTTTTGGCCTTGG - Intronic
991183809 5:63785121-63785143 AAAAAATGGTTTCGTGGGCTGGG + Intergenic
991613872 5:68476084-68476106 TAAAAAGCTTTTTATGGGCTGGG + Intergenic
991764257 5:69957951-69957973 GAAAAATGGTTTCATGGGCTGGG + Intergenic
991783070 5:70160196-70160218 GAAAAATGGTTTCATGGGCTGGG - Intergenic
991843489 5:70833023-70833045 GAAAAATGGTTTCATGGGCTGGG + Intergenic
991875512 5:71160523-71160545 GAAAAATGGTTTCATGGGCTGGG - Intergenic
991985800 5:72285500-72285522 TAATAATCTTTTTTTGGGAGGGG + Intronic
992030446 5:72716111-72716133 TAAACGTTTTCTCTTGGGCTCGG - Intergenic
992227777 5:74635485-74635507 CTAAACTCTTTTCTTGGGCTGGG + Exonic
992271680 5:75070795-75070817 TAAAAATTTTGTCTGGGGCTGGG + Intronic
992419142 5:76584165-76584187 TAAAAATATTTTTCTCGGCTGGG - Intronic
992474780 5:77090566-77090588 AAAAAATCTTCTCTTCGGCTGGG - Intergenic
992728484 5:79633856-79633878 ATAAAAACTTTTCTGGGGCTGGG + Intronic
992821801 5:80505147-80505169 TAAAACTCTTTGATTGGTCTTGG + Intronic
992997976 5:82350959-82350981 TAAACATCTATTCATGGTCTTGG + Intronic
993015700 5:82532269-82532291 AAAAAATGGTTTCGTGGGCTGGG - Intergenic
993200775 5:84812682-84812704 TAAAAATGGTTTCATTGGCTGGG + Intergenic
993638270 5:90371456-90371478 AAAAAATGGTTTCATGGGCTAGG - Intergenic
993645016 5:90451635-90451657 TAAAAAAATTTTTTTAGGCTGGG + Intergenic
993660692 5:90630292-90630314 TATAAAATTTTTCTTGGGCCAGG - Intronic
993736729 5:91486279-91486301 TGAAAATCTTTTGTTGGGAGAGG - Intergenic
993821797 5:92628631-92628653 TACATTTCTTTTCTTGTGCTCGG + Intergenic
993985783 5:94595479-94595501 AAAAAATGGTTTCGTGGGCTTGG - Intronic
994325715 5:98442638-98442660 GAAAAATGTTTTCATGGGTTGGG - Intergenic
994440833 5:99800778-99800800 CAAAAATATTTTTTTGGGCTGGG - Intergenic
994590727 5:101768860-101768882 AAAAAATGGTTTCTTGGGCCAGG + Intergenic
994853015 5:105080997-105081019 AAAAAATCTTTTCTTGGTGGGGG - Intergenic
995147287 5:108800749-108800771 AAAAAATCTTTGCCTGGGCCGGG + Intronic
995580562 5:113596695-113596717 TAAAAATACTTCCTTGGCCTAGG + Intergenic
995729955 5:115228029-115228051 TAAAAAAATTTTTTTGGCCTGGG - Intronic
996223291 5:120959490-120959512 TTTAAATCTCTTGTTGGGCTTGG + Intergenic
996553315 5:124752194-124752216 CAAAGATTATTTCTTGGGCTAGG + Intergenic
996856526 5:128014405-128014427 AAAAAATCTTTTTTTGGGAGTGG - Intergenic
996911346 5:128660484-128660506 AAAAAATGGTTTCCTGGGCTGGG + Intronic
997036872 5:130203047-130203069 AAAAAATGGTTTCATGGGCTGGG - Intergenic
997046923 5:130330092-130330114 GAAAAATGTTTTCATGGGCCAGG + Intergenic
997246560 5:132355070-132355092 GAAGAATCATTTCATGGGCTAGG + Intergenic
997247308 5:132360770-132360792 TAAAAAAATTTTTTTTGGCTGGG - Intergenic
997575214 5:134970452-134970474 TTAAAATCTTATAATGGGCTGGG - Intronic
997692826 5:135838565-135838587 AAAAAATGGTTTCCTGGGCTGGG + Intronic
998034361 5:138901583-138901605 TAAAAAATTTTTCATTGGCTGGG - Intronic
998400971 5:141849062-141849084 CAGACATCTTTTCCTGGGCTAGG + Intergenic
998414536 5:141936726-141936748 TAAAAAGCTATGCTTGGCCTGGG - Intronic
998812947 5:145984859-145984881 TAAAAATCTTGGCTTCAGCTGGG + Intronic
998822909 5:146072968-146072990 TTAAAGTATTTTCTTGTGCTAGG - Intronic
998926092 5:147127937-147127959 GAAAAATGGTTTCATGGGCTGGG - Intergenic
998945910 5:147339144-147339166 GAAAAATGGTTTCATGGGCTGGG + Intronic
999008070 5:148004577-148004599 TAAAAATCCATGGTTGGGCTTGG + Intergenic
999138398 5:149339485-149339507 TAAATAAGTTTTATTGGGCTAGG - Intronic
999174323 5:149621165-149621187 ACAAAATCTTTTCTAAGGCTGGG + Intronic
999308517 5:150536188-150536210 TAAAAATTTTTTTCTTGGCTGGG + Intronic
1000009530 5:157218332-157218354 TAAAAATTTTTTCTAGAGATGGG - Intronic
1000060285 5:157649492-157649514 TAAAAATAATTTTTTGGGCCAGG + Intronic
1000262025 5:159597312-159597334 AAGAAATCCTCTCTTGGGCTGGG + Intergenic
1000643354 5:163732126-163732148 AAAAAATGTTTATTTGGGCTGGG + Intergenic
1000768366 5:165319333-165319355 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1001507256 5:172289553-172289575 AAAAAATTTCTTTTTGGGCTGGG + Intergenic
1001525831 5:172428069-172428091 TAAAAAATTTTTCTTTGGCCAGG - Intronic
1002040428 5:176509770-176509792 TGAAACTCTTTGCTTGGCCTTGG - Exonic
1002047029 5:176547721-176547743 TAAAATACTTGTCTTGAGCTGGG - Intronic
1002980873 6:2136548-2136570 TAAAAATCTTTTGTAGAGATGGG - Intronic
1003226933 6:4214388-4214410 AAAAAATGGTTTCGTGGGCTGGG - Intergenic
1003574467 6:7279530-7279552 AAAGACTCTTATCTTGGGCTGGG + Intronic
1003690163 6:8346232-8346254 AAAATATGTTTTCCTGGGCTTGG + Intergenic
1004168582 6:13277775-13277797 TAAAAATGTTTTGTTGAGATGGG - Intronic
1004336400 6:14768407-14768429 TAAAAATCTCTTTGTTGGCTGGG - Intergenic
1004373514 6:15072929-15072951 TAAAAATGTTCTCAGGGGCTGGG - Intergenic
1004608520 6:17216646-17216668 TACAAATCTTTTTTTGCACTTGG - Intergenic
1004830880 6:19475520-19475542 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1004911336 6:20287925-20287947 TAAAAAATTTTTTTTGGGCCGGG - Intergenic
1004942520 6:20575060-20575082 TATAAATCCTTTCTTTTGCTGGG + Intronic
1004954916 6:20718928-20718950 TAAAAATCTATTATTGTGATGGG - Intronic
1005180156 6:23095552-23095574 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1005218076 6:23554840-23554862 AAAAAATATTTTTGTGGGCTGGG - Intergenic
1005543244 6:26835801-26835823 GAAAAATTGTTTCTTGGGTTGGG + Intergenic
1005571925 6:27153671-27153693 TAAAATTCATTTCTTAGGCCAGG + Intergenic
1005660347 6:27992103-27992125 AAAGAATCATTTCTTGGTCTTGG - Intergenic
1006121422 6:31808701-31808723 TAGAAATATTTTCTGGGGCTGGG + Intergenic
1006217039 6:32453372-32453394 AAAGAATGGTTTCTTGGGCTGGG + Intergenic
1006481457 6:34297888-34297910 CTTAAATCTTTTCTTGGGCCGGG - Intronic
1006490516 6:34383273-34383295 AGAAAATCTTTTCTTCGGCTTGG - Intronic
1007532275 6:42553646-42553668 TATAAATTTTATCTTGGGCTGGG - Intergenic
1007843719 6:44737344-44737366 TTAAAATTTTTTCTTAGGCCAGG - Intergenic
1008120403 6:47609379-47609401 TAAAAATCTAATCTGTGGCTGGG + Intronic
1008337523 6:50324894-50324916 GAAAAATTATTTCTTGGGCTGGG - Intergenic
1008495283 6:52126698-52126720 GAAAAATGTTTGCTTGGGGTTGG - Intergenic
1008810746 6:55494947-55494969 TTAAAATGTTTTCTTGAGGTTGG - Intronic
1009014071 6:57877966-57877988 GAAAAATTGTTTCTTGGGTTGGG + Intergenic
1009187056 6:60586999-60587021 TAAAAATGTCATCTTGGGCCAGG - Intergenic
1009351962 6:62691509-62691531 TAAAAATCTTTATAGGGGCTGGG + Intergenic
1009409743 6:63352366-63352388 TAAAAATGTTTTGTTTGGCCAGG + Intergenic
1009532839 6:64843050-64843072 AAAAAATGGTTTCATGGGCTGGG + Intronic
1009552943 6:65123137-65123159 TAAACATCCTTTCTTCGACTGGG + Intronic
1009904331 6:69849707-69849729 TTATAATCTTTACTAGGGCTGGG - Intergenic
1010005503 6:70991439-70991461 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1010136346 6:72558338-72558360 TAAATATATTTTCTTTGGCTTGG - Intergenic
1010140760 6:72611850-72611872 TAAAATTCATTCCTTTGGCTGGG + Intergenic
1010210390 6:73358394-73358416 TAAAAATTTTCTCCAGGGCTGGG - Intergenic
1010224652 6:73477800-73477822 TAAAAAGGTTGTTTTGGGCTAGG - Intronic
1010377745 6:75192636-75192658 TAAAAATCTTTCATTGGTTTTGG + Intronic
1010458239 6:76083105-76083127 GAAAAATGTTTTCCTGGGCTAGG - Intergenic
1010525385 6:76894557-76894579 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1010686933 6:78864219-78864241 TAAGAATTTTTTCTTAGGCCTGG - Intergenic
1010698300 6:79006413-79006435 TAAAATTCTTTTCTTTTGATTGG - Intronic
1010909581 6:81536772-81536794 GAAAAATGGTTTCTTGGGCCAGG - Intronic
1010924523 6:81727775-81727797 TTAAAATCTTTTCTAGCTCTAGG - Intronic
1011294122 6:85808434-85808456 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1011483960 6:87823079-87823101 TGAAAATATTTTCTTGGACCAGG - Intergenic
1011792684 6:90915430-90915452 AAAAAATAGTTTATTGGGCTGGG + Intergenic
1011845036 6:91552530-91552552 GAAAAATGGTTTATTGGGCTGGG - Intergenic
1012076332 6:94691280-94691302 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1012478245 6:99637819-99637841 TAAAAATGGTTTCATGGGCCAGG - Intergenic
1012711176 6:102607673-102607695 TAAAATTTTTTTCTTGCTCTTGG - Intergenic
1012780118 6:103546954-103546976 GAAAAATGTTTTCATGGGCTGGG - Intergenic
1012781758 6:103569005-103569027 TAACAATCTTTTCTTGAACCAGG + Intergenic
1012788215 6:103658635-103658657 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1012823820 6:104123478-104123500 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1012991786 6:105933659-105933681 TAAAAAGCCATTCTTTGGCTGGG - Intergenic
1013153472 6:107469946-107469968 TAAAAACTATTTCTTAGGCTGGG + Intergenic
1013244865 6:108276846-108276868 TAAAAAAATTTTTTTGGGCTGGG + Intergenic
1013338637 6:109191553-109191575 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
1014153131 6:118081795-118081817 TAAAAATGTAAACTTGGGCTGGG - Intronic
1014211464 6:118712667-118712689 AAAAGATCCTTTCCTGGGCTGGG - Intergenic
1014247505 6:119083201-119083223 AAAAAATGGTTTCGTGGGCTGGG - Intronic
1014491148 6:122063493-122063515 TAAAAGTGTTTATTTGGGCTGGG + Intergenic
1014581107 6:123138165-123138187 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1014995137 6:128133845-128133867 TTAAAATCTTTCTTTAGGCTAGG - Intronic
1015135157 6:129860950-129860972 TTAGAATCCTTTCTTGGGCATGG + Intronic
1015168082 6:130221147-130221169 TAAAGATCTTTTCACTGGCTGGG - Intronic
1015174318 6:130289793-130289815 TAAAAATCTTTTCTTGGGCTGGG - Intronic
1015178583 6:130338063-130338085 GAAAAATGGTTTCATGGGCTGGG + Intronic
1015713155 6:136163446-136163468 TAAAAATGGTTTCCTGGGCCAGG - Intronic
1015995736 6:138993981-138994003 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1016056413 6:139582229-139582251 TAAAAATATATTATTGGGCCAGG - Intergenic
1016219251 6:141646587-141646609 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1016295952 6:142573939-142573961 GAAAAATAGTTTCCTGGGCTGGG + Intergenic
1016490266 6:144592662-144592684 TCAAAAGCTTTTCATTGGCTGGG - Intronic
1016512924 6:144863801-144863823 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1016517260 6:144909046-144909068 TAAAAAGATTTTATTAGGCTGGG + Intergenic
1016900566 6:149096983-149097005 TTAAAATAGTGTCTTGGGCTTGG - Intergenic
1016953330 6:149602501-149602523 AAAAAAGCTTTTCTTGGATTTGG - Intronic
1017023945 6:150165331-150165353 TGAGTATCTTTTCTTGGACTGGG - Intronic
1017411131 6:154168899-154168921 TAAAATTCATATGTTGGGCTGGG - Intronic
1017508115 6:155087451-155087473 TGAAAATATTTTTTTCGGCTGGG + Intronic
1017672944 6:156784371-156784393 TAAATATCTTTTCTCTAGCTTGG + Intronic
1017966743 6:159273465-159273487 TAAAGATCTTATCTTTGGCTTGG - Intergenic
1018020254 6:159756283-159756305 TAAAAATCTTTATTTAGGTTTGG - Exonic
1018493432 6:164321593-164321615 GAAAAACCTTTCCTTGGCCTTGG - Intergenic
1018516144 6:164581775-164581797 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1019081587 6:169434970-169434992 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1019150911 6:170005035-170005057 GAAAAATGGTTTCCTGGGCTAGG - Intergenic
1019199345 6:170301377-170301399 GAAAAATGGTTTCTTGGGCAAGG - Intronic
1019496563 7:1343211-1343233 TAAACCTCTTTTCTTTGGCCAGG + Intergenic
1020346502 7:7170485-7170507 TAAACATCTTATGTTAGGCTGGG + Intronic
1020735132 7:11938818-11938840 AAAAAATATTTTGTTGGGCCGGG - Intergenic
1020855780 7:13420878-13420900 TAAAAATCCATTCTAGGTCTGGG + Intergenic
1021454772 7:20817969-20817991 TAAATTTCTTTGGTTGGGCTAGG - Intergenic
1021573341 7:22086266-22086288 GAAAAATCATTTCCTGGGCTGGG - Intergenic
1021730728 7:23592894-23592916 TAAAAAAAATTACTTGGGCTTGG + Intergenic
1021750541 7:23795161-23795183 AAAAAATGGTTTCATGGGCTGGG + Intronic
1021753995 7:23833595-23833617 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1021848098 7:24782039-24782061 TAAAAGTATGTTTTTGGGCTGGG - Intergenic
1022000718 7:26223443-26223465 TAAAAATCATTTTTTAGGCCAGG + Intergenic
1022691426 7:32659696-32659718 TGACAATTTTTTCTTGGGTTGGG - Intergenic
1022820938 7:33960403-33960425 TAAAAAAATTGTATTGGGCTGGG + Intronic
1022852795 7:34282420-34282442 GAAAAATCGTTTTGTGGGCTTGG - Intergenic
1022894354 7:34734595-34734617 AAATAATCTTTTCTTTGGTTGGG + Intronic
1023008304 7:35899709-35899731 TAAAAATTTTTTATAGGGATTGG - Intronic
1023060444 7:36321473-36321495 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1023257373 7:38325405-38325427 TTAAAATCTATGGTTGGGCTGGG - Intergenic
1023468136 7:40481330-40481352 TATATATCTTTTCTTGAGGTAGG - Intronic
1023785956 7:43707956-43707978 TAAAAAAATTTCCTTGGGCATGG + Intronic
1023841135 7:44098203-44098225 TAAAAACACTTTCTAGGGCTGGG - Intergenic
1023979162 7:45056584-45056606 TGAAAATCTTTTCTCATGCTTGG + Intronic
1024231198 7:47365149-47365171 TCAAAATGTGTTATTGGGCTGGG + Intronic
1024413798 7:49079169-49079191 GAAAAATTGTTTCCTGGGCTAGG - Intergenic
1024646076 7:51371466-51371488 TAAAAAATTTTTGTGGGGCTGGG - Intergenic
1024771662 7:52731141-52731163 TAAAAATAGTTTCTTGGGTCAGG + Intergenic
1025627592 7:63235174-63235196 TCAAAATCTTCTTTTAGGCTGGG + Intergenic
1025939484 7:66064112-66064134 TAAAAACATTTTCATTGGCTGGG - Intergenic
1025973487 7:66350308-66350330 TAAGAATCATTTGTTCGGCTGGG - Intronic
1026270456 7:68831903-68831925 TAAAAATCTATTCTTCTGTTTGG - Intergenic
1026478679 7:70760298-70760320 TAAAAATCTTTTTGTAGGCCGGG - Intronic
1027127319 7:75566007-75566029 AAAAGATCTTTACTTAGGCTGGG - Intronic
1027152969 7:75745894-75745916 TAGATATCTTTTTTTGGGCCCGG - Intergenic
1027206368 7:76103071-76103093 AAAAAATTTTTTTTTTGGCTAGG - Intergenic
1027332878 7:77117880-77117902 TAAAAATGGTTTCTTAGCCTTGG - Intergenic
1027346894 7:77269911-77269933 AAAAAATGTTCACTTGGGCTGGG - Intronic
1027404114 7:77841373-77841395 TAAAAATCATCTGTTTGGCTGGG - Intronic
1028099046 7:86797824-86797846 AAAAAATGATTTCCTGGGCTGGG + Intronic
1029256092 7:99270610-99270632 TAAAAAAATTTTTTTCGGCTGGG - Intergenic
1029327840 7:99824895-99824917 TTAAAATGCTTTCTTTGGCTAGG - Intergenic
1029362040 7:100094911-100094933 TAAAAATATTTTTGTGGGCCAGG + Intronic
1029473686 7:100770207-100770229 TAAAAATGTTTTAATAGGCTGGG + Intronic
1029572275 7:101378082-101378104 TAAAAATTTTTTGGGGGGCTGGG + Intronic
1029613310 7:101639651-101639673 CAAAAATATTTTCTTAGGCCGGG + Intergenic
1030233167 7:107229153-107229175 TGAAAATATCTTCTTCGGCTAGG + Intronic
1030527682 7:110673334-110673356 GAAAAATGGTTTCATGGGCTGGG - Intronic
1030635076 7:111939218-111939240 TTAAAATCTATTTATGGGCTGGG + Intronic
1030735508 7:113043270-113043292 TGAAAATAATTTATTGGGCTTGG + Intergenic
1030784783 7:113645902-113645924 AAAAAATAGTTTCATGGGCTAGG - Intergenic
1030786581 7:113670748-113670770 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
1031124712 7:117760080-117760102 TCAAAATTTGTTCTTGGGTTGGG - Intronic
1031284142 7:119843022-119843044 TAAAAATGGTTTCATGGGCTAGG + Intergenic
1031315411 7:120251879-120251901 TAAAAAGATTTTGTTGGACTGGG + Intergenic
1031573082 7:123383297-123383319 AAAAAATGATTTCATGGGCTGGG + Intergenic
1031601767 7:123718688-123718710 TAAAAATATTATATGGGGCTGGG - Intronic
1031803315 7:126276000-126276022 AAAAAATGGTTTCATGGGCTAGG - Intergenic
1031914152 7:127546528-127546550 AAAAAATGGTTTCATGGGCTAGG - Intergenic
1032208835 7:129893447-129893469 TAAAAATATTTTGTTGGGGATGG - Intronic
1032281223 7:130503511-130503533 AGAAAATATTTTCTTGGGCTGGG + Intronic
1032689102 7:134265033-134265055 TAAAGTTCCTTTCTTGGGGTTGG + Intergenic
1033072814 7:138220476-138220498 GAAAAATGGTTTCTTGGGCCAGG + Intergenic
1033173375 7:139103394-139103416 AAAAATTTTTTTCCTGGGCTGGG - Intronic
1033326825 7:140386358-140386380 TAAAACTATTTTCCTGGGCGAGG - Intronic
1033357856 7:140615160-140615182 TTAAAACCTTTTCATTGGCTAGG - Intronic
1033562656 7:142547343-142547365 TAAAAATAGGTTCTTGGGCTAGG + Intergenic
1033760023 7:144427731-144427753 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1034040777 7:147874554-147874576 GAAAAATGGTTTCATGGGCTGGG - Intronic
1034060037 7:148078774-148078796 CAAAAATCTATTCTCAGGCTGGG - Intronic
1034397381 7:150837505-150837527 TAAAAATATTTGCATGGGCCAGG + Intronic
1034648834 7:152673458-152673480 TAAGAATATTTTTTTAGGCTGGG - Intronic
1034742871 7:153494980-153495002 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1034751850 7:153576291-153576313 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1034827668 7:154281306-154281328 TAAAATTGTGTTCTTAGGCTGGG - Intronic
1035693670 8:1577271-1577293 TAAAAATTTTTTAAGGGGCTGGG + Intronic
1035767316 8:2117056-2117078 TAAAAATGTTTTTTGAGGCTGGG - Intronic
1036174403 8:6522981-6523003 AAAAAAACTTTTCAAGGGCTTGG - Intronic
1036446457 8:8825466-8825488 TAAATACCTGTTCTTAGGCTGGG - Intronic
1037108364 8:15137507-15137529 AAAAAATGGTTTCCTGGGCTGGG + Intronic
1037155739 8:15696167-15696189 CAAAAATAGTTTCGTGGGCTGGG + Intronic
1037194545 8:16172084-16172106 TAAAAATCTTTTTCTGGAGTTGG + Intronic
1037729827 8:21515070-21515092 GAGATATCTTTTCTGGGGCTGGG - Intergenic
1038293436 8:26270060-26270082 AAAAAATCAGTTCTTGGGCTGGG - Intergenic
1038715813 8:29990051-29990073 TAAAAATTTATTTTTGGTCTGGG - Intergenic
1038726579 8:30087402-30087424 AAAAAATCTTTTTTTGGGTCAGG - Intergenic
1038808266 8:30813874-30813896 TAAAAATCCTTACCTGGGCTGGG + Intronic
1039309191 8:36297523-36297545 GAAAAATGGTTTCCTGGGCTAGG + Intergenic
1039381526 8:37090229-37090251 TAAAAATCATGTTTTAGGCTGGG + Intergenic
1039623150 8:39019988-39020010 TCAAAATGTTTTCCTTGGCTGGG + Intronic
1039652106 8:39353368-39353390 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1039923862 8:41911642-41911664 TAACATTCTGTTGTTGGGCTGGG - Intergenic
1041434222 8:57819835-57819857 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1041595220 8:59642838-59642860 TAAAGATCTTTTTTTGGACTGGG - Intergenic
1041894432 8:62907549-62907571 AAAAAATGGTTTCATGGGCTGGG + Intronic
1041940429 8:63381695-63381717 GAAAAATGGTTTCTTTGGCTAGG + Intergenic
1042112722 8:65397937-65397959 TAAAAGTCTTGTCTTTGGGTAGG + Intergenic
1042131475 8:65590729-65590751 AAAAAATCTTTTCATAGGCTGGG - Intergenic
1042167282 8:65958170-65958192 TAAAAATGTTTTCTTAGGCTGGG - Intergenic
1042181101 8:66088316-66088338 AAAAAATGGTTTCTTGGGCCAGG - Intronic
1042222155 8:66484380-66484402 TAAAAAGGTGATCTTGGGCTGGG - Intronic
1042359650 8:67868115-67868137 TAAAAATCTTATCCTTGGCCGGG - Intergenic
1042508851 8:69590458-69590480 TAAAAATATTTTATAAGGCTGGG - Intronic
1042537523 8:69873580-69873602 TTAAAAGCTTTTTTTGGGCCAGG - Intergenic
1042550288 8:69988424-69988446 TAAAAATCATTTTTATGGCTGGG - Intergenic
1042982145 8:74541254-74541276 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
1043141143 8:76591860-76591882 TAGAAAGCCATTCTTGGGCTGGG - Intergenic
1043203614 8:77407020-77407042 TAAAAATCTATTTCTTGGCTGGG + Intergenic
1043389537 8:79779120-79779142 TAAAAATATGTTCATAGGCTGGG + Intergenic
1043455713 8:80409917-80409939 TCAACATGTTTTCTTGAGCTAGG - Intergenic
1043795212 8:84528469-84528491 TAAAAATCATTTTGTGAGCTTGG - Intronic
1043805935 8:84671743-84671765 AAAAAATGGTTTCGTGGGCTGGG - Intronic
1044066601 8:87706469-87706491 AAAAAATGTTTTCGTGGGCTGGG - Intergenic
1044127049 8:88471770-88471792 GAAAAATGGTTTCGTGGGCTGGG - Intergenic
1044161570 8:88923467-88923489 TAAAAATTATTTCTTAGGCTGGG - Intergenic
1044585295 8:93864054-93864076 TAAAAATTTTTTGTAGGGATGGG + Intronic
1044650928 8:94494294-94494316 AAAAAATTTTTTTTTTGGCTGGG + Intronic
1044679448 8:94762726-94762748 TAAAAATTTTTTGTAGGGATAGG - Intronic
1045207376 8:100056498-100056520 AAAAAATGTTTTTGTGGGCTGGG + Intronic
1045468570 8:102490975-102490997 TAAATTTCTTTTTTTAGGCTCGG + Intergenic
1045768312 8:105703749-105703771 TAAAAATCATTTCTTTGCATAGG + Intronic
1046102023 8:109625714-109625736 TAAAAATCCTATGTTTGGCTGGG - Intronic
1046175592 8:110571193-110571215 AAAAAATAGTTTCATGGGCTGGG - Intergenic
1046307382 8:112386790-112386812 TTAAAATCTTTAGTTGGGCCGGG - Intronic
1046689619 8:117267894-117267916 AAAAAATTGTTTCATGGGCTGGG - Intergenic
1046937439 8:119898425-119898447 TAAAAGCCTTGTATTGGGCTGGG + Intronic
1046960281 8:120104402-120104424 TAAAAATATTGTTTTGGGTTGGG - Intronic
1047060501 8:121219565-121219587 GAAAAATGTTTTTTTGGGCTGGG - Intergenic
1047490451 8:125370017-125370039 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1047597727 8:126395517-126395539 TATAAATCTATTCCTGGCCTTGG + Intergenic
1047869909 8:129071309-129071331 AAAAAATGGTTTCTTGGGCTTGG + Intergenic
1048089292 8:131221350-131221372 TAAAATGCTTGTCTAGGGCTTGG + Intergenic
1048189292 8:132273445-132273467 AAAAAATGGTTTCATGGGCTGGG - Intronic
1048729225 8:137419011-137419033 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1049565805 8:143338270-143338292 AAAAAATTTTTTTTTTGGCTGGG + Intronic
1049993760 9:1015399-1015421 TTAAAATATTTTCTGGGGCTGGG + Intergenic
1050142734 9:2533239-2533261 TAAAAATATTGTATAGGGCTGGG - Intergenic
1050247891 9:3710427-3710449 TAAAAATCTTATAATAGGCTGGG - Intergenic
1050255405 9:3787819-3787841 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1050559229 9:6817498-6817520 TATAAATATTTTGCTGGGCTGGG - Intronic
1050773646 9:9234356-9234378 AAAAAATGGTTTCATGGGCTGGG - Intronic
1050915966 9:11133044-11133066 AAAAATTATTTTCTTAGGCTGGG + Intergenic
1050938231 9:11425214-11425236 GAAAAATCGTTTCCAGGGCTGGG - Intergenic
1051128684 9:13835035-13835057 AAATAATGATTTCTTGGGCTAGG + Intergenic
1051967407 9:22845411-22845433 AAAAAATGTTTTCGTGAGCTGGG - Intergenic
1051990425 9:23145716-23145738 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1052008838 9:23382623-23382645 AAAAAATTGTTTCATGGGCTGGG + Intergenic
1052079107 9:24180762-24180784 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
1052594088 9:30536694-30536716 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1052921869 9:33977330-33977352 TAAAAATTTTTTGTTTGGCTGGG - Intronic
1053125827 9:35580264-35580286 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1053701230 9:40692894-40692916 TAAAAATATTCCCTTTGGCTGGG + Intergenic
1054411295 9:64816350-64816372 TAAAAATATTCCCTTTGGCTGGG + Intergenic
1054843201 9:69764475-69764497 TAAAAAACTTTTCTTAGGCCAGG - Intergenic
1054915254 9:70489744-70489766 TAAAAATCTTGACTTTGGCTTGG + Intergenic
1054928106 9:70608538-70608560 CAAAAATATTATCTCGGGCTGGG + Intronic
1055027304 9:71735919-71735941 TAAAAATATTTTCTAGAGATGGG - Intronic
1055043514 9:71900852-71900874 AAAAAATGTTTGCATGGGCTGGG + Intronic
1055046721 9:71934046-71934068 TAAAAACCATTACCTGGGCTGGG + Intronic
1055085913 9:72314190-72314212 TAAAAATCTGTTTATAGGCTAGG + Intergenic
1055107984 9:72532243-72532265 TAAAAATGCTTTACTGGGCTGGG + Intronic
1055499899 9:76892921-76892943 TAAAAATCTGTGATTAGGCTGGG + Intronic
1055635371 9:78272319-78272341 TAAACATCTTTCATGGGGCTGGG - Intronic
1055790862 9:79921724-79921746 TAAAATGCTTTGCTTAGGCTAGG + Intergenic
1055826790 9:80336733-80336755 TCAAAATCTTTTCTATGCCTTGG + Intergenic
1055852270 9:80645851-80645873 TAAAAACCTATTATAGGGCTGGG - Intergenic
1055965926 9:81864807-81864829 TAAAAATCTATTTTGGGGGTTGG - Intergenic
1056012429 9:82346218-82346240 AAAAAATGGTTTCGTGGGCTGGG + Intergenic
1056021244 9:82440609-82440631 GAAAAATGATTTCATGGGCTAGG + Intergenic
1056325493 9:85475088-85475110 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1056380936 9:86056797-86056819 TAAAAAATTTTTTTTTGGCTGGG - Intronic
1057519442 9:95749903-95749925 AAAAAACCTTTTCTTGGTCTCGG - Intergenic
1057525828 9:95799999-95800021 TGAAAATCTTTTCACGTGCTTGG - Intergenic
1057541646 9:95978753-95978775 AAAAAATATTTTCTTGTGTTTGG + Intronic
1057763949 9:97899567-97899589 TAGAAATATTTTTTTAGGCTGGG - Intergenic
1057922725 9:99111331-99111353 TAAAAAACCATTCTTGGGCTGGG + Intronic
1058047886 9:100376457-100376479 TAAATATCAATTCTTGAGCTGGG - Intergenic
1058086502 9:100753422-100753444 AAAAAATAGTTTCATGGGCTGGG - Intergenic
1058101758 9:100924772-100924794 GAAAAATGGTTTCTTGGGCTGGG + Intergenic
1058240164 9:102548118-102548140 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1058292261 9:103257109-103257131 TAAAAATGGTTTCTTGGGCCAGG - Intergenic
1058631607 9:106993903-106993925 TAAAGATGTTGTCTTAGGCTGGG - Intronic
1058727995 9:107821880-107821902 TGAAATTCTTTTCTTTGACTGGG + Intergenic
1059141479 9:111857127-111857149 CAAAAATCTTTTCCTGTTCTTGG + Intergenic
1059601379 9:115783139-115783161 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1059821025 9:117972207-117972229 TTAAAATTTATTTTTGGGCTGGG - Intergenic
1059862325 9:118478605-118478627 TAAAAATCTCTTTCTGGGCTGGG - Intergenic
1060308130 9:122434847-122434869 CAAAAATGATTTCGTGGGCTGGG + Intergenic
1061085537 9:128396069-128396091 TAAAAATCTTTATTTTGGCCAGG - Intergenic
1061131060 9:128708083-128708105 AAAAAAGGTTTTCTTGGGCCAGG + Intronic
1061611461 9:131749424-131749446 TAAAAAGTTTTTTTGGGGCTGGG + Intergenic
1061765939 9:132881468-132881490 TAAAAAACGTTTTTGGGGCTGGG + Intronic
1185718331 X:2361398-2361420 TTAAAAACTTTTATTGAGCTGGG - Intronic
1185923690 X:4123135-4123157 TTAAAATCTTTTTTTGAGATGGG + Intergenic
1187215485 X:17271779-17271801 TAAAAATGTTATATTGGGCCAGG + Intergenic
1187429378 X:19208132-19208154 TAAAAATATATTATTGGGTTTGG + Intergenic
1187703856 X:21990137-21990159 TAAAAAGCTTTTCTTAGGCCAGG + Intronic
1187862194 X:23693370-23693392 TTAAAATATATTTTTGGGCTGGG - Intergenic
1188056079 X:25542282-25542304 GAAAAATAGTTTCTTGAGCTGGG - Intergenic
1188169878 X:26911546-26911568 GAAAAATATTTTCTTGGGTCAGG + Intergenic
1188175348 X:26982498-26982520 TAAAAATCATTTTTTGGGATTGG - Intergenic
1188208420 X:27388630-27388652 TAAAAACCTTTTATATGGCTGGG - Intergenic
1188305803 X:28558640-28558662 TAAAAATGGTTTCCTGGGCTGGG - Intergenic
1188378183 X:29458847-29458869 TAAAAAAGTTTTCTGAGGCTGGG - Intronic
1188412759 X:29894776-29894798 AAAAAATATTTTCATGGGGTGGG + Intronic
1188471785 X:30548823-30548845 TGAAATTCTATTTTTGGGCTTGG + Intergenic
1188580724 X:31709508-31709530 TAAAAATTTTTTCTTTATCTGGG + Intronic
1188857048 X:35209347-35209369 AAAAAATGTTTTCATGGGCAGGG - Intergenic
1188975669 X:36671798-36671820 TAACAGTATTTTCTTTGGCTGGG + Intergenic
1189044203 X:37573080-37573102 TAAAAATATTTGCTTAGGATGGG + Intronic
1189176597 X:38963670-38963692 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1189412541 X:40785989-40786011 TAAAAAGTGTTTCTTGGGCTGGG + Intergenic
1189987943 X:46570629-46570651 AAAAAATTTTTTTTTAGGCTGGG - Intergenic
1190018394 X:46849418-46849440 TAAAAAACTTTTTTAGAGCTAGG + Intronic
1190103317 X:47539804-47539826 TAAAAATATTTTCCCTGGCTGGG - Intergenic
1190186437 X:48238616-48238638 AAAAAATCCTTTCTTTTGCTGGG + Intronic
1190269705 X:48853070-48853092 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1190624928 X:52327916-52327938 TAAAAATATTTTCCTGGCCGGGG - Intergenic
1190733297 X:53238671-53238693 GAAAAATTATTTCATGGGCTAGG - Intronic
1190754071 X:53385568-53385590 TAAAAATCTATCCTGGGGCCGGG - Intronic
1191673331 X:63769608-63769630 AAAAAATTGTTTCTTGGGCCGGG + Intronic
1192475728 X:71440796-71440818 TAAAAACATTTTCTTGCTCTCGG + Intronic
1192670468 X:73135064-73135086 TATAAAACTTTTTATGGGCTAGG - Intergenic
1192739574 X:73879942-73879964 TTAAGATTTTTTCTTGGGCTGGG - Intergenic
1192920067 X:75696918-75696940 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1193183318 X:78483677-78483699 AAAAAATGGTTTCATGGGCTGGG - Intergenic
1193498361 X:82240696-82240718 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1194328930 X:92557100-92557122 GAAAAATGGTTTCATGGGCTGGG - Intronic
1194365292 X:93006725-93006747 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
1194560285 X:95411650-95411672 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1194756273 X:97743159-97743181 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1194952610 X:100145015-100145037 AAAAAATTATTTCCTGGGCTGGG + Intergenic
1195064526 X:101228611-101228633 TAAAAATCATGTTTTAGGCTGGG + Intronic
1195228078 X:102818460-102818482 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
1195428618 X:104762860-104762882 AAAAAATGGTTTCCTGGGCTAGG - Intronic
1195718136 X:107838809-107838831 AACAATGCTTTTCTTGGGCTTGG + Intronic
1195874932 X:109530009-109530031 TAAAAATCTATTCTTGGGGCTGG - Intergenic
1196099075 X:111829527-111829549 GAAAAATGGTTTCCTGGGCTAGG + Intronic
1196136929 X:112220413-112220435 GAAAAATGGTTTCATGGGCTGGG - Intergenic
1196246258 X:113403818-113403840 GAAAAATGTTTTCCTGGGCCAGG + Intergenic
1196390678 X:115204241-115204263 GAAAAATGGTTTCATGGGCTGGG - Intronic
1196437210 X:115685586-115685608 AAAAAATGTCTTCTTGTGCTGGG + Intergenic
1196503304 X:116411072-116411094 AAAAAATAATTTCCTGGGCTGGG + Intergenic
1196524732 X:116719024-116719046 AAAAAATGTTTTTTTGGGCCAGG - Intergenic
1196930452 X:120676319-120676341 GAAAAATGGTTTCATGGGCTGGG - Intergenic
1196936350 X:120734766-120734788 GAAAGAACTTTTCCTGGGCTCGG + Intergenic
1197088700 X:122510492-122510514 AAAAAATGGTTTCTTGGGCCAGG - Intergenic
1197128222 X:122972785-122972807 AAAAAATGTTTTCCTGGGCCAGG + Intergenic
1197349825 X:125370077-125370099 GAAAAATGGTTTCCTGGGCTGGG - Intergenic
1197437713 X:126452856-126452878 GAAAAATAGTTTCATGGGCTGGG + Intergenic
1197501617 X:127249302-127249324 TAAAAATATTTTCATGAACTGGG - Intergenic
1197580994 X:128283482-128283504 TAAAAATATTTTTTTAGGCTGGG - Intergenic
1197690926 X:129500459-129500481 TAAAAATCTTGTTGTGGGCTGGG - Intronic
1198095748 X:133378179-133378201 TAAAAACCATTGCATGGGCTGGG - Intronic
1198153684 X:133935916-133935938 TAACAATCTTTTCTTGAGACGGG + Intronic
1198163920 X:134034632-134034654 GAAATTTCTTTTCCTGGGCTGGG - Intergenic
1198693268 X:139307477-139307499 GAAAAATCATTTCCTGGGCTGGG + Intergenic
1198804815 X:140483789-140483811 TAAAAATGCTTTTTTGGGCCAGG + Intergenic
1198941956 X:141965878-141965900 GAAAAATGGTTTCATGGGCTGGG + Intergenic
1199083676 X:143605760-143605782 GAAAAATGGTTTCCTGGGCTGGG + Intergenic
1199127382 X:144139005-144139027 GAAAAATGGTTTCTTGGGCCAGG - Intergenic
1199157883 X:144571848-144571870 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1199346531 X:146747125-146747147 TAAAAATGGTTTCCTGGGCCAGG - Intergenic
1199357139 X:146875608-146875630 GAAAAATTGTTTCCTGGGCTGGG + Intergenic
1199400683 X:147395277-147395299 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
1199472488 X:148210320-148210342 AAAAAATGGTTTCCTGGGCTGGG + Intergenic
1199569410 X:149252567-149252589 AAAAAATAGTTTCTTGGGGTGGG - Intergenic
1199661582 X:150055509-150055531 TATAAATATTCTCTAGGGCTTGG + Intergenic
1199776154 X:151013561-151013583 GAAAAATGATTTCCTGGGCTGGG - Intergenic
1199986010 X:152951249-152951271 TAACAAAATTTTCTTAGGCTAGG - Intronic
1200326864 X:155249734-155249756 TAAAAATCTGTTCTTTTGCCAGG + Intergenic
1200342081 X:155408611-155408633 AAAAAATGTTTTCATGGGCTGGG + Intergenic
1200637636 Y:5676302-5676324 GAAAAATGGTTTCATGGGCTGGG - Intronic
1200673512 Y:6122983-6123005 AAAAAATGGTTTCCTGGGCTGGG - Intergenic
1201982886 Y:19926661-19926683 CAAAAATCTGTTTTTGGGCCCGG + Intergenic
1202030872 Y:20572786-20572808 GAAAAATAGTTTTTTGGGCTGGG - Intergenic
1202282986 Y:23209665-23209687 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1202434660 Y:24824050-24824072 AAAAAATGGTTTCATGGGCTGGG + Intergenic
1202589319 Y:26465838-26465860 TAAAAATCTGTCCATGGGCAGGG - Intergenic