ID: 1015174319

View in Genome Browser
Species Human (GRCh38)
Location 6:130289794-130289816
Sequence TTAAAAATCTTTTCTTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1686
Summary {0: 1, 1: 2, 2: 29, 3: 218, 4: 1436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174319_1015174322 0 Left 1015174319 6:130289794-130289816 CCAGCCCAAGAAAAGATTTTTAA 0: 1
1: 2
2: 29
3: 218
4: 1436
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data
1015174319_1015174325 10 Left 1015174319 6:130289794-130289816 CCAGCCCAAGAAAAGATTTTTAA 0: 1
1: 2
2: 29
3: 218
4: 1436
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166
1015174319_1015174324 4 Left 1015174319 6:130289794-130289816 CCAGCCCAAGAAAAGATTTTTAA 0: 1
1: 2
2: 29
3: 218
4: 1436
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174319 Original CRISPR TTAAAAATCTTTTCTTGGGC TGG (reversed) Intronic
900268632 1:1774810-1774832 TTAAAAAACCTTTGTAGGGCGGG + Intronic
900321001 1:2083934-2083956 TTAAAAATCGTATGTTGGCCGGG + Intronic
901145106 1:7059445-7059467 TTAAAAATCTTTTGTAGAGATGG - Intronic
901346705 1:8550841-8550863 TTAAAAATCCTTTAGTGGCCGGG - Intronic
901452400 1:9344081-9344103 TTTAAAAACTTATCTTGGCCAGG - Intronic
901593624 1:10367386-10367408 TTAAAAAACTTTTATCTGGCTGG - Intronic
901708668 1:11096647-11096669 TTAAAAATTTTTTGTAGGGATGG + Intronic
901832377 1:11900381-11900403 TTAAAATACTTTTGTTAGGCTGG + Intergenic
902061524 1:13647562-13647584 TTAAAAACATTTTATTGGCCAGG + Intergenic
902061713 1:13649315-13649337 TTAAAAATCATCTTTTTGGCCGG - Intergenic
902890934 1:19443089-19443111 TTAAAAATCCATTCCTGGCCAGG + Intronic
902956108 1:19924950-19924972 TTAAAAACCTTTTATCGGCCGGG + Intergenic
903106051 1:21081134-21081156 TTAAAAATATGTACTTGGGCTGG + Intronic
903109087 1:21113717-21113739 TCAAAAATCTTATCTGGGCCAGG + Intronic
903422811 1:23230825-23230847 TTTAAAAGCATTTTTTGGGCCGG - Intergenic
903601280 1:24542628-24542650 TTAAAAATTTTGTTTTTGGCCGG - Intergenic
903617365 1:24670437-24670459 TTATACATCTGATCTTGGGCAGG + Intronic
903822792 1:26115899-26115921 TTAAAAGTCTGCTTTTGGGCTGG + Intronic
904022587 1:27478988-27479010 TTAAAAATCTTGGTTAGGGCCGG + Intronic
904026985 1:27510203-27510225 TCAGAAATCTTTGCTTAGGCCGG + Intergenic
904099679 1:28014119-28014141 TTAAAAATAGTTTCCTGGCCGGG + Intronic
904578466 1:31521970-31521992 TTGAAAATCTTTCAATGGGCCGG - Intergenic
904661048 1:32085454-32085476 TTAAAAATCTCTTATTTGGCTGG + Intronic
904665339 1:32116361-32116383 TTCAAGATCTTTTCCTGGCCAGG + Intronic
905164946 1:36075000-36075022 TTAAAATATCTTTCTTGGGCTGG + Intergenic
905229958 1:36508767-36508789 TGAAAAATGTTTTCTTGGGATGG + Intergenic
905407510 1:37745265-37745287 TTGAACATCTTTTCCTGTGCAGG - Intronic
905523694 1:38620284-38620306 TTAAAATTCAGTTCCTGGGCCGG + Intergenic
905705642 1:40054950-40054972 TTTAAAATCATTTATTTGGCCGG - Intronic
905752207 1:40476046-40476068 AAAATAATATTTTCTTGGGCTGG - Intergenic
905926881 1:41757411-41757433 AAAAAAATATTTTTTTGGGCCGG - Intronic
906007900 1:42493915-42493937 TTAAAAACCTTCCCATGGGCTGG + Intronic
906030911 1:42719410-42719432 TAAAAAAATTTTTTTTGGGCCGG + Intergenic
906081699 1:43094288-43094310 TGAAAATTCTTTTCTTGGGCCGG - Intergenic
906397060 1:45475503-45475525 ATAAAAATATTCTCTTGGCCGGG - Intronic
906414474 1:45609902-45609924 TTAGAAATTTTGTCGTGGGCTGG + Intronic
906435749 1:45795144-45795166 TTAAAAATTTTTTTTTTGGCTGG + Intronic
906435832 1:45795754-45795776 TTAAAAAAATTTTTTTAGGCCGG - Intronic
906441240 1:45847398-45847420 TTGAATATCTTTTTTTGGGGGGG + Intronic
906493179 1:46283957-46283979 TAAAAAATGTTTTCTTGGCCGGG - Intronic
906503505 1:46359772-46359794 TTAAAAAATTTTTTTTGTGCAGG + Intronic
906623568 1:47306025-47306047 TTAAAAAATATTTTTTGGGCCGG - Intronic
906628244 1:47343300-47343322 TAAAAAATATTTTCCTGGCCGGG + Intronic
906753007 1:48283383-48283405 TGAAAATTCTTTTCTTGGCTGGG + Intergenic
906976316 1:50576961-50576983 TTTAAAATCTGTTTTTAGGCTGG - Intronic
906976698 1:50582028-50582050 TTTAAAACCTTTTTTTGGGGGGG + Intronic
907087023 1:51684827-51684849 TAAAAACTGTTTTCTTGGCCAGG - Intronic
907128441 1:52073555-52073577 TTAGAATTCTTTTTTTTGGCAGG + Intronic
907346875 1:53789517-53789539 TTAAAAAACTTGGCTGGGGCTGG + Intronic
907392043 1:54164485-54164507 TTAAACCTCTTTTTTTGGCCGGG - Intronic
907591752 1:55680504-55680526 TTATAAATCTTTTGTTGGATAGG + Intergenic
907613145 1:55893395-55893417 TTAAAAATACTTTGTTGGCCAGG + Intergenic
907853280 1:58277334-58277356 TTAAAAGTCTTTGCATCGGCTGG - Intronic
907964392 1:59315205-59315227 TTAATAGACTTTTCTGGGGCAGG + Intronic
908081335 1:60582145-60582167 CTAAAAATCTTTTTCTGGCCGGG + Intergenic
908276548 1:62478707-62478729 ATAAAAATTTTTTACTGGGCTGG - Intronic
908347807 1:63253298-63253320 TTAAAAACCTAATCTTGGCCGGG + Intergenic
909080263 1:71102288-71102310 TTCACAATTTTGTCTTGGGCAGG + Intergenic
909357531 1:74726502-74726524 TAAAAAATGGTTTCCTGGGCCGG - Intronic
909375884 1:74941591-74941613 CATAAAATCTTTTCTTGGCCTGG + Intergenic
909568461 1:77081552-77081574 TTAAAAATATTTTGCTGGCCAGG - Intergenic
909619305 1:77649585-77649607 ATAAAAAACTTTTCCTGGCCGGG + Intronic
909627124 1:77729938-77729960 TTAAAAATGTTTTCTTGCTCAGG - Exonic
909916335 1:81324205-81324227 TTAAAAATATTTTTTAGGGCTGG + Intronic
910000799 1:82340154-82340176 TTAAAAAGCATTTCCTGGGGTGG + Intergenic
910217786 1:84859971-84859993 TTCAAAACCCTTTCTTAGGCAGG + Intronic
910260083 1:85285571-85285593 TTAATATTCTTTTCTGAGGCTGG - Intergenic
910321103 1:85945312-85945334 TTAAGAATCTCTTCTCGGCCGGG - Intronic
910697453 1:90035773-90035795 TTTAAAACCTTATCTTTGGCCGG + Intergenic
911076182 1:93877989-93878011 TTAAAAATCATGAGTTGGGCAGG - Intronic
911193821 1:94973863-94973885 TTAAAAAAGTTCTCTTGGGCTGG + Intergenic
911608253 1:99932571-99932593 TTAAAAAAGCTTTATTGGGCCGG - Intergenic
912228236 1:107761092-107761114 TGAAAATTATTTTCTTGGCCGGG + Intronic
912438360 1:109678448-109678470 TTAAAAATCTGTATATGGGCTGG + Intronic
912473148 1:109919522-109919544 TTAAAAATGTTTTCCTGGCCAGG - Intronic
912535693 1:110368121-110368143 TTAAAAATATTTACTTGGCTGGG - Intronic
912755258 1:112319238-112319260 TTAAAAATGTTGTCTTGTTCTGG + Intergenic
912772211 1:112474441-112474463 TTAAAAGTGTTCTCTTGGCCAGG - Intronic
912788220 1:112624798-112624820 TTAATTAAATTTTCTTGGGCTGG - Intronic
912789269 1:112635716-112635738 TTAAAATTATTTCCTTGGGCCGG - Intronic
912833799 1:112977665-112977687 TTAAAAATATTTTATTGGCTGGG + Intergenic
912897349 1:113606261-113606283 TTAAAAATTATTTCTTGGGCTGG - Intronic
912916694 1:113822663-113822685 TTAAAAAGGGTTTCTTGGGCCGG + Intronic
913444328 1:118933795-118933817 TTAAAAATCTTTTTCTGAGGAGG - Intronic
913654774 1:120950268-120950290 TAAAAAATCTTTTTTTGATCAGG + Intergenic
914213416 1:145602773-145602795 TTAGAAATATTTTATGGGGCTGG - Intergenic
914321191 1:146562104-146562126 TAAAAAATATATTCTTGGCCGGG + Intergenic
914732459 1:150383611-150383633 TTTAAAATCTCTTCTTTGGCTGG - Intronic
914749662 1:150526065-150526087 TAAAAAGTTTTTTTTTGGGCAGG + Intergenic
914978073 1:152385340-152385362 TTAAGAATTTTTGCATGGGCCGG + Intergenic
915231997 1:154452534-154452556 TTAAAAAACATTTGTTTGGCCGG + Intronic
915241840 1:154528519-154528541 TTAAAAAAATTTTTTTTGGCAGG - Intronic
915484004 1:156207473-156207495 TTAAAAATGTTTTGTAGTGCCGG - Intronic
915486831 1:156227206-156227228 TTAAAAATTTTTTTTTGGCCAGG + Intronic
915501570 1:156322494-156322516 TTAAAAAAATTTTTTTGGGGTGG - Intronic
915763160 1:158336060-158336082 TAAAAAATCTTATCTGGGCCAGG - Intergenic
915778390 1:158517451-158517473 TAAAAAACATATTCTTGGGCCGG + Intergenic
916040386 1:160956366-160956388 TAAAAACTCTTTTTTTGGGCTGG + Intergenic
916307844 1:163359579-163359601 TTAAAAATTGTTTGTTGGCCAGG + Intergenic
916926075 1:169521912-169521934 TTAAAAAAATCTTCTTGGCCGGG - Intronic
917246112 1:173003216-173003238 TTAAAGTCCTTTTCTTGGGCTGG + Intergenic
917877626 1:179300798-179300820 TTAAAATTGTTTTTTTGGCCGGG + Intronic
917881222 1:179337853-179337875 ATAAAAATCTTTCCTTGTTCTGG - Exonic
917892405 1:179452891-179452913 GTAAAAATGGTTTCGTGGGCTGG + Intronic
918168099 1:181969914-181969936 TTAAAAATACTTTCTCAGGCCGG - Intergenic
918330332 1:183454160-183454182 TTAAAAATTTTTTGTAGGGACGG - Intergenic
919006802 1:191909162-191909184 GGAAAAATGTTTTCATGGGCTGG - Intergenic
919066629 1:192699132-192699154 TTAAGAACCTTGTCTTTGGCTGG - Intergenic
919242695 1:194935698-194935720 TAAAAAGTTGTTTCTTGGGCTGG + Intergenic
919659335 1:200228701-200228723 TTAAAAATGGATTCATGGGCTGG + Intergenic
919673480 1:200358898-200358920 TTCAAAAGCTTTTATTGGCCAGG + Intergenic
919733374 1:200928752-200928774 TTTGAAAGGTTTTCTTGGGCAGG + Intergenic
919829399 1:201529891-201529913 TTAAAACTCTTTTCTCTGTCTGG - Intergenic
919949317 1:202348149-202348171 TTCAAGATCTTTTCTGGGCCTGG + Intergenic
920011331 1:202869842-202869864 TTGAAAATGGTTACTTGGGCTGG - Intergenic
920166481 1:204039819-204039841 TTAAACCTCTCTTCTTTGGCCGG + Intergenic
920238305 1:204524480-204524502 TTAAAAATCTATTTTCCGGCTGG + Intronic
920337489 1:205254913-205254935 TTTAAAATGTTAGCTTGGGCTGG + Intronic
920805323 1:209228439-209228461 TTTAAAATTTTCCCTTGGGCTGG + Intergenic
921057541 1:211555097-211555119 TTAAAAAAATTTTTTTTGGCCGG - Intergenic
921083439 1:211763873-211763895 TTAAAAATTCCTTCTTGGGCTGG + Intronic
921144186 1:212336409-212336431 TCAAAAATCGTATTTTGGGCTGG - Intronic
921370057 1:214413171-214413193 TTAAAAAGCTTTCGTTGGGCTGG - Intronic
922510979 1:226167089-226167111 TTAAAAACCGATTGTTGGGCTGG - Intronic
922605233 1:226886034-226886056 TAAAAAATTTTTTTTTGTGCAGG + Intronic
922817512 1:228460286-228460308 TTAAAAATTATTTCTCGGCCAGG - Exonic
922869888 1:228893882-228893904 TTTAAAAACTTTTCTCAGGCCGG + Intergenic
923292932 1:232564371-232564393 CTAAAAAACCTTTCTTGGCCAGG - Intergenic
923778484 1:237000532-237000554 TTAAAAATATTTTGTTAGTCTGG - Intergenic
924295823 1:242586037-242586059 TTAAAAATCTTTTCTGGGGGTGG + Intergenic
924433652 1:244019778-244019800 TTAAAAATCTGCTTTTGGGCCGG + Intergenic
924712422 1:246540327-246540349 TTAAGAATATTTTCTTGGCCAGG - Intergenic
924860213 1:247912254-247912276 TTTAAAATGTATTCTTTGGCCGG - Intergenic
924891497 1:248286155-248286177 TTAAAAATTTTTTGTTAGCCGGG - Intergenic
1062859212 10:797032-797054 TTAAAAATGGTTTTGTGGGCTGG + Intergenic
1062876601 10:947917-947939 TTAAAAAACATTTCATTGGCCGG - Intergenic
1063012795 10:2041719-2041741 TTAAATATCTTTTCTTTGGAGGG - Intergenic
1063127067 10:3144630-3144652 TTAAAAATTTTTTGTTGAGATGG - Intronic
1063216293 10:3929022-3929044 TTAAAAATCATGTCTGGGCCAGG + Intergenic
1063673367 10:8117808-8117830 TTAAAAATATTGTCTGGGCCAGG - Intergenic
1063832502 10:9971013-9971035 TTAAAAATTGTTTCTAGGCCCGG - Intergenic
1063998603 10:11643786-11643808 CTCAAAATCTCTTCTTGGTCTGG + Intergenic
1064089444 10:12371278-12371300 TAAAAAATCTTTTTTGAGGCCGG + Intronic
1064116036 10:12578247-12578269 TAAAAAATGTTTTGTAGGGCTGG + Intronic
1064175787 10:13073781-13073803 TTAAAAAAAATGTCTTGGGCAGG - Intronic
1064448096 10:15414559-15414581 TATAAAAACTGTTCTTGGGCCGG + Intergenic
1064559480 10:16582133-16582155 TTAAAAATATTTTAGAGGGCTGG + Intergenic
1064562785 10:16609142-16609164 TTAAAAATCTGATTTTAGGCTGG - Intronic
1064628499 10:17285576-17285598 TTAAACTTCTTTTCTTAAGCTGG - Intergenic
1064770906 10:18722029-18722051 TTAAAAATATTTTTTTGGGCTGG + Intergenic
1064790144 10:18949838-18949860 TTAAAAATCCTGTTTTGGCCAGG - Intergenic
1065148382 10:22796616-22796638 TTAAAAATCTTTACTTTGGGAGG - Intergenic
1065304733 10:24357399-24357421 TTAAAATTCTTACCTTTGGCCGG + Intronic
1065341849 10:24714737-24714759 TTAAAAATTGTTTTTTGGCCGGG + Intronic
1065376007 10:25042588-25042610 TTAAAAATTTTTTCAGGGCCAGG - Intronic
1065536120 10:26716398-26716420 TTAAAAAAATTTTTTTGGCCGGG + Intronic
1065676876 10:28185817-28185839 TTAAACATGTTTTTGTGGGCTGG - Intronic
1065893586 10:30141591-30141613 TCAAATCTCTTTTCTTTGGCAGG - Intergenic
1065926286 10:30435838-30435860 TTTAAAATATTTTTTTAGGCCGG - Intronic
1066011131 10:31194180-31194202 TTAAAAATCATTTGTAGAGCCGG - Intergenic
1066081411 10:31934308-31934330 ATAAGAATCTATTCTTGGCCGGG + Intergenic
1066088359 10:31993472-31993494 TTAAAAAGCTTTTCTTGATGTGG - Intergenic
1066133367 10:32416793-32416815 TTAAAAATATTCTATTCGGCCGG + Intergenic
1066286405 10:33970674-33970696 TTACAAATGTTTTCCTTGGCTGG - Intergenic
1066577227 10:36839517-36839539 TTAAAAAATTTTTTTTGGCCAGG + Intergenic
1066636803 10:37511352-37511374 GTAAAAATGGTTTCATGGGCTGG + Intergenic
1066758496 10:38733313-38733335 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1067036135 10:42919273-42919295 TTAAAAATCTCTTTTGGGCCAGG + Intergenic
1067108115 10:43378876-43378898 TTAAAAATCTTTTATTTTTCAGG + Intergenic
1067119594 10:43462937-43462959 TTAAAAAATTTTTTTTGGCCAGG + Intronic
1067196258 10:44121820-44121842 TAAAAAATGTTATTTTGGGCTGG - Intergenic
1067209799 10:44250363-44250385 TTAAAATTTTTTTCTGGGGGTGG - Intergenic
1067975250 10:51017392-51017414 TTGAAAATCTTCTCTGTGGCAGG - Intronic
1068239292 10:54284129-54284151 TTGAAAATCATTTATTAGGCCGG - Intronic
1068507779 10:57924639-57924661 TTAAAAACCTTTTTTTTGGCCGG - Intergenic
1068923190 10:62506796-62506818 TAAAAAATCTTTACATGGTCTGG - Intronic
1069407882 10:68121870-68121892 TTAAAAATACTTTTTTGGACTGG - Exonic
1069459993 10:68585712-68585734 TAAAAAAAATTTTTTTGGGCCGG + Intronic
1069490321 10:68855414-68855436 TTAAAAAAATTTTTTTGGCCAGG - Intronic
1069519054 10:69103252-69103274 TTAAAAATGATTTCTTGGGCCGG + Intronic
1069690042 10:70344861-70344883 TTAAAAATGTCTTTGTGGGCCGG - Intronic
1069725150 10:70572723-70572745 TTAAAATGCTTATTTTGGGCCGG + Intergenic
1069730842 10:70611554-70611576 TTAAAAATTTTTTTTCGGCCGGG + Intergenic
1070203497 10:74231759-74231781 AAAAAAAACTTTTCTTGGCCAGG - Intronic
1070222896 10:74469532-74469554 TTAAAAATTTTTTGTAGAGCTGG + Intronic
1070261235 10:74857847-74857869 TTAAAAATTTTTTCTAGAGATGG - Intronic
1070413352 10:76165565-76165587 TTAAACCTCTTTTCTTGGCTGGG - Intronic
1070614395 10:77958330-77958352 TTAAAAATCTATTTTAGGTCAGG - Intergenic
1071330748 10:84557169-84557191 TTAAAAAATTTTTTTTTGGCTGG + Intergenic
1071587584 10:86839956-86839978 TAAAAAATCTTATCCTGGGCTGG - Intronic
1071833294 10:89393434-89393456 TTAAAAACCATTACTTAGGCCGG + Intronic
1071894396 10:90050153-90050175 TTAAAAATTTTTTTTGGGCCGGG + Intergenic
1071924652 10:90392105-90392127 TTAGAAATATTGTCATGGGCCGG + Intergenic
1071926835 10:90418777-90418799 TTAAAAATATTTTATTGGCTGGG - Intergenic
1072104761 10:92263373-92263395 TTAAAAATGCTTTATTGGGCTGG - Intronic
1072143795 10:92615106-92615128 TTAAAAAGCTTTTTTAGGCCAGG + Intronic
1072200897 10:93157935-93157957 TTAAACCTCTTTTCTTGGCCAGG + Intergenic
1072432613 10:95386814-95386836 TTAAAGCTCCTTTCTTGGACGGG + Intronic
1072440107 10:95446853-95446875 TTTAAAATCTAATCTTGGGCCGG + Intronic
1072483006 10:95827778-95827800 TTAACAATTTTTTTTTGGCCGGG - Intronic
1072546599 10:96444892-96444914 TTAAAAATTATTCCTTGGCCAGG + Intronic
1072847681 10:98850438-98850460 TTAAAAATATTATTTTGGGCCGG + Intronic
1072901324 10:99409424-99409446 TTAAAACTTTTTTATTGGCCAGG - Intronic
1072919192 10:99561236-99561258 TTAAAAAGCTTTTCATGTGGGGG + Intergenic
1073306966 10:102510523-102510545 TTAAAAAGATTTTTTTTGGCTGG + Intronic
1073507520 10:104012400-104012422 TGAAACATTTTTTCTTGGCCTGG + Intronic
1073520584 10:104125097-104125119 TTAAAAATATTTTTTTAGGCTGG - Intronic
1073627268 10:105112298-105112320 TTAAAAATCTTTTTTGGGGTGGG + Intronic
1073737685 10:106368318-106368340 TTAAAACTCTTTTCTAGGCCGGG - Intergenic
1073804690 10:107084396-107084418 TTTAAAACCTTTTCCTGGCCAGG - Intronic
1074149696 10:110747281-110747303 TAAAAACTCTTTTTTTGGGGGGG + Intronic
1074232325 10:111549771-111549793 TTAAAAATGTTACCTTGGCCGGG + Intergenic
1074249802 10:111733203-111733225 TTAAAAATATTATTTAGGGCTGG + Intergenic
1074473563 10:113749358-113749380 TTAAAAACCTATGCTTGGCCGGG + Intergenic
1075102022 10:119513159-119513181 TTAAAAAATTTTTCTGAGGCTGG + Intronic
1075746634 10:124732561-124732583 TTAAAAATTGTTTTTTGGCCAGG + Intronic
1075760937 10:124856056-124856078 TTAAATATCTTTTTTTAGGCCGG - Intergenic
1075783283 10:125031190-125031212 TTAAAAAAGTTTTCTTGGGCCGG + Intronic
1076352491 10:129826776-129826798 TTAAAAATCCATTCATGGCCGGG + Intergenic
1077031023 11:467459-467481 ATATAAATATATTCTTGGGCTGG + Intronic
1077583961 11:3436184-3436206 TTAAAAATGTAAGCTTGGGCTGG - Intergenic
1077728782 11:4705692-4705714 TTAAAAAGCTATTATTGGCCGGG + Intronic
1078152435 11:8770695-8770717 TAAAAAATCTTTTTATGAGCAGG + Intronic
1078243896 11:9555252-9555274 ATAAAAATCATTTCTAGGCCAGG - Intergenic
1078290150 11:10001819-10001841 TTAAAAAAATTTTTTTGGCCAGG - Intronic
1078333690 11:10446891-10446913 TTAAAAATTATTTTTTGGCCGGG + Intronic
1078585244 11:12580103-12580125 TTAAAAATTTTTTTTGTGGCCGG - Intergenic
1079014712 11:16858786-16858808 TTAAAAATCTTTTTTTAGGTTGG - Intronic
1079397583 11:20078752-20078774 TTAGAAATGTTTTCCTAGGCTGG - Intronic
1079741751 11:24071011-24071033 ATAAAAATGTTTTCTTGGGAGGG + Intergenic
1079990041 11:27236717-27236739 TTAATAGTCTTTTTTTGGGCCGG - Intergenic
1080424247 11:32141590-32141612 TTAAAAATATTTCCTTTGGCTGG - Intergenic
1080434968 11:32231348-32231370 TTTAAAAACTTTTCTAGGCCGGG - Intergenic
1080477255 11:32607386-32607408 TTAAGAATTTATTTTTGGGCCGG - Intronic
1080940851 11:36916132-36916154 TTAAAAAAATTTTTTTGGGGGGG + Intergenic
1081290871 11:41324127-41324149 TTAAAAATATTATTTTAGGCAGG + Intronic
1081334926 11:41853486-41853508 TTAAAAATCATTTCTGAGTCTGG + Intergenic
1081556230 11:44164621-44164643 TTATAAAGCTTCTCTAGGGCAGG - Intronic
1082018897 11:47514558-47514580 TTAAAAATCTCTTTTTGGCCAGG + Intronic
1082035280 11:47640711-47640733 GTAAAAATAGTTACTTGGGCCGG - Intronic
1082055077 11:47807985-47808007 TTAAAAATCTTTTTCCCGGCTGG + Intronic
1082732652 11:56818873-56818895 ATAAAAATCTGTGCTTTGGCTGG - Intergenic
1082797021 11:57385513-57385535 TTGAAAAATTTTTCTTGGCCGGG - Intergenic
1083223191 11:61266959-61266981 TTAAAAATATTTCTCTGGGCTGG + Intronic
1083341921 11:61963742-61963764 TTAAGAATCTTGTCTTGGGCTGG + Exonic
1083358926 11:62091528-62091550 TTGAAAATTTTTTTTTGGCCAGG - Intergenic
1083561572 11:63677234-63677256 TTAAAAATTCCATCTTGGGCCGG + Intergenic
1083689282 11:64397010-64397032 TTAAAAAACTTAGCTGGGGCTGG - Intergenic
1083866092 11:65454153-65454175 TTAAAAAGCCTCTCTGGGGCTGG + Intergenic
1083912007 11:65715462-65715484 TTAAAAAGCAATTCCTGGGCTGG + Intronic
1083977077 11:66131630-66131652 TAAGAAATCTTTTCTGGGCCAGG + Intronic
1084048166 11:66582552-66582574 TTAAGAAAATTTTTTTGGGCTGG - Intergenic
1084240868 11:67818857-67818879 TTAAAAATGTAAGCTTGGGCTGG - Intergenic
1085064661 11:73483024-73483046 TTAAAAACCTGTTCTTGGCTGGG - Intronic
1085078328 11:73611775-73611797 TTAAAAATATTTTACTGGCCAGG - Intergenic
1085371529 11:76011326-76011348 TTAAAAATCTTACATTGGCCGGG + Intronic
1085606865 11:77908621-77908643 TACAAAATATTTACTTGGGCCGG - Intronic
1085792398 11:79507260-79507282 TTAAGAAACCTTTCTTGGGCCGG - Intergenic
1085874912 11:80394831-80394853 TTTAACATCTTTTCCTTGGCAGG - Intergenic
1086080479 11:82898845-82898867 TTAAAAATTGTTTCTTGGCTGGG + Intronic
1086356934 11:86010616-86010638 TTCAAAATGTTTTCGTTGGCTGG - Intronic
1086385875 11:86306701-86306723 ATAAAAATATTTTTTTTGGCCGG + Intronic
1086614353 11:88797434-88797456 TTAAAAACCCAATCTTGGGCTGG - Intronic
1086895781 11:92310959-92310981 TTAAAAAACTTTTTTTGAGATGG + Intergenic
1087041673 11:93807113-93807135 TTAAAACTTTTTTTTTTGGCCGG + Intronic
1087098527 11:94342951-94342973 TTAAAAATGTTATCCTAGGCTGG - Intergenic
1087278578 11:96184888-96184910 TTAAAAAACATTTTTTGGGCTGG - Intronic
1087437913 11:98145660-98145682 GGAAAAATGGTTTCTTGGGCTGG - Intergenic
1087510197 11:99082476-99082498 TTAAATATCTGTTTTTGGCCTGG - Intronic
1087734915 11:101820981-101821003 TTAAAAATGTTAACATGGGCTGG - Intronic
1087760438 11:102099403-102099425 TTAAAAATATTTTTTTGGTTAGG - Intergenic
1088153816 11:106780332-106780354 TAAAAAATGTTTTCATAGGCTGG + Intronic
1088323197 11:108574203-108574225 TTAAAAATCTTTTTGTAGGTTGG - Intronic
1088925565 11:114297780-114297802 TAAAACATCTTTTCTGGGCCAGG - Intronic
1089243939 11:117104541-117104563 TTAAAAATGTTGTCCTGGCCAGG - Intergenic
1089484224 11:118832364-118832386 TTAAAAGTGTTATCTTGGCCAGG + Intergenic
1089544547 11:119213108-119213130 TTAAAAATACTTTCTTGGCTGGG - Intronic
1089774087 11:120824155-120824177 TTAAAAATCTACTTTTGGGAAGG - Intronic
1090417847 11:126552856-126552878 AAAAAAAGCTTTTCTTGGCCTGG - Intronic
1090801754 11:130177266-130177288 TTAAAAATTTGTTTTTAGGCCGG + Intronic
1091101161 11:132874966-132874988 TTTTAAATATTTACTTGGGCTGG - Intronic
1091598578 12:1900428-1900450 TTAAAAGTTTTTTGTTGGTCAGG - Intronic
1092741213 12:11631887-11631909 AGAAAAATCCTTTCTTGGCCGGG + Intergenic
1092812925 12:12288253-12288275 TTAAAACTATGTTCTGGGGCCGG + Intergenic
1092817905 12:12327103-12327125 TTAAAAAGCTACTCTTGGCCAGG - Exonic
1093001256 12:13999003-13999025 TTAAAAATCATATCTAGAGCTGG + Intergenic
1093008585 12:14079949-14079971 TAAAAAATCTTTTCTGGGGGAGG + Intergenic
1093016429 12:14159733-14159755 ATAAAAATCTACTCTTGGCCGGG + Intergenic
1093418290 12:18945855-18945877 CTAGAAATGTTTTCTTGGACTGG + Intergenic
1093468198 12:19472167-19472189 TTAAAAATTTTATTTTAGGCTGG + Intronic
1093624982 12:21335124-21335146 TCAAAAATCTTTTTTTGGCCAGG + Intronic
1093814120 12:23522257-23522279 TTAAAATTCTTTTCAAGTGCCGG - Intergenic
1093961140 12:25273957-25273979 TTAAAAATCTTTTTTAGGCCGGG - Intergenic
1094128393 12:27048427-27048449 TTTAAAAACATTTCTTGGGAGGG + Intronic
1094626475 12:32129227-32129249 TTAAAAATTTTTTGTAGGCCGGG + Intronic
1094708128 12:32934576-32934598 TTACTAATATTTTCTTTGGCAGG + Intergenic
1094737457 12:33251082-33251104 TTAAAAAGTCTTGCTTGGGCTGG + Intergenic
1095144686 12:38711763-38711785 TTTAAAATGTATACTTGGGCCGG - Intronic
1095422659 12:42041526-42041548 TTAAAAATATAGTCTTGGCCAGG + Intergenic
1095656055 12:44670219-44670241 TTAAACATTTTTTGTAGGGCTGG - Intronic
1095926967 12:47588230-47588252 TTAAAACTCTTCTCTCGGCCAGG - Intergenic
1096149639 12:49300696-49300718 TTAAAAATTATTTTTTGGGCTGG - Intergenic
1096246256 12:49989093-49989115 TAGAAAATCATTTCTGGGGCTGG - Intronic
1096398599 12:51286826-51286848 TAAAAAATCTTTTTTTGAGATGG + Intronic
1096678806 12:53241530-53241552 TCAAAAAGCATTTCTTGGCCAGG - Intergenic
1096721748 12:53528134-53528156 TAAAAAATTATTTCTTGGCCGGG - Intronic
1096742915 12:53707304-53707326 TTAAAAAAATTTTTTTTGGCCGG + Intergenic
1097012346 12:55962147-55962169 TTAAAACTCATTTATTTGGCCGG + Intronic
1097111467 12:56661815-56661837 TTAAGAACATTTTCTGGGGCGGG - Intergenic
1097418416 12:59343893-59343915 TTAAAAATATTCTCTTTCGCCGG + Intergenic
1097443941 12:59646256-59646278 GGAAAAATCATTTCCTGGGCTGG + Intronic
1097544473 12:60981781-60981803 TTAAAGCTCTTTTTTTGGGGGGG + Intergenic
1097629731 12:62045366-62045388 TTAAAAAAAATTTCTTGGTCAGG - Intronic
1097839377 12:64306663-64306685 TTAAGAATCTTTCCTGCGGCTGG - Intronic
1097877413 12:64656278-64656300 TTAAAAACATATTATTGGGCAGG + Intronic
1098095119 12:66946693-66946715 TTAAAAACCAATGCTTGGGCTGG + Intergenic
1098245418 12:68512351-68512373 ATAGAAATCTTTTCCTGGACTGG + Intergenic
1098300809 12:69052328-69052350 TTAAAAAACTTTTTTTTGGCCGG - Intergenic
1098344213 12:69484377-69484399 TTAAAAAGCTTTTCCAGGCCGGG - Intronic
1098456010 12:70673935-70673957 TTAAAAATTTTTTTTAAGGCAGG + Intronic
1098759721 12:74407877-74407899 TTTAAAATGTTTTCTGGGCCAGG - Intergenic
1098774857 12:74600124-74600146 GGAAAAATGTTTTCATGGGCTGG + Intergenic
1098911734 12:76215806-76215828 GTAAAAATATTATCTGGGGCCGG - Intergenic
1098929613 12:76396325-76396347 TTAATCCTTTTTTCTTGGGCGGG - Intronic
1098934818 12:76466660-76466682 TTAAAAATCTTTTTCCAGGCTGG + Intronic
1098937547 12:76498106-76498128 TTAAAAATCAGTATTTGGGCTGG + Intronic
1098954337 12:76673265-76673287 TTAAAAATTTTTTATTGGCCGGG + Intergenic
1099234285 12:80064185-80064207 TTAAAAATTTTTTCCTGGGGTGG + Intergenic
1099852283 12:88116677-88116699 ATAAAAATATTTTCCTGGCCGGG + Intronic
1099999796 12:89819750-89819772 TTAAAAATATTTTATTGGCCGGG + Intergenic
1100473939 12:94918545-94918567 ATAAAAATCTTCTTTTAGGCCGG + Intronic
1100634080 12:96418128-96418150 ATAAAAATATTTTCTTGGCTGGG + Intergenic
1100787635 12:98095824-98095846 GAAAAAATGGTTTCTTGGGCTGG + Intergenic
1100793336 12:98154138-98154160 TTACAAGTCATTTCTTGGGAGGG + Intergenic
1100951446 12:99854305-99854327 TCAAAAACCTTGTCTTGGCCGGG - Intronic
1101069156 12:101054781-101054803 ATAAAAATGTTCTCTTAGGCCGG - Intronic
1101192701 12:102351651-102351673 TTTAATCTCTTTTCTTGAGCTGG + Intergenic
1102092222 12:110201105-110201127 TTAAAAAAATTTTTTTGGCCAGG + Intronic
1102094973 12:110231615-110231637 TTAAAAATCTTTCTTTAGCCAGG + Intergenic
1102121155 12:110442161-110442183 TTAAAAATTTTTTTTTTGCCTGG - Intronic
1102170630 12:110839800-110839822 TTAAAAATCTTTGACTTGGCCGG + Intergenic
1102367652 12:112352901-112352923 TTAAAACACTTATGTTGGGCTGG - Intronic
1102698182 12:114816205-114816227 TAAAAAAATTTTTCATGGGCTGG - Intergenic
1102864625 12:116364297-116364319 TTAATAATTTTTTTTTGGCCGGG - Intergenic
1102994084 12:117334921-117334943 TTAAAACTCTTCCCTGGGGCAGG - Intronic
1103396030 12:120607896-120607918 TTAAAATTCTGTTCCTCGGCTGG - Intergenic
1103532619 12:121612879-121612901 TTAAAAAAATTTTTTTGGGGGGG - Intergenic
1103554481 12:121757946-121757968 TTTAAAAACTTTTCTTGGCTGGG - Intronic
1103578419 12:121896172-121896194 TGAAAAATCTGTTCTCGGCCGGG + Intronic
1103582590 12:121926496-121926518 TTAAAAATCTTTTTTAGAGATGG + Intronic
1103589936 12:121984600-121984622 TTAAAAATGATTTCTAGGCCGGG - Intronic
1103655693 12:122468670-122468692 TTAAAAATATATTGTTGGCCGGG - Intergenic
1103665907 12:122565589-122565611 TTAAAAATAAATTCTTGGCCGGG + Intronic
1103776021 12:123366869-123366891 TTAAAAGTTTTTTGTTGGGCCGG - Intergenic
1103804575 12:123562533-123562555 TTAAATGTTTTTTCTTGGCCAGG - Intergenic
1104240572 12:126985027-126985049 CTAAAAATGGTTTCATGGGCCGG - Intergenic
1104543042 12:129685268-129685290 GAAAAAATGGTTTCTTGGGCTGG + Intronic
1105033927 12:132904716-132904738 TTAAAAATGTTTTTATAGGCCGG - Intronic
1105230168 13:18486951-18486973 TTAAAAATATTCCCTTTGGCTGG - Intergenic
1105343030 13:19545879-19545901 TTAAAAATCTGTCCATGGGCAGG + Intergenic
1105373758 13:19824132-19824154 TTAATATTCTGTTCTTGGCCGGG - Intronic
1105394703 13:20019529-20019551 TTTAAAATCTTTTTTTAGGTAGG + Exonic
1105416704 13:20219507-20219529 TTAAAAATCTTTTACTGGCTGGG - Intergenic
1105427791 13:20309974-20309996 TTAGAAATTATTTTTTGGGCTGG - Intergenic
1105456514 13:20546011-20546033 TTAAAAATTTTATTTTAGGCCGG + Intergenic
1105530742 13:21217687-21217709 TTAAAAAAATTTTTTTGGCCAGG + Intergenic
1105556765 13:21454419-21454441 TTCAAATTATTTTCTTGGGCTGG - Intronic
1105590557 13:21789521-21789543 TTAAATATCTTTTTCTTGGCCGG - Intergenic
1105599180 13:21870596-21870618 TTAAAAATGCATTCTTGGCCAGG + Intergenic
1105644598 13:22303472-22303494 GGAAAAATGGTTTCTTGGGCTGG - Intergenic
1105764043 13:23540674-23540696 TTAAATATCTCTTTCTGGGCTGG - Intergenic
1105868514 13:24483189-24483211 TTAAAAAGTTTTTTTTGGCCGGG + Intronic
1106632198 13:31486566-31486588 ATAAAAATGTTTTCTTGGGCTGG - Intergenic
1106833275 13:33608201-33608223 TTAAAAATGTTTTCATGGGCTGG - Intergenic
1106881931 13:34141104-34141126 TTGAAAATCATTTCTTTGGGAGG - Intergenic
1107255851 13:38426081-38426103 TAAAAAATACTTTCTTGGCCGGG - Intergenic
1107473217 13:40710806-40710828 TGAAAATTCTTTTCTTGAGGTGG + Intergenic
1107543133 13:41411852-41411874 TTAAAGTGCTTTTCTTAGGCTGG + Intergenic
1107599913 13:42002837-42002859 TTAAAACTCATTGCATGGGCCGG - Intergenic
1107689518 13:42938615-42938637 TTAAAAATCTGTTGTTAGGCTGG + Intronic
1107853570 13:44593102-44593124 TTAAAAATGTTTTCCAGGGCCGG + Intergenic
1108067217 13:46590502-46590524 TTAAAACTCTCTTCTTGGCCAGG + Intronic
1108344727 13:49534357-49534379 TCAAATATCTTTTCTGGGGGAGG - Intronic
1108443025 13:50475426-50475448 TTAAAAATCATTGCCTTGGCCGG - Intronic
1108456010 13:50614486-50614508 TAAAAAATATCTTCTTTGGCTGG + Intronic
1108894863 13:55313556-55313578 TTAAAAATGTTTCCTTGGCCAGG + Intergenic
1108991898 13:56669390-56669412 TTAAAAATTATTTCTTGTTCAGG + Intergenic
1109227719 13:59716469-59716491 TTAAAAATGTTTCCTGGGGCCGG - Intronic
1109351387 13:61187268-61187290 TTAAAAATGTCTTCTTGGCCAGG + Intergenic
1109642413 13:65207675-65207697 TTAAAAATATTATTTTGGCCAGG - Intergenic
1109726175 13:66344419-66344441 TTAAAAATACTTTATTGGCCGGG - Intronic
1109815780 13:67582523-67582545 TTAAAAATCTTTTTTTTGGTGGG + Intergenic
1109873467 13:68366832-68366854 TTAAAAGTCTTATCTTCTGCCGG + Intergenic
1109951888 13:69510759-69510781 GAAAAAATGGTTTCTTGGGCTGG + Intergenic
1110208168 13:72942702-72942724 TTAAAAATCCTTTAGTAGGCTGG + Intronic
1110511400 13:76355662-76355684 GAAAAAATGGTTTCTTGGGCCGG + Intergenic
1110740772 13:78993662-78993684 TTTTAAATCTTTTGTTTGGCAGG - Intergenic
1111291030 13:86169718-86169740 TTAAAAATAATTTATTGGCCAGG - Intergenic
1111922470 13:94426881-94426903 TGAAAAATCTTGTTTGGGGCTGG + Intergenic
1111994583 13:95151901-95151923 TTGAAAATCTGTTCTTGCACAGG - Intronic
1112217094 13:97443560-97443582 TTAAAAATTTTTTCTAGAGATGG + Intronic
1112356986 13:98681804-98681826 TTAAAAATCCTTTGTTTGGCTGG - Intergenic
1112511438 13:100012948-100012970 TTAAAAATCAATTATTTGGCTGG + Intergenic
1113084518 13:106554589-106554611 ATAAAAAACTTTTCTTGGCCGGG + Intronic
1113282582 13:108805781-108805803 TTAAAAAACTAATCTGGGGCTGG + Intronic
1113287598 13:108869427-108869449 TAAAAAATCTTACCTTGGCCGGG + Intronic
1113323702 13:109263653-109263675 TTAAAAATTATTCCTTAGGCAGG - Intergenic
1114014411 14:18413763-18413785 TTAAAAATATTCCCTTTGGCTGG - Intergenic
1114174383 14:20307020-20307042 TTAAAAATTTTTTTTTGAGATGG + Intergenic
1114284509 14:21227746-21227768 TAAAAAGTCTTTTCTTGGCAAGG - Intronic
1114309923 14:21457191-21457213 TTAAAAAAGATTTCTTGGCCAGG - Intergenic
1114316194 14:21511931-21511953 TTAAAAATCTGTACTATGGCCGG - Intergenic
1114800357 14:25767901-25767923 TTAAAAAAATTTTTTTGGGAAGG - Intergenic
1114848818 14:26357933-26357955 TTGAACATCTTTTCATGTGCTGG + Intergenic
1115050027 14:29047976-29047998 TTGAAAATGTTTTCCTGGGAGGG + Intergenic
1115083324 14:29483662-29483684 TTAAAAATTATTTTTTGGCCAGG - Intergenic
1115419945 14:33183127-33183149 TTAGAAATCCATTCTTGGGCTGG + Intronic
1115421005 14:33195561-33195583 TTAAAACTCTTGTTTTGGCCAGG - Intronic
1115602712 14:34970938-34970960 CTAATAATCTCTTCTTGGCCAGG - Intergenic
1115644101 14:35355370-35355392 TTAAAAATCTATACCTAGGCTGG + Intergenic
1115751351 14:36494712-36494734 TTAAAAATGTTTCCTTAAGCTGG + Intronic
1115765080 14:36614932-36614954 TTAAAAATCAATTGTGGGGCTGG + Intergenic
1116038967 14:39662387-39662409 CTAAAAATCTTTTTTTGGGGTGG - Intergenic
1116437076 14:44907942-44907964 TTAAAAATATATTCTGGGGCTGG - Intergenic
1116492178 14:45517664-45517686 TTAAAAAACCTTTCTGGGCCAGG - Intergenic
1116623530 14:47237172-47237194 AAAAAAATCATTTATTGGGCAGG + Intronic
1116828601 14:49695767-49695789 TAAAAAATCTATTGTTGGCCGGG + Intronic
1116943910 14:50818009-50818031 TTAAAAATGCATTCTTGGCCAGG - Intronic
1117030899 14:51668962-51668984 TTAAAAAGCTGATTTTGGGCAGG - Intronic
1117132688 14:52701930-52701952 TAAAAAATTTTTTTTTGGCCGGG - Intergenic
1117132689 14:52701931-52701953 TTAAAAAATTTTTTTTTGGCCGG - Intergenic
1117136820 14:52743283-52743305 TTAAAAATACTTTTCTGGGCCGG + Intronic
1117156043 14:52942596-52942618 TGAAAAAAATTTTCTTGGGGCGG - Intronic
1117283823 14:54266691-54266713 TTAAACCTCTTTCCTTTGGCTGG + Intergenic
1117299413 14:54409535-54409557 TTAAAAATTTATTCCTGGTCAGG + Intronic
1117345448 14:54827408-54827430 TTCAATATCAGTTCTTGGGCAGG + Intergenic
1117385084 14:55203910-55203932 TTAAAAAACTATTTTTAGGCTGG + Intergenic
1117579035 14:57133112-57133134 TAAAAACTATTTTCTTGGCCAGG - Intergenic
1117601287 14:57378084-57378106 TTAAAAAAATATTCTTGGCCGGG + Intergenic
1117626910 14:57649855-57649877 TTCAAAAGTTTTTCTGGGGCAGG + Intronic
1117694573 14:58346630-58346652 ATAAAGATCTTTTCCTGGCCAGG + Intronic
1117728806 14:58700587-58700609 TTAAAAATCATTTTTTAGGCCGG - Intergenic
1117924724 14:60766416-60766438 TTAAAAATCTTTTTGTGGCCTGG + Intronic
1118063141 14:62162503-62162525 TTAAAAGTCATTTCTAGGCCGGG - Intergenic
1118194479 14:63612021-63612043 TTAAAAATTTTTTGTTGGCCAGG - Intronic
1118382974 14:65232793-65232815 TTTAAAATTTTTTTTTGGGCCGG + Intergenic
1118421391 14:65608997-65609019 TTAAAAATATTTTCTTGGCCAGG + Intronic
1118690055 14:68329684-68329706 TTAAAAATATTTTTTGGGCCGGG + Intronic
1118715236 14:68555139-68555161 TTAAGAATATTTTTTTGGCCGGG - Intronic
1118913598 14:70082269-70082291 TTTAAAATAATTTCTTGGGGGGG + Intronic
1119308160 14:73624423-73624445 TTAAAAAAATTTTTTTGGGCGGG - Intergenic
1119393330 14:74306479-74306501 TCAGAAATCTGTTCTTGGCCAGG - Intronic
1119468449 14:74878155-74878177 TTAAAAATTATCTTTTGGGCCGG + Intergenic
1119470668 14:74896147-74896169 TTAAAAATTCTTTTTTGGCCAGG - Intronic
1119529421 14:75349201-75349223 TTAAAATCCTTTTCTTGGCTGGG - Intergenic
1119597664 14:75951046-75951068 TTAAAAACCTTATCTGGGCCAGG + Intronic
1119760880 14:77150861-77150883 CTAATAATTTTTTCTTGGCCAGG - Intronic
1119792663 14:77366947-77366969 TTAAAAACCTTTTCTAGGCTGGG + Intronic
1120313618 14:82863183-82863205 TTAAAAAATTATTCCTGGGCCGG - Intergenic
1120361089 14:83503154-83503176 TTATAAATCTACTATTGGGCGGG - Intergenic
1121651901 14:95564881-95564903 TTAAAAATCTTTAGTTGAGATGG - Intergenic
1121941891 14:98078759-98078781 TAAAAAATCATTTTTTGGCCAGG + Intergenic
1122089578 14:99329306-99329328 TTAAACCTCTTTCCTTGGCCGGG + Intergenic
1122101902 14:99419478-99419500 TTAAAAACCTTTTTATGGCCGGG + Intronic
1122547052 14:102529088-102529110 CTAAAAATCATTTCTGGGCCAGG + Intergenic
1122696720 14:103557695-103557717 TTTAAAAACTCTTCCTGGGCTGG + Intronic
1123128093 14:105964199-105964221 GGAAAAATGTTTTCATGGGCTGG + Intergenic
1202829850 14_GL000009v2_random:16154-16176 TTTAAAATATTTACTTGGCCAGG + Intergenic
1123432663 15:20231838-20231860 TTGAAAAGCCTTTCTTGGCCAGG + Intergenic
1123441905 15:20297981-20298003 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1123712141 15:22996346-22996368 TTAAAAAAAATGTCTTGGGCTGG + Intronic
1123917003 15:25041480-25041502 TTAAAAATTTTTTCCCTGGCCGG + Intergenic
1123982715 15:25618532-25618554 TTAAAAATCTATTCCTGGCCAGG - Intergenic
1124029199 15:25994218-25994240 TTAAAAAACTTTTCTTGGGGGGG + Intergenic
1124485123 15:30107546-30107568 TTAAAAATTTATTCTGGGCCGGG + Intergenic
1124518455 15:30389723-30389745 TTAAAAATTTATTCTGGGCCGGG - Intronic
1124540199 15:30576526-30576548 TTAAAAATTTATTCTGGGCCGGG + Intergenic
1124758454 15:32431051-32431073 TTAAAAATTTATTCTGGGCCGGG - Intergenic
1124997343 15:34736607-34736629 TTAAAAATGATTTATTGGCCGGG + Intergenic
1125143904 15:36443094-36443116 TTAAAAAGTATTTTTTGGGCTGG - Intergenic
1125149410 15:36515161-36515183 TTAAAAATGTTTTCCAGGCCGGG + Intergenic
1125150974 15:36531700-36531722 TTAAAAAAATTTTCTTGGCCGGG - Intergenic
1125244660 15:37621027-37621049 TTAAAAATGTTTTCTTGGCCGGG - Intergenic
1125479067 15:40068151-40068173 TTGAAAATCTTTTATTGGCTAGG - Intergenic
1125521783 15:40352031-40352053 TTAAAAAAATTTTTTTTGGCTGG - Intronic
1125532656 15:40423754-40423776 TTAAAGAACTATCCTTGGGCCGG - Intronic
1125746221 15:41999395-41999417 TTGAACATCTTTCCATGGGCTGG - Intronic
1125763061 15:42111601-42111623 TAAAAAATAATTACTTGGGCCGG + Intergenic
1125918171 15:43508064-43508086 TTAAACATATTTTCTGGGCCGGG + Intronic
1125998937 15:44191291-44191313 TTCAAAATCTATTCCTGGCCGGG + Intronic
1126027811 15:44464999-44465021 TTAAAAGGGTTTTCTTGGCCAGG - Intronic
1126030465 15:44492163-44492185 TTAAAAAAATTTTTTTTGGCCGG - Intronic
1126145068 15:45466276-45466298 TTAAATCTCTTTTCTTAGCCGGG + Intergenic
1126653559 15:50952021-50952043 TTAAAAATATTTAACTGGGCCGG - Intronic
1126759552 15:51956822-51956844 TTATAAATTTTTTTTTGGGGGGG + Intronic
1126820391 15:52497256-52497278 TTAACATTTTTTTCTCGGGCTGG - Intronic
1127133933 15:55898934-55898956 TTAAAGGTCTTTTCTTGGCCAGG - Intronic
1127415864 15:58756699-58756721 TTAAAAATCCCTTCTGGGCCTGG + Intergenic
1127752961 15:62064190-62064212 TTATGAATGTTTGCTTGGGCAGG - Intergenic
1127781794 15:62322945-62322967 TTAAAAATGTATTATTTGGCTGG - Intergenic
1127814529 15:62595978-62596000 TTAATAATGTATTCTTGGCCAGG + Intronic
1128035982 15:64526945-64526967 TTCAAAATCTCATATTGGGCTGG - Intronic
1128881811 15:71250787-71250809 TTAAAAATCTATGATTGGCCTGG + Intronic
1128960974 15:72004260-72004282 TTAAAAATCTATTCTTGGCCGGG + Intronic
1129415473 15:75375125-75375147 TTAAAATTCTTATGTTGGCCGGG + Intronic
1129435766 15:75539088-75539110 TTAAAAAATTTTTTTTTGGCCGG + Intronic
1129435767 15:75539089-75539111 TAAAAAATTTTTTTTTGGCCGGG + Intronic
1129575041 15:76733943-76733965 TTAAAAATGTTTTCAGTGGCAGG - Intronic
1129629285 15:77240321-77240343 TTACAAATGTTTTGTTTGGCTGG + Intronic
1130150103 15:81305366-81305388 TTAAAAAATTTTTCTTGGCCGGG + Intronic
1130389686 15:83444660-83444682 TTAAAAAGCTTTTCTAGGCTGGG - Intergenic
1131027853 15:89160136-89160158 TAATAAATGTTTTCCTGGGCTGG + Intronic
1131041008 15:89266644-89266666 TTAAAAATTTTTTCTAGAGATGG + Intronic
1131213260 15:90516064-90516086 TTAAAAACTTTTTATTTGGCTGG - Intergenic
1131238935 15:90721634-90721656 TTAAAAATATTTTTATTGGCCGG + Intronic
1131750877 15:95506957-95506979 TTAAAAATATTTAAGTGGGCCGG + Intergenic
1131963906 15:97817600-97817622 TTTAAAATATTTTCCTGGGAAGG + Intergenic
1132058467 15:98670359-98670381 TTAAAAATGTATTTTGGGGCTGG + Intronic
1132378093 15:101345217-101345239 TTAAAATTCTTTTCTGTGGGAGG + Intronic
1132795352 16:1718496-1718518 ATAAAAATATTTTCTAGGCCGGG + Intronic
1132820684 16:1868258-1868280 TTTAAAATCTTATTTAGGGCCGG + Intronic
1133098169 16:3461805-3461827 TTAAAAAAATATTCTTGGCCAGG + Intronic
1133100658 16:3477503-3477525 TTAAAAAACTGTTCTTGGCTGGG + Intronic
1133120081 16:3600890-3600912 TAAAAAAGCTTTTTATGGGCTGG - Intronic
1133243332 16:4429515-4429537 TTAAAAATCTTTTTGTAGGCCGG - Intronic
1133266871 16:4590261-4590283 TTAAAAAACTATTTTTGGCCAGG + Intronic
1133269871 16:4605578-4605600 TTAAAAATCAGATCTGGGGCTGG + Intergenic
1133570043 16:7032127-7032149 TTAAAAATCTTATCTTGGCGGGG + Intronic
1134530936 16:14983275-14983297 TTAAAAGCCTTCTCTTGGCCGGG + Intronic
1134611816 16:15615075-15615097 TTAAAAATAGTTTCAGGGGCTGG - Intronic
1135039336 16:19105840-19105862 TTAAAAATCTGCTTTTGGCCAGG - Intergenic
1135426548 16:22341813-22341835 TTAAAAACCTATTTTTAGGCTGG + Intergenic
1135459661 16:22630681-22630703 TTTAAAATCTATTCTTAGCCTGG + Intergenic
1135603736 16:23805072-23805094 TTAAAAATTTTTTTCTGGCCGGG + Intergenic
1135625282 16:23989606-23989628 CTAAAAATCTTTACTTAGGTAGG - Intronic
1135919075 16:26631993-26632015 TTAAAAATGGTTTAATGGGCTGG - Intergenic
1136651046 16:31671564-31671586 TTAAGAATCTGTTTTTAGGCTGG + Intergenic
1136719300 16:32307534-32307556 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1136724327 16:32345900-32345922 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1136837670 16:33513798-33513820 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1136842654 16:33551941-33551963 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1136851965 16:33619268-33619290 TTGAAAAGCCTTTCTTGGCCGGG - Intergenic
1137234428 16:46602925-46602947 TTAAAAATAACTTTTTGGGCTGG - Intronic
1137271140 16:46902950-46902972 TTTAAAATTATTTCTTGGGCCGG + Intronic
1137301322 16:47150655-47150677 TTGAAAATATTTTCTTGGCCGGG + Intergenic
1137440446 16:48494356-48494378 TTAAGAATCTATAGTTGGGCTGG + Intergenic
1137686264 16:50389004-50389026 TTAGAAATCTTTTCTGGGCCTGG + Intergenic
1137765107 16:50971997-50972019 GATCAAATCTTTTCTTGGGCTGG + Intergenic
1137993668 16:53185677-53185699 GGAAAAATGTTTTCTTGGGCTGG + Intronic
1138574213 16:57897127-57897149 TTAAAATTTTTTTCTAGAGCTGG - Intronic
1138783867 16:59822284-59822306 TTTAAAAAATTGTCTTGGGCCGG - Intergenic
1138959144 16:62008105-62008127 TTAAAAATATTTTGTAGAGCTGG + Intronic
1139077325 16:63467441-63467463 TGAAAAATCTTTTCTTGGCATGG + Intergenic
1139149119 16:64359489-64359511 TTTAAAATTTTGTCTTAGGCTGG + Intergenic
1139274835 16:65717867-65717889 TTAAAAATCTTTTAGAGGTCAGG + Intergenic
1139412561 16:66776004-66776026 TTAAAAATCCTTTTGGGGGCTGG - Intronic
1139536962 16:67581926-67581948 TTAGATATCTTTTGTTGGCCGGG + Intronic
1139637765 16:68268707-68268729 TTAAAAATTTTTTTGTTGGCTGG + Intronic
1139744402 16:69062767-69062789 TTAAATTTCTTTTTATGGGCCGG - Intronic
1139865412 16:70057738-70057760 TTAAAAGCCTTCTCTTGGCCAGG - Intergenic
1140012435 16:71149044-71149066 TAAAAAATATATTCTTGGCCGGG - Intronic
1140377224 16:74454371-74454393 TTAAAAAATTTTTTTTGGCCAGG + Intronic
1140389888 16:74576760-74576782 ATAAAAATTTTTTCTTCAGCAGG - Intronic
1140417749 16:74788385-74788407 AAAAAAATTTTTTTTTGGGCCGG + Intergenic
1140433356 16:74923735-74923757 TTAAAATTTTATTCTTGGCCGGG - Intronic
1140439687 16:74978036-74978058 TTAAAAATTTTTTGTGGGGGTGG - Intronic
1140460310 16:75134436-75134458 TTAAAAATGTTTTTTGGGGATGG - Intergenic
1140467121 16:75191473-75191495 TTAAATCTCTTTTCTCGGCCAGG - Intergenic
1140488587 16:75315045-75315067 TTAATAATATTTTCCTGGCCAGG - Intronic
1140513511 16:75525635-75525657 TTAATGAACTGTTCTTGGGCAGG + Intergenic
1140951019 16:79817559-79817581 TTAAAAACATTTTCTTTGGGGGG + Intergenic
1141014420 16:80435040-80435062 TTAAAAATGGCTTCTTGGCCGGG - Intergenic
1141304107 16:82844948-82844970 TTAAAAATACTTTATTGGCCAGG - Intronic
1141549682 16:84797377-84797399 TATAAAATATTTTCTTGGCCAGG + Intergenic
1141587366 16:85043706-85043728 TTAAACATCATTTCCTGGCCAGG - Intronic
1142198457 16:88749729-88749751 TAAAAATGCTATTCTTGGGCTGG + Intronic
1142241259 16:88947521-88947543 TTAAAATTTATTTCCTGGGCTGG + Intronic
1203002103 16_KI270728v1_random:171865-171887 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1203007131 16_KI270728v1_random:210237-210259 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1203133707 16_KI270728v1_random:1708272-1708294 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1203147855 16_KI270728v1_random:1814076-1814098 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1203152819 16_KI270728v1_random:1852238-1852260 TTAAAAATATTTTTTAGGCCAGG + Intergenic
1142707298 17:1703927-1703949 TTAAAAATTTTTTTTTGGCCGGG + Exonic
1142950334 17:3473085-3473107 TGAAAAATCTATTTTTGGGGTGG - Intronic
1143051421 17:4129060-4129082 TTAAAAATGTTTTTTGGGCCGGG - Intronic
1143159787 17:4861794-4861816 TGTAAAATCTTTGGTTGGGCCGG - Intronic
1143507438 17:7375609-7375631 AAAAAAATTTTTTCTTGGCCAGG + Intergenic
1143693876 17:8595725-8595747 TTAAACAACTGTTCTTGGGCCGG - Intronic
1143694786 17:8605448-8605470 TTAAAATACTCTTCTTGGCCAGG + Intronic
1144376494 17:14647529-14647551 TTAAAAATTCTATCTTGGCCAGG - Intergenic
1144399697 17:14884103-14884125 GAAAAAATGGTTTCTTGGGCTGG - Intergenic
1144521385 17:15954604-15954626 TCAAAAATGTTTTTTTGGCCTGG + Intronic
1144663828 17:17088842-17088864 AGAAAAATCTTTTCTTTGGCCGG + Intronic
1144967624 17:19088119-19088141 TTAAAAATATTTTGTAGGCCGGG + Intergenic
1144980294 17:19163946-19163968 TTAAAAATATTTTGTAGGCCGGG - Intergenic
1144987928 17:19214286-19214308 TTAAAAATATTTTGTAGGCCGGG + Intergenic
1145918428 17:28591433-28591455 TTAAAAATCTTTTGTAGGGATGG + Intronic
1145927285 17:28657692-28657714 ATAAAAATTTTTTTTTAGGCTGG - Intronic
1146051027 17:29553614-29553636 TTAAAACTATTTTCTTGGCTGGG - Intergenic
1146204140 17:30887418-30887440 TTAAAAATCTGTGCTATGGCTGG + Intronic
1146293339 17:31629032-31629054 TTAAAAATCCCTTTGTGGGCTGG - Intergenic
1146304207 17:31717981-31718003 TAAAAAATCTTTTTCTGGGCCGG - Intergenic
1146402884 17:32513946-32513968 TTAAAAAAATTTTTTTGGCCGGG + Intronic
1146426342 17:32743043-32743065 TTAAACATTTTTTCTTGGCTTGG + Intronic
1146771461 17:35572296-35572318 TAGAAAATCTTTTCTAGGCCCGG + Intergenic
1146818737 17:35967089-35967111 TTTCAAATCTTTTTTTGGGAAGG + Intergenic
1147182528 17:38695621-38695643 TTAAAAAATTTTTTTAGGGCCGG + Intergenic
1147688774 17:42302635-42302657 TTAAAAATGTTTACTGAGGCTGG + Intronic
1147731058 17:42602514-42602536 TTAAGAAGCTTTTCCAGGGCTGG - Intronic
1147818505 17:43227778-43227800 TTAAAAATGTTATTTTGGCCGGG - Intergenic
1147831789 17:43302480-43302502 TTAAAAATGTTATTTTGGCCGGG - Intergenic
1147854291 17:43467093-43467115 TTCAAAATCCTTTCCTGGCCGGG + Intergenic
1148032341 17:44629899-44629921 TTAAAAAATTTTTTTTGGACAGG - Intergenic
1148538578 17:48461570-48461592 TTAACAATTTTTTTTTGGCCAGG - Intergenic
1148573494 17:48690011-48690033 CTTAAAATCTTTTCTTAGGTTGG - Intergenic
1148619645 17:49024893-49024915 TTAATAATAATGTCTTGGGCCGG + Intronic
1148710881 17:49679829-49679851 TTTAAAAATTATTCTTGGGCTGG + Intergenic
1148832366 17:50442006-50442028 TTAAAAACATTTTTTTTGGCTGG + Intronic
1149050228 17:52295677-52295699 TTAAAAGTCAGTTCCTGGGCCGG - Intergenic
1149078378 17:52624332-52624354 TAAGAAATCTTTTTATGGGCTGG - Intergenic
1149146987 17:53505897-53505919 TTTAAAATCTTTTCTGGGCCGGG - Intergenic
1149438170 17:56651807-56651829 TTAATACTCTATTCTTGGCCAGG - Intergenic
1149676836 17:58472304-58472326 TTAAAACACTTTTTTTGGGGGGG - Intronic
1149713297 17:58762599-58762621 TTAAAAAATTTGTTTTGGGCCGG + Intronic
1149741160 17:59046834-59046856 TTAAAAATTTGTTTTTCGGCTGG - Intronic
1149802505 17:59583582-59583604 TTAAAAAATTTTTTTTAGGCCGG + Intronic
1149843986 17:59991910-59991932 TAAAAAATTTTTTTTTAGGCCGG - Intergenic
1150037886 17:61824109-61824131 TTAAAAATTCTATCTTAGGCCGG - Intronic
1150048050 17:61932556-61932578 ATAAAAATCTGTTTTTGGGTTGG - Intergenic
1150486157 17:65545391-65545413 TTAAAAAAATTTTTTTTGGCAGG + Intronic
1150642123 17:66956360-66956382 TTCAAATTCTTTTCTTGTCCAGG - Intergenic
1150725414 17:67647605-67647627 TTAAAAATAGCTTCCTGGGCTGG - Intronic
1151325691 17:73378713-73378735 TTAAAAATCATTTCTAGGCTGGG - Intronic
1151606311 17:75138701-75138723 TTAAAGACCTCTTCTTGGCCGGG - Intronic
1151731794 17:75915710-75915732 TTAAAAACATTTTTTTGGGCCGG + Intronic
1151740121 17:75975646-75975668 TTAAAAATGTTTTCTCAGCCAGG + Intronic
1151793938 17:76329436-76329458 TTAAAAACCATTGCCTGGGCCGG + Intronic
1151870961 17:76836475-76836497 TTAAAAAGCATGTCTTGGCCGGG + Intergenic
1152512139 17:80797577-80797599 ATTAAAAACTTTTCTTTGGCTGG - Intronic
1152905668 17:82969502-82969524 TTTAAAATTTTTACTTAGGCCGG - Intronic
1153046865 18:864044-864066 TTAAAAATGTCATTTTGGGCCGG + Intergenic
1153854596 18:9133769-9133791 TTAAAAATGTTCTCTGGGGTTGG + Intronic
1154081669 18:11263265-11263287 TTAAAAATATTATTTTAGGCTGG - Intergenic
1154225358 18:12498542-12498564 TTAGAAGTTTTTTGTTGGGCCGG - Intronic
1154523238 18:15252890-15252912 TTAAAAATATTCCCTTTGGCTGG + Intergenic
1154943850 18:21141243-21141265 TTTAAAATATTGTATTGGGCCGG + Intergenic
1154975978 18:21458265-21458287 TAAAAAAACTGTCCTTGGGCCGG - Intronic
1155017033 18:21853689-21853711 TTAGAAATCTTTTCTTTGTGAGG + Intronic
1155305674 18:24475710-24475732 TTAAAAATCCTTTTTGGGCCAGG + Intronic
1155628670 18:27865202-27865224 TTAAAAATAAATCCTTGGGCTGG - Intergenic
1155722477 18:29033918-29033940 TAAAAAATCATTTCTCGGCCAGG - Intergenic
1155950368 18:31904732-31904754 TAAAACATGTTTTCTTGGCCAGG + Intronic
1155967953 18:32053613-32053635 TTAAAAATTTTTTCTAGAGATGG - Intronic
1156277112 18:35594068-35594090 TTTTAAATCTTTTCTTTGGGCGG + Intronic
1156907444 18:42370660-42370682 TTAAAAATGCTTTCAAGGGCTGG + Intergenic
1157003125 18:43550604-43550626 GTAAAAGTGTTTTCATGGGCTGG - Intergenic
1157261691 18:46180963-46180985 TTAAATGTCGTTTTTTGGGCTGG + Intronic
1157871960 18:51238157-51238179 TTAAAAAACTATTTTTGGCCTGG + Intergenic
1157932665 18:51840568-51840590 TTAAAAATGCTTTGCTGGGCGGG + Intergenic
1158445331 18:57515532-57515554 TGAAAAATATTTTTTTGGCCAGG - Intergenic
1158461196 18:57647746-57647768 TTAAAAAATTTTTTTTGAGCTGG + Exonic
1158637673 18:59175835-59175857 TTAAAAATGTTTTATGGGCCGGG + Intergenic
1159041616 18:63328654-63328676 TTATAAATCTTTCTCTGGGCCGG - Exonic
1159090506 18:63843400-63843422 TTAAAAATCATATCTTGGCCGGG + Intergenic
1159115142 18:64105163-64105185 TAAAAAATGTTTTCTAGGCCGGG + Intergenic
1159123005 18:64191942-64191964 TTAGGAATCCTTTCTTGGTCTGG + Intergenic
1159985691 18:74838210-74838232 CTAAAAATATATTCTTGGGACGG - Intronic
1160311750 18:77798931-77798953 ATAAAATTCTGTTCTTGGCCGGG + Intergenic
1160813237 19:1022503-1022525 TTAAAAACATTTTTTTGGGGGGG - Intergenic
1161078525 19:2298833-2298855 TTAAAAAAAATTTCTTGGGCCGG - Intronic
1161141419 19:2650481-2650503 TTAAAAATGATTCCTAGGGCTGG - Intronic
1161154382 19:2724736-2724758 TTAAAAAATTTTTCTCGGCCGGG + Intronic
1161475499 19:4482631-4482653 TTAAAAATCTTTCCTTTAGCAGG - Intronic
1161484434 19:4527366-4527388 TTAAAAATTTTTTTTTAGGCCGG - Intronic
1161898629 19:7101152-7101174 TTAAAGATAGTTTCGTGGGCAGG - Intergenic
1161946297 19:7439292-7439314 TTAAAAATATTTTCTTGTAGAGG - Intronic
1162009069 19:7800609-7800631 TTAAAAGTCTTTTCGTTGGCCGG + Intergenic
1162112526 19:8407656-8407678 TTAAAAATGTTTTATGGGGTGGG + Intronic
1162383354 19:10345552-10345574 TTAAAAATTTTGGCTGGGGCCGG - Intergenic
1162434597 19:10649895-10649917 TGAAAAATGTTGTCTTGGCCAGG - Intergenic
1162688902 19:12412741-12412763 TAAACAATCTTATCCTGGGCTGG + Intronic
1162765994 19:12919771-12919793 TTAAAAATATTTTTCTGGCCGGG + Intergenic
1162916209 19:13875822-13875844 TTAAGAAACTTTTATTGGCCAGG - Intronic
1163056976 19:14727322-14727344 TTAAACCTCTTTTCTTGGGCCGG - Intronic
1163084034 19:14966193-14966215 TTAAAAAATTTTTCATAGGCCGG + Intronic
1163172865 19:15544762-15544784 TTTAAAAGCTTTGCTTGGGCCGG + Intronic
1163522790 19:17801789-17801811 TTAAAAAAATTTTTTTTGGCTGG + Intronic
1163728425 19:18935721-18935743 TTAAAAATAATTTTTTAGGCCGG + Intronic
1163833577 19:19559894-19559916 TTAAAAAACATTTTTTTGGCCGG - Intergenic
1163991712 19:21005083-21005105 ATAAAAATCTTACCTTGGCCGGG + Intergenic
1164077284 19:21831654-21831676 TTTAAAAGCTTTTCTGGAGCCGG - Intronic
1164145103 19:22507803-22507825 TTAAAAATGTTTATTTAGGCTGG + Intronic
1164180501 19:22814105-22814127 TTAAAAATGTTTTGCTGGCCGGG - Intergenic
1164310714 19:24043556-24043578 TTAAAATTTTTTGCTTTGGCCGG - Intronic
1164465089 19:28480986-28481008 TTAAAAAGTTCTTCTTGGCCAGG - Intergenic
1164614273 19:29656974-29656996 TTAAAAATCTAAACTTGGGCCGG - Intergenic
1164879070 19:31715496-31715518 TCAAAAATGTTTTCCTGGGGAGG - Intergenic
1165387879 19:35522153-35522175 TTAAAAATTATTTTTTTGGCCGG - Intergenic
1165492454 19:36132461-36132483 TAAAAATTATTTGCTTGGGCCGG - Intergenic
1165567433 19:36743050-36743072 TTAAAAATATTTCCTTGGCCAGG + Intronic
1165657492 19:37547221-37547243 TTAAAAATCTTAAATTAGGCTGG + Intronic
1165876105 19:39007966-39007988 TTAAAAATGTTTTATTGGCTAGG + Intronic
1166101604 19:40574717-40574739 TTAAAAATAGTTTCTTGGCCTGG + Intronic
1166747648 19:45149165-45149187 TTAAAGATCTTTTTTTGGCCAGG - Intronic
1166819120 19:45565778-45565800 TTAAAAATCTTTTTGTGGCCGGG - Intronic
1167022509 19:46888695-46888717 TTTAAAACCTGTTCTTTGGCCGG + Intergenic
1167039953 19:47018077-47018099 TTAAAAATGTTTTGTTGGCCGGG - Intergenic
1167085371 19:47306091-47306113 TTAAAAATCTGGTTTTCGGCCGG - Intronic
1167952955 19:53042328-53042350 TTTAAAATCTTTGTTTGGGCCGG - Intergenic
1168134395 19:54340444-54340466 TTAAAAATCAATTCTATGGCCGG + Intergenic
1168233127 19:55045648-55045670 TTAAGGATCTTTTTTTGGCCAGG + Intronic
1168278593 19:55291240-55291262 TTAAAGATTTTTTTTTTGGCTGG + Intronic
1168603591 19:57740319-57740341 TTAAAATTCCTTTTTTGTGCGGG + Intronic
1168655097 19:58121701-58121723 TTGAAAAAATTTTCTTAGGCTGG - Intergenic
1168668909 19:58226592-58226614 TTAAAAATGTTACCTTTGGCTGG - Intergenic
1202642838 1_KI270706v1_random:111632-111654 TTTAAAATATTTACTTGGCCAGG - Intergenic
925440849 2:3883855-3883877 AGAAAAATCCTTTCTTGGCCAGG + Intergenic
925564256 2:5232603-5232625 TTTATAACCTCTTCTTGGGCTGG - Intergenic
925632286 2:5906963-5906985 GAAAAAATCATTTCTTGGCCAGG + Intergenic
925734067 2:6944874-6944896 TAAAAAATCTTTGCTCGTGCTGG - Intronic
925844372 2:8021992-8022014 TTAGTAATCTTTTCTTTGGCTGG + Intergenic
926028225 2:9563313-9563335 TTGAACTTATTTTCTTGGGCAGG - Intergenic
926184567 2:10679061-10679083 TAAAAAATATTTTTTTTGGCCGG + Intronic
926305234 2:11633264-11633286 TTAAAAAATTGTTATTGGGCCGG + Intronic
926709151 2:15862564-15862586 TTAAAAACATTCTGTTGGGCTGG - Intergenic
927164887 2:20308148-20308170 TTAAACATTTTTTCTTTGGGAGG + Intronic
927329087 2:21841558-21841580 AGAAAAATGTTTTCATGGGCTGG + Intergenic
927369423 2:22337506-22337528 TTAAAAATCTTTATTAGGCCGGG + Intergenic
927433987 2:23051589-23051611 TTAAAAATCATTTCTGGGTTGGG + Intergenic
927549776 2:23987826-23987848 ATAAAGAACTTTTCTTGGCCAGG + Intronic
927619284 2:24635012-24635034 TTGAAAGTGTTTTCTAGGGCAGG - Intronic
927701554 2:25272281-25272303 TTAAAAAGACTTTTTTGGGCTGG - Intronic
927782910 2:25953961-25953983 TTAAAAATTATTTTTAGGGCCGG - Intronic
927816155 2:26219419-26219441 TTAATAATTTTTTATTGGCCGGG - Intronic
928349069 2:30530712-30530734 TTAAAAATTTTTTGTAGAGCTGG + Intronic
928708295 2:33976195-33976217 TAAAAAATCATTTCTGGGCCGGG - Intergenic
928908598 2:36395295-36395317 TTAAAAATCTGTTTTTGGCTGGG - Intronic
928916594 2:36478516-36478538 TAAAAAATCTTCTCTTGCTCAGG + Intronic
928949187 2:36799415-36799437 TTTAAAAAGTTTTCTTGGCCAGG + Intronic
928978149 2:37110389-37110411 TTAAAAACCTTTTGTTGGCTGGG - Intronic
929102766 2:38332500-38332522 TTAAAAATGTTTCCATTGGCGGG - Intronic
929112888 2:38420270-38420292 TTAAAAATTATGTCTTGGCCAGG - Intergenic
929184016 2:39074569-39074591 CTAAAAATATTTTCTCTGGCTGG + Intronic
929426175 2:41846826-41846848 TTAAGGATCTTCTCTGGGGCTGG - Intergenic
929495628 2:42439936-42439958 TTAAAAATATTTTCTTGGCCAGG - Intergenic
929678725 2:43966701-43966723 TTAAAAATTTTGTATTGGCCGGG - Intronic
929814685 2:45221506-45221528 TCAAAAAGCTTTACTTGGGAGGG - Intergenic
929840987 2:45462869-45462891 TAAAAAATCTATTTTTGGGTGGG - Intronic
930039589 2:47110295-47110317 TTAAAAATTATATTTTGGGCTGG + Intronic
930046671 2:47178408-47178430 TCAAAAATCTTTTCTTTGCCAGG + Intergenic
930185903 2:48411743-48411765 TTAAAAATATTTTCTAGGCTGGG - Intergenic
930481458 2:51952931-51952953 AGAAAAATGGTTTCTTGGGCTGG - Intergenic
930817101 2:55609383-55609405 TTTAAGACCTTTTCATGGGCTGG + Intronic
930824369 2:55681547-55681569 ATAAAAATATTTTCTAGGCCAGG + Intronic
930942158 2:57026016-57026038 AAAAAAATGTTTTCATGGGCTGG - Intergenic
931061286 2:58532499-58532521 TTAAAAATTTTTTGTAGAGCTGG + Intergenic
931236280 2:60415435-60415457 TTAAAAATTATTTCTCAGGCCGG + Intergenic
931330372 2:61275104-61275126 TTAAAAATCTTTTGTAGAGACGG - Intronic
931374070 2:61692121-61692143 TAAAAAATATTTTCTTGGCCAGG - Intergenic
931374723 2:61696833-61696855 TTAAAAAATTTTTTCTGGGCGGG + Intergenic
931452634 2:62381141-62381163 TTAAAAATTTAATCTTGGCCAGG + Intergenic
931528123 2:63180933-63180955 TTAAAAATTTTTTCATATGCAGG + Intronic
931555886 2:63504390-63504412 TTAAAAATATTTTTCTGGGCAGG + Intronic
931594162 2:63923014-63923036 TTAAAAAGATTTTTTGGGGCTGG + Intronic
931641937 2:64388774-64388796 TCAAAAATCTTTTGTTGGGGTGG + Intergenic
931726239 2:65113782-65113804 TAAAAAATCTTTTGAGGGGCTGG + Intronic
932038348 2:68271237-68271259 TTAAAAATCATTTTGTGGCCAGG - Intergenic
932155778 2:69415831-69415853 TTAAGAAGCTTTTCCTGGTCAGG + Intronic
932302564 2:70677493-70677515 TTAAAACTCATTTTGTGGGCAGG + Intronic
932378551 2:71260611-71260633 TTAAAAATCCTTTGTGAGGCCGG + Intergenic
932679500 2:73812503-73812525 TCAAAAAGCATTTCTTGGCCAGG + Intronic
933199938 2:79436925-79436947 TTAAGAATATTTAATTGGGCCGG - Intronic
933331626 2:80899632-80899654 TTAGAAATATTTTCGTGGGCCGG + Intergenic
933739177 2:85519768-85519790 TTAAAAATCATTGCTTTGGCTGG - Intergenic
933740959 2:85533476-85533498 TTAAGAATCCTTGCTAGGGCCGG - Intergenic
933910206 2:86934064-86934086 TTGAAAAAATATTCTTGGGCCGG + Intronic
934022522 2:87969345-87969367 TTGAAAAAATATTCTTGGGCCGG - Intergenic
934097699 2:88622191-88622213 TTAAAAGTCTTTCATAGGGCCGG - Intronic
934159748 2:89237566-89237588 CTAAAAATCTTCTTTCGGGCTGG + Intergenic
934207531 2:89944865-89944887 CTAAAAATCTTCTTTCGGGCTGG - Intergenic
934321813 2:91977660-91977682 TTAAAAATATTTTTTAGGCCAGG - Intergenic
934571988 2:95378436-95378458 TTTAAAATATTTTCATTGGCCGG + Intronic
934711657 2:96519184-96519206 TTTAAGATCTTTGCTTGGGAGGG + Intergenic
935019323 2:99215070-99215092 TAAAAAATGTTTTCGTGGGCTGG - Intronic
935091012 2:99894768-99894790 TTAAAAGTATTTTCCTGGCCGGG - Intronic
935224443 2:101040763-101040785 TTAAAAGTATTTTCTTGGCTGGG - Intronic
935288787 2:101591194-101591216 TTAAAAATACTTTATTGGCCGGG + Intergenic
935406670 2:102717326-102717348 TTAAGAATCATTTCCTGGCCAGG - Exonic
935641560 2:105295515-105295537 TTAAAAATGTTCTCCTGGCCGGG + Intronic
935979194 2:108609845-108609867 TTAAAAATATTTTATTGGCCGGG + Intronic
936158405 2:110064816-110064838 TTAAAAATCTAATCCTAGGCTGG - Intergenic
936186256 2:110306506-110306528 TTAAAAATCTAATCCTAGGCTGG + Intergenic
936551707 2:113448607-113448629 TTAAAAATCTGTTGCTGGCCGGG + Intronic
936600290 2:113889229-113889251 TTAAAAAAATTTTCTTTGGAGGG + Intergenic
936765220 2:115839377-115839399 TTAAAAATGTTAGCTTAGGCTGG + Intronic
937163326 2:119787149-119787171 TTACAAATCTTCTCCTGGGCTGG + Intronic
937179363 2:119976290-119976312 TTAAAAATAGTTTCTTGGCCGGG - Intronic
937275722 2:120682744-120682766 TTAAAAATCGAATTTTGGGCCGG - Intergenic
937578774 2:123458052-123458074 TTAAAAATATTTTTTCAGGCTGG + Intergenic
937730363 2:125222785-125222807 AAAAAAATGTTTTTTTGGGCTGG - Intergenic
937761026 2:125603914-125603936 GAAAAAATGGTTTCTTGGGCTGG + Intergenic
937950577 2:127384188-127384210 TTAAAAATTATTTGTTGGCCGGG - Intronic
938110584 2:128561992-128562014 TTTAAAATATTTGCTTGAGCGGG - Intergenic
938522542 2:132085762-132085784 TTAAAAATATTCCCTTTGGCTGG + Intergenic
938603990 2:132873407-132873429 TTAAAAAACATTTTTTCGGCTGG - Intronic
938712074 2:133983616-133983638 TTAAACCTCTTTTCTTGGCCAGG - Intergenic
938877683 2:135550050-135550072 TTTAAAATCTTTTCATGATCTGG + Intronic
938880023 2:135576099-135576121 ATAAAAATGGTATCTTGGGCTGG + Intronic
939131034 2:138236462-138236484 TTAAAACTCTTTTTCTTGGCCGG + Intergenic
939438086 2:142204727-142204749 ATAAAAAGCTTTTACTGGGCTGG + Intergenic
939781855 2:146459067-146459089 TCAAAAATGGTTTCCTGGGCTGG - Intergenic
939902039 2:147862444-147862466 TTAAAATTGTTTTCCTGGGCAGG + Intronic
939963830 2:148591522-148591544 TTAAAAATAATTTCGTGGGCTGG + Intergenic
939971292 2:148664200-148664222 TTAAAAATAATTTATTAGGCTGG + Intronic
940043229 2:149382171-149382193 CTAAAAATGTATTTTTGGGCTGG - Intronic
940147274 2:150559470-150559492 TTTAAAAAGTTTTCTTGGCCGGG + Intergenic
940318182 2:152346775-152346797 AAAAAAATCTTTTCATGGCCAGG + Intronic
940331117 2:152475792-152475814 TTAAAAATCTATTCTTGGCCAGG - Intronic
940718712 2:157258263-157258285 TAAAAAATTTTTCCTTGGTCTGG - Exonic
940935633 2:159491423-159491445 TTAAAAGTCTTCTGTTGGCCAGG + Intronic
941188568 2:162347034-162347056 TCAAAAATCTTTTAAGGGGCGGG - Intronic
941374486 2:164710241-164710263 TAAAAAACCTTCTCTTGGGGAGG + Intronic
941552939 2:166939383-166939405 TGAAAATTCTTTTCTTGGGCTGG + Intronic
941649783 2:168080738-168080760 AAAAAAATGGTTTCTTGGGCTGG + Intronic
941652071 2:168102632-168102654 TTAAAAATCTCTTCTCAGCCAGG + Intronic
941794151 2:169581709-169581731 TTAAAAATGCTTTTTGGGGCCGG - Intergenic
941839733 2:170068063-170068085 TTAAAAATATTTTCTAGGCTGGG - Intronic
941902286 2:170690009-170690031 TTAAAAATCCTTTCTTGGCTGGG + Intergenic
941926555 2:170901249-170901271 TTAAAAATCATGTAATGGGCAGG - Intergenic
941967233 2:171312374-171312396 GGAAAAATGGTTTCTTGGGCTGG + Intergenic
942025267 2:171904706-171904728 TTAAATCTCTTCTCTTGGCCGGG + Intronic
942166090 2:173242461-173242483 TTGAAAATATTTTCTTGGCCAGG - Intronic
942557370 2:177185748-177185770 ATAAAAAGCTTTACTTGGCCAGG - Intergenic
942586848 2:177489377-177489399 TTAAAAATATTTCCTTGGCCAGG - Intronic
942713172 2:178861337-178861359 TTAAAAATTTTTTGTAGGGCCGG + Intronic
943091526 2:183381171-183381193 TTAAAAATAATTTCTAGGCCAGG - Intergenic
943506092 2:188759519-188759541 TTTAAAATCTGTTTTTGGCCAGG - Intronic
944417188 2:199490661-199490683 TTAAAAATCTGTCTTTAGGCTGG - Intergenic
944447634 2:199807340-199807362 TTAAAAATTATTTATTGGCCAGG + Intronic
944449032 2:199822105-199822127 TTAAAAATACTTTATTGGCCAGG + Intronic
944549480 2:200832192-200832214 TGAAAAATCTATTCCTGGCCGGG + Intergenic
944582850 2:201147528-201147550 TTAGAAAGCTTTTCTGGGGTGGG - Intronic
944713204 2:202354460-202354482 TTAAAAAAATTTTCTTGGCCGGG - Intergenic
944800880 2:203236943-203236965 TTAAAACTCTTATGTTTGGCCGG + Intergenic
945087303 2:206145294-206145316 TTAAAAATTTTTTGTAGAGCCGG + Intronic
945591402 2:211736408-211736430 ATAAAAATGTATTGTTGGGCAGG + Intronic
945774082 2:214082735-214082757 TTAAAAATCATTTATTTGCCTGG + Intronic
946256031 2:218442623-218442645 TTAGAAATGTGTTCTTAGGCTGG - Intronic
946706641 2:222464777-222464799 TTAAAACCCTGTGCTTGGGCTGG - Intronic
947167467 2:227277022-227277044 TTAAAAATTTTTTCTTGGCCGGG + Intronic
947284982 2:228504402-228504424 TTAAAACTCTACTCTTGGCCGGG - Intergenic
947387753 2:229608925-229608947 TTAAAAATGTGATCTTGGTCGGG + Intronic
947706394 2:232279822-232279844 TTAAAAATCCTTTCCAGGCCAGG - Intronic
947775069 2:232701989-232702011 TTAAAAATCTTTTTTAGAGATGG - Intronic
948018121 2:234706782-234706804 TTTAAAATCTGTTCTTGGCTGGG + Intergenic
1168920198 20:1527137-1527159 TTAAAAATATTTTCTAAGCCAGG + Intergenic
1169239994 20:3968701-3968723 TGCAAAATCTTTTCTTGAGTGGG + Intronic
1169241105 20:3981820-3981842 TTTAAAATATTCTATTGGGCCGG + Intronic
1169326510 20:4681006-4681028 TTAAAAATTTATTATTGGCCTGG - Intergenic
1169432797 20:5554278-5554300 TTGAAAATCTGTTGTTCGGCCGG - Intronic
1169500538 20:6156351-6156373 TTAAAAATCTCTTGTCAGGCTGG + Intergenic
1169504683 20:6196343-6196365 ATAAAGATCTTTTTTTGGGCAGG + Intergenic
1170056201 20:12206686-12206708 TTAAAACTCTATTCTTTTGCAGG + Intergenic
1170263340 20:14437296-14437318 TTAAAAAGGGTTTCTTGGGCCGG + Intronic
1170639698 20:18140512-18140534 TTAAAAACCATTTATTGGCCAGG + Intronic
1170691650 20:18621767-18621789 TTAAAAAAATTTTTTTGGCCAGG + Intronic
1171224747 20:23432774-23432796 TTAAAAATGTTTCATTGAGCAGG - Intergenic
1171433472 20:25102195-25102217 GTAAAACTCATTTCTTGGCCAGG - Intergenic
1171500602 20:25589904-25589926 TTAAAAACATTTTCTTGGCCAGG + Intergenic
1171889955 20:30701839-30701861 TTTAAAATATTTACTTGGCCAGG - Intergenic
1171955564 20:31460324-31460346 TTAAAAATTGTGTCTTGGCCGGG + Intergenic
1172048428 20:32098324-32098346 TTAAAAAAATTTTTTTGGCCAGG - Intronic
1172070872 20:32255972-32255994 TTAAAAATCTATTTTAGGTCGGG + Intergenic
1172171124 20:32933681-32933703 TTAAAAACCTCTTTTTGGCCGGG + Intronic
1172242851 20:33424806-33424828 TTAAAAATTTTTTGTAGGCCAGG - Intronic
1172341900 20:34164621-34164643 TTAAAATACTTTTCATGGGCTGG - Intergenic
1172380191 20:34483111-34483133 CTAAAAATGGTTTCATGGGCCGG - Intronic
1172648271 20:36485087-36485109 TTCAAATTATTTTCTTTGGCCGG + Intronic
1172706527 20:36886297-36886319 TTAAAAATTTGTTTTAGGGCCGG + Intronic
1172923634 20:38510612-38510634 TTGAAAATCTTTTATAGGGCCGG + Intronic
1173245952 20:41337609-41337631 TTAAAAATTTTTTGTAGGGATGG - Intergenic
1173392705 20:42649112-42649134 TTAAACCTCTTTCCTTGGCCGGG - Intronic
1173426991 20:42951938-42951960 TTAAAAACATTTTCTTGGCCAGG - Intronic
1173522006 20:43707008-43707030 TTAAAAAAATTTTTTTTGGCTGG - Intronic
1173604717 20:44323723-44323745 TTAAAAATGATTTCCTGGCCGGG - Intergenic
1173651323 20:44666913-44666935 ATAAAAAGATTTTCTTGGCCGGG + Intergenic
1173721714 20:45264358-45264380 TCACAAATCATTTCTTGGGAGGG - Intergenic
1173747868 20:45451831-45451853 TCAAAAACCTTTTCCTGGGCCGG - Intergenic
1173962555 20:47086369-47086391 TTAAACCTCTTTTCTTTAGCTGG - Intronic
1174019505 20:47518718-47518740 TTAAAAATCCTCTATTGGCCAGG - Intronic
1174345996 20:49930240-49930262 TTAAAAATATTTTTTGGGCCAGG + Intergenic
1174490160 20:50887232-50887254 TTAAAAATCCTTATTTTGGCCGG - Intergenic
1174614577 20:51825891-51825913 TTAAAAATTTTTTTGTAGGCTGG - Intergenic
1175297169 20:57916443-57916465 CTAAGAATATTTTCTTGGGTGGG - Intergenic
1175566862 20:59986894-59986916 TTCAAAATCTTTTCCTGGCTTGG + Intronic
1175710889 20:61219894-61219916 TTAAAAATTGTTTCTTGGCCAGG - Intergenic
1176609038 21:8860994-8861016 TTTAAAATATTTACTTGGCCAGG + Intergenic
1176774153 21:13115296-13115318 TTAAAAATATTCCCTTTGGCTGG - Intergenic
1177149157 21:17437354-17437376 TTAATAATCTTTCCTTGACCAGG + Intergenic
1177485189 21:21747054-21747076 TTAAAACTCTTTTCCTGGCCGGG + Intergenic
1177530036 21:22346610-22346632 TGAAAAATCTTTCCCTGGGGTGG + Intergenic
1177573765 21:22924040-22924062 TTAAAAATACTTGTTTGGGCTGG + Intergenic
1177607794 21:23404455-23404477 TGAAAAACCATTTCTTGGCCAGG + Intergenic
1177721976 21:24918883-24918905 TGAAAATTATTTTCTTGGTCAGG + Intergenic
1177843291 21:26258679-26258701 TTAAAAACATCATCTTGGGCTGG + Intergenic
1177908558 21:27001146-27001168 TTAAAAATTTTTTCTAGAGATGG - Intergenic
1177942588 21:27429663-27429685 TTGAAAATCTCTTCTTGAGCTGG + Intergenic
1178255807 21:31051487-31051509 TAATAAAACTTTTCATGGGCTGG - Intergenic
1178413023 21:32381330-32381352 TTAACAATGCTTTCTTTGGCTGG + Intronic
1178545969 21:33493280-33493302 TTAAAAATTTTTTAGTGGCCAGG - Intergenic
1178845879 21:36173717-36173739 TGAAAATGTTTTTCTTGGGCCGG - Intronic
1178846111 21:36175493-36175515 TTAAAAATCCTGTCTCCGGCCGG + Intronic
1178910227 21:36668069-36668091 CAAAAAATCTTTTCCTGGCCAGG + Intergenic
1179203818 21:39253968-39253990 TAAAATATCATTTCTTAGGCTGG + Intronic
1179651288 21:42810730-42810752 TTCAAAATCTATTCTTTGGCTGG + Intergenic
1179796303 21:43786256-43786278 TAAAAAATCTCTTCTCGGGCTGG - Intergenic
1179802065 21:43815714-43815736 TTAAAAAACTTTTCATGTTCTGG + Intergenic
1179901657 21:44397331-44397353 TAAAAATTCCTTTCCTGGGCCGG - Intronic
1180359130 22:11870826-11870848 TTTAAAATATTTACTTGGCCAGG + Intergenic
1180438910 22:15344571-15344593 TTAAAAATATTCCCTTTGGCTGG - Intergenic
1180548559 22:16523578-16523600 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1180689085 22:17695614-17695636 TTAAAAAAATTTTTTTTGGCTGG - Intronic
1180730983 22:17982379-17982401 TATAAAATGTTTTCTTGGCCAGG + Intronic
1181152092 22:20891792-20891814 TTAAAAATTTTTTCTAGAGGTGG - Intergenic
1181516001 22:23413696-23413718 TTAAAAATACTCTCTTGGGCGGG - Intergenic
1181536103 22:23546299-23546321 TCAAAAATTTTTTCTTGGCTGGG - Intergenic
1181564227 22:23724493-23724515 TTAATTATCTTTTTTTTGGCTGG + Intergenic
1181816436 22:25440704-25440726 TTAAATCTCTGTTCTTGGCCAGG - Intergenic
1181878801 22:25960850-25960872 TAAGAAATCTTTTATGGGGCCGG + Intronic
1181930777 22:26399708-26399730 TTAAAAATCTGTTCGGGGCCAGG + Intergenic
1182193437 22:28488986-28489008 TAAAAAATCATTACTTGGCCAGG + Intronic
1182210894 22:28676858-28676880 TTAAAAATATTTTTTAGGCCAGG + Intronic
1182232842 22:28851899-28851921 TAAAAAATCTGGTCCTGGGCTGG - Intergenic
1182410137 22:30177974-30177996 TTAAAAAGCTCCTCCTGGGCTGG - Intergenic
1182463163 22:30496417-30496439 TTAAAAAACATTTCTAGGTCAGG - Intronic
1182783229 22:32884582-32884604 TTCAAAATCATTTCGTGGCCGGG + Intronic
1183127591 22:35799649-35799671 TTAAAAATAATTACTTCGGCTGG + Intronic
1183213063 22:36462784-36462806 TTTAAAATTTATTTTTGGGCCGG + Intergenic
1183215614 22:36477838-36477860 TTGAAAGTGTTTTCTTTGGCCGG + Intronic
1183455360 22:37919689-37919711 TTAAAAAATTTTTTTTTGGCCGG + Intronic
1183455361 22:37919690-37919712 TAAAAAATTTTTTTTTGGCCGGG + Intronic
1183530383 22:38350245-38350267 TTAAAAATTATTTCCTGGCCAGG - Intronic
1183541715 22:38433150-38433172 TTAAAAATTTATTATTGGCCGGG + Intronic
1183696092 22:39423307-39423329 TTAAAAATCATGTATTGGCCGGG + Intronic
1183822028 22:40353920-40353942 TTAAAAGCCTATGCTTGGGCCGG - Intronic
1183875216 22:40774518-40774540 TTGAAAAATTTTTCTTAGGCCGG - Intronic
1184066243 22:42123446-42123468 TAAAAAATCTATAATTGGGCTGG - Intergenic
1184068711 22:42135598-42135620 TAAAAAATCTATAATTGGGCTGG - Intergenic
1184074715 22:42168990-42169012 TTAAAAATTATTTCTGGGGAAGG - Intronic
1184507204 22:44911424-44911446 GAAAAAATGTTTTCTTAGGCTGG + Intronic
1184710877 22:46248723-46248745 TTAGAACTGTTTTCTTGGCCAGG + Intronic
1185196240 22:49471600-49471622 TTAAAAATCATTTCCTGGTTGGG + Intronic
1185261024 22:49863330-49863352 TTAAAAATTTTTTTGTAGGCCGG + Intronic
949340718 3:3027668-3027690 TTAAAACCAATTTCTTGGGCAGG + Intronic
949344435 3:3063730-3063752 TTAAAACTCTTTTCTGGGCTGGG - Intergenic
949557646 3:5171025-5171047 TTAAAAATCTATTCTTGGCCAGG - Intronic
949932016 3:9086228-9086250 TTAAATATGTTTGCTTGGCCAGG + Intronic
950000512 3:9652584-9652606 TTAAAAATTTTTTGTTGGCTGGG + Intronic
950006711 3:9696200-9696222 TTAAAAATCTCTTCTCAGCCGGG + Intronic
950085118 3:10251850-10251872 TAAAAATTTTTTTTTTGGGCTGG + Intronic
950237610 3:11337157-11337179 TAAAAAATATTTTCTTGGCCAGG + Intronic
950378279 3:12590082-12590104 TTAAAAACTTTTTCCTGGCCAGG - Intronic
950380601 3:12611388-12611410 TTAAAAATCTTTTGTAGAGATGG + Intronic
951164351 3:19466954-19466976 TTAAAAATATTTTATTGGCCGGG - Intronic
951322681 3:21265907-21265929 TTAAGTATGTTTTCTTGGTCAGG - Intergenic
951411925 3:22376087-22376109 TTAAAAAACTTTTCCAGGGCCGG - Intergenic
951487195 3:23226533-23226555 TTAAAGATGTTTTCCTGGCCGGG - Intronic
951605067 3:24423885-24423907 TTAAATATCTTGTCTTCTGCTGG - Intronic
951787873 3:26442933-26442955 TTAAAAATCTTTTGTAGAGATGG + Intergenic
951858236 3:27222075-27222097 TCAAAAAACTTTTCCTGGCCAGG + Intronic
952013697 3:28932043-28932065 TTAATAATAATTTCCTGGGCTGG - Intergenic
952018882 3:28993077-28993099 TTAAAAATGTCTTCTCAGGCTGG + Intergenic
952201247 3:31130264-31130286 TTAAAAAACTTTTCTTGGGCTGG - Intergenic
952203274 3:31152534-31152556 ATAAAGATTTTTTCTTGGCCGGG + Intergenic
952416405 3:33094912-33094934 TTTAAAATATTCTCTAGGGCTGG + Intronic
952428489 3:33199566-33199588 TTAAAAAACTTTTTTTGGTTGGG - Intronic
952452260 3:33443065-33443087 TTAAAAAAATTTTTTTGGCCAGG - Intergenic
952575791 3:34773053-34773075 AAAAAAATTATTTCTTGGGCTGG + Intergenic
952765646 3:36951911-36951933 TTAAAAATATTATCCTGGCCGGG + Intergenic
953491793 3:43359234-43359256 TTAAGAATTTTATCTTAGGCTGG - Intronic
953951742 3:47196539-47196561 TTTAAAATCATTTTTTGGCCAGG + Intergenic
954153131 3:48669037-48669059 TTTAAGATCTTCTCTTGGCCAGG - Intergenic
954308638 3:49746715-49746737 TTAAAACTCCATTCTTGGCCGGG - Intronic
954357868 3:50097803-50097825 TTAAAAATGTTTACCTGGCCTGG + Intronic
954381750 3:50222529-50222551 TTAAAAAATTGTTCTGGGGCCGG + Intergenic
954398526 3:50306588-50306610 TTAAAAAAATTTTTTTTGGCTGG + Intronic
954694550 3:52414710-52414732 TTTAAAATCTATTTTTAGGCTGG + Intronic
954782290 3:53070739-53070761 TTAAAAGTTTTTTTTTGGCCAGG + Intronic
955008879 3:54995267-54995289 TTAAAAAACTTTCTTTGGCCAGG - Intronic
955025642 3:55164828-55164850 TTTAAAATGCTTTCTTGGCCTGG + Intergenic
955165211 3:56504293-56504315 TTAAAAATTTTCTCTTGGCTGGG + Intergenic
955276383 3:57551160-57551182 TTAAAAATTTTTGTTTTGGCTGG - Intergenic
955292867 3:57708455-57708477 TTAAAAATAATTTGTTGGCCGGG - Intergenic
955311817 3:57895644-57895666 TAAAAAGTTTTTTCTTGGCCAGG + Intronic
955335696 3:58083896-58083918 TTAAAAGTGCTTTCTTTGGCCGG + Intronic
955346636 3:58166523-58166545 TTAAAAATATCTTTTTGGCCTGG + Intronic
955363304 3:58291553-58291575 GTCAAAAACTTTTCCTGGGCTGG - Intronic
955432284 3:58859881-58859903 TTAAAAATCATTACTTGGCCAGG + Intronic
955659465 3:61281231-61281253 TTTAAAATCTTGACTGGGGCTGG - Intergenic
955677028 3:61459546-61459568 CCAAAATGCTTTTCTTGGGCTGG + Intergenic
956415994 3:69029735-69029757 TTAAAAGTATGTTGTTGGGCCGG - Intronic
956915669 3:73868359-73868381 TTTAAAGTCTTTTCTTTGGAAGG - Intergenic
957134768 3:76272366-76272388 TTAAAAATATATTTCTGGGCTGG + Intronic
957866486 3:86031025-86031047 TTATAAATTTTTTCTTAGGGTGG + Intronic
957996264 3:87693273-87693295 TCAAAATTATTTTCTTAGGCTGG - Intergenic
958025852 3:88048255-88048277 TTAAAAATATTTGCTAGGCCGGG + Intergenic
958052441 3:88365613-88365635 ATAAGGATCTTTTCTTGGGAAGG - Intergenic
958588566 3:96122600-96122622 TTAAAAATGTTTGCTTTGGGAGG - Intergenic
958626227 3:96627523-96627545 TTAAAAAAATTTTCCTGGGGAGG - Intergenic
958774111 3:98460773-98460795 TTAAAAATCTCTCATTTGGCAGG + Intergenic
958824542 3:99014800-99014822 TTAAAAACATTTTCTTGGCCGGG + Intergenic
959391553 3:105780954-105780976 TTAAAATGCTTTTATTGGCCAGG - Intronic
959851774 3:111096588-111096610 GGAAAAATGGTTTCTTGGGCTGG + Intronic
959921299 3:111871349-111871371 TTAAAACTTTGTTCTTGGCCCGG + Intronic
959960756 3:112295213-112295235 TAAAAAATCTATTCTCGGCCAGG + Intergenic
960460738 3:117931907-117931929 TTAAAAATATGTTCCAGGGCTGG + Intergenic
960609306 3:119540751-119540773 TTAAAAATCTTTTCAAGGCCAGG + Intronic
960976079 3:123175674-123175696 TTAAACATCTCTTCTTAGGTAGG - Intronic
961138738 3:124537335-124537357 TTAAAAAATTTCTCTTGGCCAGG - Intronic
961208234 3:125104403-125104425 TTAAAATTTTTTTCTGAGGCTGG - Intronic
961750534 3:129091488-129091510 TTAAAAAACCTTTTTTAGGCCGG + Intronic
961776787 3:129292777-129292799 ATAAAAAACTTTTCTCGGCCAGG - Intronic
961801999 3:129458031-129458053 TTTAAAATCTATTCCTGGCCGGG - Intronic
961811731 3:129525916-129525938 TAAAAAAAAATTTCTTGGGCCGG + Intergenic
961845550 3:129760015-129760037 TAAAAAAAATTTTTTTGGGCCGG - Intronic
961849346 3:129799512-129799534 TTAAAAACATTTTCTGGGGCCGG + Intronic
962079137 3:132118473-132118495 TTAATAAACTTTTTTTGGGGGGG + Intronic
962228131 3:133633492-133633514 TTAGAGCTCTTTTCTTTGGCTGG + Intronic
962232451 3:133677341-133677363 TTAAAAATCATTTATTGGCCGGG + Intergenic
962267334 3:133953331-133953353 TTAAAAATATTTCTATGGGCTGG - Intronic
962528270 3:136255168-136255190 TTAAAAATGCTTCTTTGGGCCGG - Intronic
962867242 3:139457686-139457708 TTAAAAATCTCTTCTGATGCAGG - Intronic
962994142 3:140608554-140608576 TTAAAAATTTTTTGTGGGGTTGG - Intergenic
963148988 3:142024088-142024110 TCAAAAATCTTTTAATGGGCTGG - Intronic
963177530 3:142315808-142315830 TTGAAAATCTTTTTTAGGCCGGG - Intronic
963515826 3:146306697-146306719 TAAAAAATTGTTTCTTGGGCTGG - Intergenic
963544761 3:146642770-146642792 TAGAAAATGTCTTCTTGGGCCGG + Intergenic
963596614 3:147336067-147336089 TCAAAAATCTACTCTTGGCCAGG + Intergenic
963638960 3:147835861-147835883 TTAAAAATCATTGCTTGTGGGGG + Intergenic
963803937 3:149704136-149704158 TTAAAAAGATATTCTTGGCCAGG - Intronic
963820107 3:149881624-149881646 TTAAAGATCTTATGTTGGCCGGG - Intronic
964026470 3:152080213-152080235 GGAAAAATGTTTTTTTGGGCAGG - Intergenic
964609120 3:158591453-158591475 TTTAAAATTTTTTCTTGGCCAGG - Intronic
964700195 3:159557211-159557233 TTAAGAATCTTTTTTTTGGGAGG - Intronic
965328504 3:167338962-167338984 CTATAAATCTTTTTTTGGCCTGG + Intronic
965397901 3:168182789-168182811 TTAAAAATCTTTTAGAGGCCCGG + Intergenic
965668083 3:171117672-171117694 TTAAAAATATGTTCTCTGGCCGG + Intronic
965720459 3:171655631-171655653 TTAAAAAGCTTATCTTGGGCAGG - Intronic
965747824 3:171943854-171943876 TTAAAACTCTCTTCTCAGGCTGG - Intergenic
965832376 3:172806936-172806958 TTAAGAATCATTTCTTGGCGGGG - Intronic
965978574 3:174657450-174657472 TTAAAAATTTTTTTGTGGCCGGG - Intronic
966203090 3:177377690-177377712 TTAAAACTATCTTCTTGGCCTGG + Intergenic
966553652 3:181233428-181233450 TTATAAAACTTTTCTTGATCTGG - Intergenic
966580556 3:181557588-181557610 TAAAAGATCTGTTCTTGAGCAGG + Intergenic
966771770 3:183510576-183510598 TTAAAAAGCATTTTTTAGGCCGG + Intronic
966810553 3:183840024-183840046 TAAAAAAATTTTTCTTAGGCTGG - Intronic
966880753 3:184349193-184349215 TTAAAAAAATTTTCTGGGCCGGG + Intronic
966965617 3:184989559-184989581 TTAAAAATCAATTAATGGGCTGG - Intronic
967025451 3:185560454-185560476 TTAAAAATACTTTCTGGGCCGGG - Intergenic
967159123 3:186719442-186719464 TTAGAAATGTTTGCTTGGGCCGG + Intronic
967173247 3:186840501-186840523 TAAAAAGTATTTTCTTTGGCCGG - Intergenic
967247833 3:187505802-187505824 TTAAAACCCTCTTCTTGGCCGGG - Intergenic
967368337 3:188713795-188713817 TTAAGAATCCCTTCTTGGGTGGG + Intronic
967711630 3:192714812-192714834 TTAAAAATTATTTCCTTGGCCGG - Intronic
968149908 3:196329235-196329257 TAAAAAATCATTTATTGGCCGGG - Intronic
968342075 3:197964690-197964712 TTAAAAAACTTTTTTAGGCCGGG - Intronic
1202736396 3_GL000221v1_random:3617-3639 TTAAAAATCTTATTTTTAGCTGG - Intergenic
968564338 4:1302773-1302795 TAAAAAATGTTTTCTTGGCTGGG - Intronic
968678374 4:1898367-1898389 TTAAAAATGGTTTCGTGGCCAGG + Intronic
968682981 4:1934379-1934401 AAAAAAATCTTTTCCTAGGCCGG - Intronic
968794459 4:2693311-2693333 TTAAAAAAAATTTCTTGGCCGGG - Intronic
968999147 4:3965931-3965953 TTAAAAATGTAAGCTTGGGCTGG - Intergenic
969034573 4:4242813-4242835 TTTAAAAAATTTTCTTAGGCCGG - Intronic
969071598 4:4543820-4543842 TAAATAATCTTTTCCTGGCCGGG - Intergenic
970596386 4:17604100-17604122 TTAAAAATTTCTTTTTGGGCCGG - Intronic
970703375 4:18770161-18770183 TGAATTATCTTTTCTTGAGCAGG - Intergenic
970973502 4:22014454-22014476 TTAAAAATTCTTGCTGGGGCTGG + Intergenic
971278110 4:25217085-25217107 TTAAACCTCTTTTCTTGGCCAGG - Intronic
971456942 4:26853828-26853850 TTAAAAGTTGTTTCTTGGCCAGG - Intergenic
971598983 4:28568666-28568688 GGAAAAATCATTTCATGGGCTGG - Intergenic
972000633 4:34028256-34028278 TGAAAAATTTGGTCTTGGGCTGG + Intergenic
972073533 4:35054703-35054725 TTAAAAACATTTTCTTGGCCGGG - Intergenic
972243802 4:37223436-37223458 TTAAAAATGTTGTTTTCGGCCGG - Intergenic
972283212 4:37623096-37623118 TTAAAAAGTATTTCTTGGCCGGG - Intronic
972348142 4:38211004-38211026 TTAAAAATATGTTCCTAGGCTGG + Intergenic
972395728 4:38658106-38658128 TTAAAAATAATCACTTGGGCTGG - Intergenic
972469129 4:39386622-39386644 TTAAAAATCATGTCCTCGGCTGG - Intergenic
972486927 4:39550576-39550598 TTAAAAATGTCTGCATGGGCTGG - Exonic
972657280 4:41076567-41076589 GTAGATCTCTTTTCTTGGGCAGG - Intronic
972694222 4:41429014-41429036 TTTGAAATCTCTTCTTGGGAAGG + Intronic
972748834 4:41968753-41968775 TTAAAAATGGTTTTGTGGGCTGG + Intergenic
972968181 4:44538438-44538460 TTAAAAATATATTATGGGGCCGG - Intergenic
973123707 4:46557208-46557230 TTAGAACTATTCTCTTGGGCTGG - Intergenic
973188098 4:47354836-47354858 TTATAAAGCTTTTCTGTGGCAGG + Intronic
973855604 4:55007488-55007510 TAAAAAATCTTTCCTTGAGGAGG - Intergenic
974014385 4:56635485-56635507 TGAAAATTCCATTCTTGGGCCGG + Intergenic
974125644 4:57692822-57692844 GAAAAAATAGTTTCTTGGGCTGG + Intergenic
974126092 4:57697512-57697534 TGAGAAATCTTTTTTTGGGAGGG + Intergenic
974517442 4:62936002-62936024 GAAAAAATGGTTTCTTGGGCTGG + Intergenic
974626591 4:64433819-64433841 TAAAAAATATTTTATTTGGCCGG + Intergenic
974802133 4:66831352-66831374 TTAAAAATCTATTCTTGGCCAGG + Intergenic
974822822 4:67089772-67089794 TTAAAATGCTTTTCTTGGCCGGG + Intergenic
974977964 4:68915598-68915620 TTTAAAAACCTTTCATGGGCTGG - Intergenic
975099246 4:70493443-70493465 TTAGAAATCTATTCTTGGTTAGG - Intergenic
975118082 4:70701267-70701289 TAAAAAATCCTTTGGTGGGCTGG - Intergenic
975134803 4:70864348-70864370 TTAAAAAAATATTCTTGGCCGGG + Intergenic
975144044 4:70947903-70947925 TTAAAATTCTTCTCTGTGGCTGG - Intronic
975501612 4:75092241-75092263 TTAAAAACCTTTTTTTGGCTGGG - Intergenic
975578370 4:75885566-75885588 TTAAAAATAATATCTTAGGCTGG + Intronic
976172389 4:82317888-82317910 TAAAAAATGGTTTCCTGGGCTGG + Intergenic
976225286 4:82790941-82790963 TTAAAAAATGATTCTTGGGCTGG + Intronic
976607652 4:86997464-86997486 TTAAAAATGCATACTTGGGCTGG + Intronic
976625937 4:87181930-87181952 AAAAAAATCAATTCTTGGGCCGG + Intronic
976729540 4:88248128-88248150 TTAAAAATCTCTCCTGGGCCAGG - Intergenic
976812115 4:89109212-89109234 TTAAGAATCTATTATTGGCCAGG + Intronic
977398158 4:96497442-96497464 TTAAAATTTTTTTCTTGGGCAGG - Intergenic
977657998 4:99545801-99545823 TTAAAAATCTTATCTAAGCCTGG + Intergenic
977751244 4:100612560-100612582 TTAAAAATGTGTTATTTGGCCGG + Intronic
977863001 4:101989147-101989169 TTATAAAGCTCTTCTTGGCCAGG + Intronic
978048508 4:104165323-104165345 TTAAAAATGCTTTCTTGGGAGGG + Intergenic
978525506 4:109660810-109660832 TTAATTTTCTTTTCTTGGGATGG - Intronic
978548961 4:109903625-109903647 TTAAAAATATTTTGTTGAGATGG - Intergenic
978568064 4:110106059-110106081 TTTAAAATTTTATCTTGGGTGGG + Intronic
978799862 4:112744643-112744665 TTTAAAATCTTATCCTGGCCAGG - Intergenic
978912587 4:114082194-114082216 GTAAAAATATTTTGTCGGGCCGG + Intergenic
979947080 4:126845625-126845647 TTAAAAATATTTTTTTAGGCCGG + Intergenic
980118870 4:128707441-128707463 TTAAAAAATTTTTCGTGGCCAGG + Intergenic
980314279 4:131176187-131176209 TTAAATATTTTATCTTGGCCAGG - Intergenic
980423536 4:132594752-132594774 TTCAATATCTGTTCTTGGGCTGG - Intergenic
980939514 4:139260483-139260505 TTAAAAAATTTTTTTTGGCCGGG + Intergenic
981406751 4:144379917-144379939 TTAAAAATCTTTACTTAAGGAGG + Intergenic
981873997 4:149519324-149519346 TTAAAAGTGCTTTCTTGGCCGGG + Intergenic
981990936 4:150920250-150920272 TTTAAAAGTTTGTCTTGGGCCGG + Intronic
982061068 4:151604550-151604572 TTAAAAATGAATTTTTGGGCCGG + Intronic
982124307 4:152171274-152171296 TTCCAAATTTTTTCTGGGGCTGG - Intergenic
982249784 4:153392947-153392969 TTAATAATTTTTTCTAGAGCTGG - Intronic
982271763 4:153597635-153597657 TTAAAAATCATTTCCAGGCCAGG + Intronic
982314699 4:154020385-154020407 TTAAAAATGTATTTTGGGGCCGG - Intergenic
982609321 4:157552865-157552887 TTAGAAAACCTTTCTTTGGCCGG - Intergenic
982647280 4:158039514-158039536 TTAAAGATCTTTTGTAAGGCTGG - Intergenic
982749123 4:159137948-159137970 TTTAAATTCTTTTCTTGAGTGGG + Intronic
982814875 4:159872127-159872149 TTAAAAATTTTTTTGTAGGCCGG - Intergenic
982957916 4:161793902-161793924 TTATAAATGGTTTCTTGGCCAGG - Intronic
983092839 4:163525255-163525277 TAAAACATCTATTCTTTGGCAGG - Exonic
983115190 4:163806585-163806607 TTAAGAATATTTTATTGGGGAGG + Intronic
983223238 4:165062826-165062848 AGAAATATCTTTTTTTGGGCTGG - Intergenic
983478908 4:168249053-168249075 TTAAAAATATTTACTGGGCCTGG - Intronic
983493890 4:168421362-168421384 TCAAAAATAGTTTCTTGGCCGGG + Intronic
983552654 4:169033215-169033237 TTTAAAATCTTTTCTCAGCCAGG + Intergenic
983921233 4:173347552-173347574 TTTAAAATTATTTTTTGGGCTGG - Intergenic
983921238 4:173347588-173347610 TTTAAAATTATTTTTTGGGCTGG - Intergenic
984151728 4:176141726-176141748 TAAAAACTATTTTCTTGGCCGGG - Intronic
984205259 4:176780082-176780104 TTAAAACTCTTTTCTAGGCCAGG + Intronic
984303789 4:177960378-177960400 TTAAAAATCTTTTTTTGATAGGG + Intronic
984462430 4:180055244-180055266 TTAAAAAGGTGTTCTTGGCCGGG - Intergenic
984654345 4:182301162-182301184 TAAAAATTCTTTACTTTGGCAGG + Intronic
984993247 4:185402477-185402499 TTAAAAACTTTTTTTTGAGCTGG + Intronic
985045679 4:185938291-185938313 TTAAGAATAATTTCTTGGTCAGG - Intronic
985088515 4:186340186-186340208 TTCTAAATCTTTTCTTTGGTGGG + Intergenic
985432190 4:189892210-189892232 TTAAAAAGCATTTATTGGGCAGG - Intergenic
1202770208 4_GL000008v2_random:197526-197548 TTTAAAATATTTACTTGGCCAGG - Intergenic
985675038 5:1226556-1226578 TTGAGAATCTTTTCTTAAGCAGG - Intronic
986188398 5:5467820-5467842 ATAAAAATCTTTACTTTGGAAGG + Intronic
986191305 5:5498523-5498545 TCAAAAGACATTTCTTGGGCTGG + Intergenic
986533364 5:8761649-8761671 GTAAAAATTGTTTCATGGGCTGG + Intergenic
986623889 5:9705861-9705883 CTAAAAGTCTTTTTTTGGGGGGG - Intronic
986944502 5:12999518-12999540 TTAAAAAGGCTTTCTCGGGCCGG + Intergenic
987069718 5:14324647-14324669 TTGAATCTCTTTTCTTGGGCAGG + Intronic
987144392 5:14978224-14978246 ATAAAATTTTATTCTTGGGCTGG + Intergenic
987219311 5:15773346-15773368 TTAAAAACATTTTCCTGGCCAGG + Intronic
987293764 5:16532228-16532250 TTCAAAAAGTTTTCCTGGGCTGG + Intronic
987301503 5:16601689-16601711 TTAAAAATAATTTCCTGGCCAGG - Intronic
987332336 5:16868306-16868328 TTAAAAATCTGCTCTTCAGCTGG + Intronic
987342440 5:16950722-16950744 TTAAACCTCTTTTCTTGGCCAGG + Intergenic
987381937 5:17293663-17293685 TTAAAAATTATTTCTAGGGCTGG + Intergenic
987820055 5:22952112-22952134 TTAAAATTATTTCCTTGGGGGGG - Intergenic
988038567 5:25859213-25859235 TTAAAAATTTATGCTTTGGCCGG - Intergenic
988268370 5:28982212-28982234 TTTAAAATATTTTTTTGGGCTGG + Intergenic
988310674 5:29552843-29552865 TTAAAAAGCTTTTTTTTGGACGG - Intergenic
988454581 5:31375828-31375850 TTAAAACTCACTTCTTTGGCAGG + Intergenic
988535300 5:32062687-32062709 TTAAAAATTTAGTCTTGGCCGGG - Intronic
988679581 5:33471912-33471934 TAAAAAATGTTTTCTTTGGCTGG + Intergenic
988745121 5:34128046-34128068 GGAAAAATTTTTTCTTGGGTTGG + Intergenic
988979639 5:36553843-36553865 TTAAATCTCTTTTCTTGGACTGG + Intergenic
989060077 5:37401751-37401773 TTAAAAATATAATCTTGGCCAGG - Intronic
989159219 5:38374360-38374382 TTAAAGATAATTTGTTGGGCAGG + Intronic
989339734 5:40359941-40359963 TTAAAAAACTTGTCTTGAGTGGG + Intergenic
989536502 5:42570679-42570701 TTCAAAATTCTTCCTTGGGCTGG - Intronic
989578721 5:43012392-43012414 TTAAAGATGTTTTTTTGGGTGGG + Intergenic
990112938 5:52350473-52350495 TTAAAAATTTTTGAGTGGGCTGG + Intergenic
990372628 5:55136240-55136262 TTAAAAATATTTTTTGGGGCTGG - Intronic
990425745 5:55687142-55687164 TTAAAAGTTTTTTCTAGGCCGGG + Intronic
990580077 5:57159753-57159775 TTAAAAACCTTTTTTTAGGCCGG + Intergenic
991473546 5:66995980-66996002 TTAAAAATACTTTGTTGGCCAGG + Intronic
991613871 5:68476083-68476105 TTAAAAAGCTTTTTATGGGCTGG + Intergenic
991732361 5:69602205-69602227 TTAAAAATCTAGTCTTGGCTGGG + Intergenic
991808793 5:70457348-70457370 TTAAAAATCTAGTCTTGGCTGGG + Intergenic
991862591 5:71025648-71025670 TTAAAAATCTAGTCTTGGCTGGG - Intergenic
991985799 5:72285499-72285521 CTAATAATCTTTTTTTGGGAGGG + Intronic
992227776 5:74635484-74635506 ACTAAACTCTTTTCTTGGGCTGG + Exonic
992271679 5:75070794-75070816 TTAAAAATTTTGTCTGGGGCTGG + Intronic
992474781 5:77090567-77090589 AAAAAAATCTTCTCTTCGGCTGG - Intergenic
992483190 5:77171471-77171493 TTAAAAATTTTTCTATGGGCCGG - Intergenic
992590552 5:78291743-78291765 TTAAATATATTATCTTGGACTGG + Intronic
992642997 5:78785460-78785482 TTAAAAATCTCTTCTATGACTGG + Intronic
992685683 5:79197366-79197388 TTAAAACTCTTTAGTTGGCCTGG + Intronic
992728483 5:79633855-79633877 TATAAAAACTTTTCTGGGGCTGG + Intronic
992797759 5:80268448-80268470 TTAAAAAACATTTCTGGGCCGGG + Intergenic
992836828 5:80650014-80650036 TTAAAAGTCTCTTCACGGGCAGG + Intronic
993529616 5:89007973-89007995 TTAAAAATTTTATTCTGGGCCGG + Intergenic
993645015 5:90451634-90451656 TTAAAAAAATTTTTTTAGGCTGG + Intergenic
993687944 5:90963780-90963802 TTAAAAATCTATACTTGATCAGG + Intronic
993765072 5:91845640-91845662 TTTAAAATCTTTTCTGGGGCAGG - Intergenic
994358085 5:98817337-98817359 TTAAAGATTTTTTCTTGGTTTGG - Intergenic
994440834 5:99800779-99800801 TCAAAAATATTTTTTTGGGCTGG - Intergenic
994853016 5:105080998-105081020 TAAAAAATCTTTTCTTGGTGGGG - Intergenic
994872963 5:105377610-105377632 TTAAAAATCTCTTGTAAGGCTGG + Intergenic
994877887 5:105448915-105448937 TTAAAAATCCTTTTAGGGGCAGG + Intergenic
995057993 5:107782797-107782819 TAAAAAATCTTTTCTTGCTCTGG + Intergenic
995147286 5:108800748-108800770 TAAAAAATCTTTGCCTGGGCCGG + Intronic
995495276 5:112735471-112735493 TTAAAAATATTTTCTGGGCAGGG - Intronic
995729956 5:115228030-115228052 TTAAAAAAATTTTTTTGGCCTGG - Intronic
995986099 5:118176014-118176036 TTAAAAATATTATTTTGGGTTGG - Intergenic
996555832 5:124778060-124778082 TTAAAATGCTTTTCTAAGGCTGG - Intergenic
996955248 5:129175599-129175621 TTAAAAATAACTTCTTTGGCTGG - Intergenic
997115370 5:131121121-131121143 TGAAAATTCTTTTCTTGACCAGG + Intergenic
997130711 5:131273473-131273495 TAAAAAACTTTTTCTTGGCCAGG + Intronic
997247309 5:132360771-132360793 TTAAAAAAATTTTTTTTGGCTGG - Intergenic
997838058 5:137212604-137212626 TTAACAATCTTATCTTGGTCAGG + Intronic
997891256 5:137679159-137679181 GTAAGAATTTATTCTTGGGCTGG + Intronic
998034362 5:138901584-138901606 TTAAAAAATTTTTCATTGGCTGG - Intronic
998414537 5:141936727-141936749 TTAAAAAGCTATGCTTGGCCTGG - Intronic
998812946 5:145984858-145984880 TTAAAAATCTTGGCTTCAGCTGG + Intronic
999076031 5:148796543-148796565 TTAAAAATGTTATGTTGGCCGGG + Intergenic
999174322 5:149621164-149621186 TACAAAATCTTTTCTAAGGCTGG + Intronic
999308516 5:150536187-150536209 TTAAAAATTTTTTTCTTGGCTGG + Intronic
999345354 5:150813566-150813588 TTTAAAAAATTTTTTTGGGCCGG - Intergenic
999525430 5:152400829-152400851 TTAAAAATTGTTCCTTGGGGTGG - Intronic
999958552 5:156728608-156728630 TAAAAAGTCTTATCTTGGGGTGG - Intronic
1000009531 5:157218333-157218355 TTAAAAATTTTTTCTAGAGATGG - Intronic
1000235400 5:159354794-159354816 TTAAAAACTGTTTCCTGGGCTGG + Intergenic
1000479442 5:161753453-161753475 TTAAAAGTCTTTTCTTCTGGAGG + Intergenic
1000530641 5:162415630-162415652 TTAAAATTCTGTTTATGGGCCGG + Intergenic
1000587261 5:163115617-163115639 TTCAAAATCTTCTCATGGGGAGG + Intergenic
1000590668 5:163153500-163153522 TAAAAAATTTTTTATTGGTCAGG - Intergenic
1000643353 5:163732125-163732147 TAAAAAATGTTTATTTGGGCTGG + Intergenic
1000895719 5:166853256-166853278 TTTAAACTCTATTCTTGGGAAGG + Intergenic
1001196581 5:169678556-169678578 TTAAAACTTTTTTCTTGGCCAGG - Intronic
1001507255 5:172289552-172289574 TAAAAAATTTCTTTTTGGGCTGG + Intergenic
1001972197 5:175965718-175965740 TTTAAAATCTTGGCTTGGCCGGG - Intronic
1001983986 5:176058372-176058394 TGAAAAATCATTTGTTAGGCCGG - Intronic
1001992531 5:176129857-176129879 TTAAAAGTGCTTTCATGGGCAGG - Intronic
1002005300 5:176228061-176228083 TTAAAAATATTTTTCTGGCCAGG - Intergenic
1002072660 5:176689604-176689626 TTAAACATCTAATCTTGGGGTGG - Intergenic
1002221074 5:177682564-177682586 TTAAAAATATTTTTCTGGCCAGG + Intergenic
1002233488 5:177785687-177785709 TGAAAAATCATTTGTTAGGCCGG + Intronic
1002532439 5:179856199-179856221 TAAAAAGGCTTTTCTTGGCCGGG - Intronic
1002980874 6:2136549-2136571 TTAAAAATCTTTTGTAGAGATGG - Intronic
1003064988 6:2896842-2896864 TTAAAATACTTTTCTAGGCCAGG + Intronic
1003098651 6:3160535-3160557 TTAAAAACCTATTCTAGGGAAGG - Intergenic
1003287874 6:4750495-4750517 TTAAAAAAATTTTTTTGGCCGGG - Intronic
1003550340 6:7097657-7097679 TTAAAAGCCCTTTCTTGGCCAGG + Intergenic
1004168583 6:13277776-13277798 TTAAAAATGTTTTGTTGAGATGG - Intronic
1004336401 6:14768408-14768430 TTAAAAATCTCTTTGTTGGCTGG - Intergenic
1004373515 6:15072930-15072952 TTAAAAATGTTCTCAGGGGCTGG - Intergenic
1004396889 6:15253356-15253378 TTAAAAATCCTTATTTGGCCAGG - Intronic
1004622158 6:17340510-17340532 TTAAAATTCTGTTCCTCGGCGGG - Intergenic
1004724339 6:18296818-18296840 TTAAAAATATTTTGTTGGCCAGG + Intergenic
1004858624 6:19777762-19777784 ATAAAATTCTTTTTTTGGCCAGG - Intergenic
1004911337 6:20287926-20287948 TTAAAAAATTTTTTTTGGGCCGG - Intergenic
1004942519 6:20575059-20575081 TTATAAATCCTTTCTTTTGCTGG + Intronic
1005002934 6:21260906-21260928 TTCAAAATCTTCTTTTGGCCAGG - Intergenic
1005197115 6:23300450-23300472 TTAAAAATATTTTCTCGGCCGGG - Intergenic
1005223729 6:23618067-23618089 TTAAAAGAATTTTCTTGGCCGGG - Intergenic
1005644941 6:27828967-27828989 TTAAAAATGTGTTTTTGGCCTGG - Intergenic
1005910976 6:30309194-30309216 TTAAAAGCCATTTCTTGGCCTGG - Intergenic
1006121421 6:31808700-31808722 ATAGAAATATTTTCTGGGGCTGG + Intergenic
1006481458 6:34297889-34297911 TCTTAAATCTTTTCTTGGGCCGG - Intronic
1006667598 6:35707514-35707536 TCAAAAGTCTTTTCATGGCCGGG - Intronic
1006707821 6:36037035-36037057 TTAAAAATATTTTATTAGCCGGG - Intronic
1007331784 6:41116729-41116751 TTAAAAATCTTTTACTGGCCAGG + Intergenic
1007379777 6:41480864-41480886 TTGAAAATCTGTTGTTGGCCAGG - Intergenic
1007532276 6:42553647-42553669 CTATAAATTTTATCTTGGGCTGG - Intergenic
1007678233 6:43615970-43615992 TTAAAATCCTTTTTTTGGGGGGG - Intronic
1007755323 6:44095712-44095734 GTAAAAATACTTTCTTGGCCGGG - Intergenic
1008190316 6:48448192-48448214 TTAAAAATTATTCCTTGGCCGGG + Intergenic
1008243331 6:49140538-49140560 TTTAAAATCTTTGCTAGGGAAGG - Intergenic
1008337524 6:50324895-50324917 GGAAAAATTATTTCTTGGGCTGG - Intergenic
1008468518 6:51857102-51857124 TTAAAAATCATTTTCTGGGATGG - Intronic
1008575786 6:52858850-52858872 TTAAAAATCTTGTTTGGGCCAGG - Intronic
1008667600 6:53731593-53731615 TTAAAATTCTTTTTTTGAGATGG - Intergenic
1008699239 6:54078985-54079007 TAGAAAATTATTTCTTGGGCCGG - Intronic
1009351961 6:62691508-62691530 TTAAAAATCTTTATAGGGGCTGG + Intergenic
1009609923 6:65928104-65928126 ATAAACATCTTTTCTTGTGTAGG + Intergenic
1009901046 6:69808047-69808069 TGAAAAATGGTTTCATGGGCCGG - Intergenic
1009972374 6:70638158-70638180 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1010439329 6:75875270-75875292 TTAAAAATTTTTTTTTGGTTGGG + Intronic
1010440646 6:75889706-75889728 TTAAAAATTATTTCTAGGCCGGG - Intronic
1010722352 6:79297783-79297805 TTACAAATCATTTCTTGGCCGGG + Intergenic
1011442794 6:87404837-87404859 TTAATAATTTTTTATTGAGCCGG - Intergenic
1011645180 6:89450795-89450817 TTAAAAATACTTTATTGGCCAGG - Intronic
1012551906 6:100470595-100470617 TTTAAAATATTTTCTTATGCAGG - Intergenic
1012780119 6:103546955-103546977 AGAAAAATGTTTTCATGGGCTGG - Intergenic
1012991787 6:105933660-105933682 TTAAAAAGCCATTCTTTGGCTGG - Intergenic
1013115298 6:107098980-107099002 TTAAACATCTTTTTTTGGGGGGG + Intronic
1013153471 6:107469945-107469967 TTAAAAACTATTTCTTAGGCTGG + Intergenic
1013242431 6:108258802-108258824 TTAAAAATGGTTTCTGGGCCTGG - Intronic
1013244864 6:108276845-108276867 TTAAAAAAATTTTTTTGGGCTGG + Intergenic
1013358009 6:109363687-109363709 TTAAAAATATTTTCTTGGCCAGG - Intergenic
1013507166 6:110812415-110812437 TTAAAAATATTCTCTGGGTCGGG - Intronic
1013624799 6:111926501-111926523 TAAAAAATCTGTTCTTGGCTGGG + Intergenic
1013816344 6:114102866-114102888 TTTAAAATTTTATCTTGGTCTGG - Intronic
1013832342 6:114289280-114289302 TTATAAATTTTTCCTTGGGTAGG + Intronic
1014004790 6:116405740-116405762 TTACAAATGGATTCTTGGGCAGG + Intronic
1014120349 6:117718542-117718564 TTAAAAATATTAACTTGGGGTGG - Intergenic
1014153132 6:118081796-118081818 TTAAAAATGTAAACTTGGGCTGG - Intronic
1014211465 6:118712668-118712690 TAAAAGATCCTTTCCTGGGCTGG - Intergenic
1014845771 6:126275031-126275053 TTAAAAATCTGATATTGTGCTGG - Intergenic
1015122369 6:129713496-129713518 TTAAAAAGCTGTTCTTTGGGAGG + Intergenic
1015168083 6:130221148-130221170 TTAAAGATCTTTTCACTGGCTGG - Intronic
1015174319 6:130289794-130289816 TTAAAAATCTTTTCTTGGGCTGG - Intronic
1015281222 6:131435850-131435872 TTAAGCATCTTTTGTAGGGCTGG - Intergenic
1015793332 6:136986119-136986141 TTAAAAATATTTTCTGGGCCGGG - Intergenic
1016304815 6:142672786-142672808 TTAGAAATCTATTATTGGGGAGG + Intergenic
1016570156 6:145503207-145503229 TTAAAAATTTTTTATTGTGTTGG + Intronic
1016980980 6:149853805-149853827 TTAATAATCTTTTCAAGGCCAGG - Intronic
1017014737 6:150090958-150090980 TTAAAAACTTTTCTTTGGGCCGG + Intergenic
1017166280 6:151411253-151411275 TTTAAAATCTCTTATAGGGCCGG - Intronic
1017230878 6:152072413-152072435 TTTAAAAACTTTTCTAGGGAAGG + Intronic
1017420789 6:154270678-154270700 TTAAATATGTATTCTTGGCCAGG + Intronic
1017425142 6:154312921-154312943 TTTAGAACTTTTTCTTGGGCAGG + Intronic
1017462161 6:154661403-154661425 TATAAAATCTTTTCTTTGGAAGG + Intergenic
1017508114 6:155087450-155087472 TTGAAAATATTTTTTTCGGCTGG + Intronic
1017787771 6:157770490-157770512 TTAAAAATGATTTATTGGCCGGG + Intronic
1017833062 6:158149286-158149308 TTAAGAATACATTCTTGGGCCGG - Intronic
1017964091 6:159248597-159248619 TTAAAAATTTTTTTTTGGCCAGG - Intronic
1018046748 6:159971997-159972019 TTTGAAAACTTTTCTTGGGGCGG + Intronic
1018772576 6:166984879-166984901 TGAAAACTTTTTTCTTGGCCGGG - Intergenic
1018806032 6:167260454-167260476 TGAAAATTCTTTTCTTTAGCCGG - Intergenic
1019000501 6:168745738-168745760 TTTAACATCTTTTGTTGGGAAGG + Intergenic
1019081586 6:169434969-169434991 TAAAAAATGGTTTCATGGGCTGG + Intergenic
1019808204 7:3144512-3144534 AAAAAAATCATTTCTTGGCCAGG + Intronic
1019818816 7:3223164-3223186 TTAAAAAGCTTTTTATGGCCAGG - Intergenic
1019880157 7:3852450-3852472 TTAAAAGTTTTTTTTTGGCCGGG + Intronic
1020018095 7:4843306-4843328 TTTAAAATCATCTCTTGGCCGGG - Intronic
1020123894 7:5521813-5521835 TTAAAAATCTTTTGTAGAGATGG - Intergenic
1020346501 7:7170484-7170506 TTAAACATCTTATGTTAGGCTGG + Intronic
1020465664 7:8475846-8475868 TTAAAAATGTTATCTTGAACTGG + Intronic
1020735133 7:11938819-11938841 TAAAAAATATTTTGTTGGGCCGG - Intergenic
1020872588 7:13650452-13650474 TTTAAAATATTTTTTTGGCCGGG - Intergenic
1021128059 7:16877566-16877588 TTGAGAATATTTTCTTGGCCGGG + Intronic
1021282908 7:18742002-18742024 AGAAAAATGTTTTCTTGGGATGG + Intronic
1021521244 7:21541351-21541373 TTAATAATCCTTTCATTGGCCGG - Intergenic
1021573342 7:22086267-22086289 GGAAAAATCATTTCCTGGGCTGG - Intergenic
1021759244 7:23887369-23887391 TTAAAAATATTATTTTAGGCCGG + Intergenic
1021847470 7:24776907-24776929 TTAACAGTGTTTTCTTGGGGTGG + Intergenic
1021848099 7:24782040-24782062 TTAAAAGTATGTTTTTGGGCTGG - Intergenic
1022297443 7:29069142-29069164 TTAAAAGTCATTTGTTGGCCAGG + Intronic
1022401140 7:30039216-30039238 TTAAAAATTTATTCTTGGCCAGG + Intronic
1022773154 7:33496208-33496230 TTAAAAATGTATTCTGGGCCAGG + Intronic
1022820937 7:33960402-33960424 TTAAAAAAATTGTATTGGGCTGG + Intronic
1022937687 7:35196965-35196987 TTAGAAATCTTTTATTTGGAAGG - Intergenic
1023172921 7:37406735-37406757 CTAAGAATATTTTCTTGGCCTGG - Intronic
1023295012 7:38705667-38705689 TTAAAAATTTTTTTTTGGTGGGG - Intergenic
1023469811 7:40504423-40504445 AAAAAAATCTATTCTTGGCCAGG - Intronic
1023475244 7:40570725-40570747 CTAAAAGTCTTCTGTTGGGCTGG + Intronic
1023665873 7:42522749-42522771 TGACAAATCTTTTCTAGGTCTGG + Intergenic
1023721814 7:43103461-43103483 TTAAACCTCTTTTCTTGGCCAGG - Intergenic
1023724501 7:43128173-43128195 TTGAAAATCTATTTTTGGCCAGG - Intronic
1023779453 7:43642443-43642465 TTTAAAATTTTTTCTTGAGATGG - Intronic
1023787168 7:43719261-43719283 TTAAGAAGCTCTTCTTGGCCAGG - Intronic
1023811806 7:43917734-43917756 TTAAAAGGATTTTCTTGGCCAGG + Intronic
1023829851 7:44032703-44032725 TTAAAAATGTTGTTTTGGCCGGG - Intergenic
1023841136 7:44098204-44098226 TTAAAAACACTTTCTAGGGCTGG - Intergenic
1023957591 7:44899662-44899684 TTAAAAATGTGTTCTTGGCTGGG + Intergenic
1024646077 7:51371467-51371489 TTAAAAAATTTTTGTGGGGCTGG - Intergenic
1024647022 7:51379422-51379444 TTAAAAATTTTTTATTGGTGGGG - Intergenic
1024732238 7:52265479-52265501 TTTAAAATATATTCTTGGCCAGG + Intergenic
1025216762 7:57062391-57062413 TTCAAAATCTTCTTTTAGGCCGG + Intergenic
1025627591 7:63235173-63235195 TTCAAAATCTTCTTTTAGGCTGG + Intergenic
1025654621 7:63508356-63508378 TTCAAAATCTTCTTTTTGGCCGG - Intergenic
1025768066 7:64476468-64476490 TTAAAAATATATTTTTAGGCCGG - Intergenic
1025780775 7:64600027-64600049 TTAAAATTGCTTTATTGGGCAGG - Intergenic
1025804228 7:64814468-64814490 TTAAAAATTATTTTATGGGCTGG + Intronic
1025939485 7:66064113-66064135 TTAAAAACATTTTCATTGGCTGG - Intergenic
1025949813 7:66135625-66135647 TTAAAAATCTTTTCTTGGCCAGG + Intronic
1026150318 7:67782867-67782889 TTAAAAATGCTTTCTTGGCTGGG + Intergenic
1026432495 7:70361048-70361070 ATAAAAATCGATTCTTGGCCAGG + Intronic
1026457736 7:70587370-70587392 TGAAAAATCCCTTCCTGGGCAGG - Intronic
1026478680 7:70760299-70760321 TTAAAAATCTTTTTGTAGGCCGG - Intronic
1026517233 7:71083455-71083477 TTAAAAAGCTATTCTTGGCTTGG - Intergenic
1026535550 7:71235882-71235904 TTAAAAGTCTGCTCTTGGTCAGG + Intronic
1026759974 7:73119413-73119435 TTAAAACTCTTTTCTTGGCTGGG - Intergenic
1027035478 7:74922169-74922191 TTAAAAATTCTCTCTGGGGCCGG - Intergenic
1027036316 7:74928225-74928247 TTAAAACTCTTTTCTTGGCTGGG - Intergenic
1027087247 7:75273239-75273261 TTAAAACTCTTTTCTTGGCTGGG + Intergenic
1027404115 7:77841374-77841396 TTAAAAATCATCTGTTTGGCTGG - Intronic
1027515564 7:79137757-79137779 GTAAAAATCTGTATTTGGGCTGG - Intronic
1028099045 7:86797823-86797845 TAAAAAATGATTTCCTGGGCTGG + Intronic
1028372442 7:90108627-90108649 TTAGAAATCTTTTATTTGGAAGG + Intergenic
1028427308 7:90704133-90704155 TTAAAAATCTTATTTTTGCCTGG - Intronic
1029256093 7:99270611-99270633 TTAAAAAAATTTTTTTCGGCTGG - Intergenic
1029393553 7:100291213-100291235 TTAAAACTCTTTTCTTGGCTGGG + Intergenic
1029394578 7:100298968-100298990 TTAAAAATTCTCTCTGGGGCCGG + Intergenic
1029473685 7:100770206-100770228 TTAAAAATGTTTTAATAGGCTGG + Intronic
1029572274 7:101378081-101378103 TTAAAAATTTTTTGGGGGGCTGG + Intronic
1029613309 7:101639650-101639672 ACAAAAATATTTTCTTAGGCCGG + Intergenic
1029681789 7:102116636-102116658 TTAAAAATTTTTTTAGGGGCAGG - Intronic
1029740162 7:102486970-102486992 TTAAAAATGTTGTTTTGGCCGGG - Intronic
1029758159 7:102586149-102586171 TTAAAAATGTTGTTTTGGCCGGG - Intronic
1029776097 7:102685227-102685249 TTAAAAATGTTGTTTTGGCCGGG - Intergenic
1029814295 7:103077184-103077206 TTAAAAATCCTTTATTGGCCAGG - Intronic
1030162384 7:106522143-106522165 TTAAAAATCTTTTCCTGACGAGG - Intergenic
1030635075 7:111939217-111939239 TTTAAAATCTATTTATGGGCTGG + Intronic
1030644789 7:112047984-112048006 TTAAAATTTTTTTCTCGGCCAGG - Intronic
1030736746 7:113058018-113058040 TTACATATCTTTTCTAGGGTAGG + Intergenic
1030744886 7:113153063-113153085 TTAAAAATGTTTTATTGAGTTGG - Intergenic
1030918297 7:115345567-115345589 TAAAAAATCTTTTCTGGGACTGG + Intergenic
1031009799 7:116514142-116514164 TTAAAACTATTTTTTTGGCCGGG + Intergenic
1031056906 7:117001928-117001950 TTTAAAATGTTTTATTGGCCAGG + Intronic
1031237877 7:119199257-119199279 TTAAAGATCTTTTGTAAGGCTGG - Intergenic
1031315410 7:120251878-120251900 TTAAAAAGATTTTGTTGGACTGG + Intergenic
1031601768 7:123718689-123718711 TTAAAAATATTATATGGGGCTGG - Intronic
1032108292 7:129053527-129053549 TTAAAAATCTGGTCTTGGTATGG - Intronic
1032126665 7:129200124-129200146 TAAAAAATCATTTCCTGGCCAGG + Intronic
1032157192 7:129478211-129478233 TTAAAAACTTTTTGTTAGGCCGG + Intronic
1032281222 7:130503510-130503532 TAGAAAATATTTTCTTGGGCTGG + Intronic
1032458050 7:132088340-132088362 TTTTAAAGCTTTGCTTGGGCAGG - Intergenic
1032588996 7:133175104-133175126 TTAAAAATCCTGTCATTGGCCGG - Intergenic
1032747145 7:134797278-134797300 TTAAAAAAGTTTTCTGGGTCGGG - Intronic
1032865895 7:135924086-135924108 CTAATAGTCTTTTCTAGGGCAGG + Intergenic
1032913182 7:136457812-136457834 ATAAAAATGTTTTCTTGACCGGG + Intergenic
1033138808 7:138807122-138807144 TTAAAAATCTATTCCTGGCCAGG + Intronic
1033203576 7:139396143-139396165 TTGAAAATATTTTCTTGGCCAGG + Intronic
1033224249 7:139548175-139548197 TAAAAAGTCTTTCCTAGGGCCGG - Intergenic
1033481637 7:141747700-141747722 TTAAAAATTGATTTTTGGGCTGG + Intronic
1034060038 7:148078775-148078797 TCAAAAATCTATTCTCAGGCTGG - Intronic
1034523613 7:151640013-151640035 TTAAAAATGTAGTCTTGGCCAGG + Intronic
1034626482 7:152497163-152497185 TTAAAAATTATTTCTTGAGATGG + Intergenic
1034654760 7:152720606-152720628 TTAAAAATGTATTCTGTGGCTGG + Intergenic
1034671595 7:152862935-152862957 TTAAAAATCTTTTCATGGCCGGG - Intergenic
1034827669 7:154281307-154281329 TTAAAATTGTGTTCTTAGGCTGG - Intronic
1035533492 8:373842-373864 TTAAAAATCTGTTGTTGTTCTGG + Intergenic
1036059856 8:5304206-5304228 TAAAAAATCTTTTCTTCTGTTGG + Intergenic
1036192615 8:6684592-6684614 TTTAAAAGGTTTTCTGGGGCCGG + Intergenic
1036488826 8:9205525-9205547 TTTAAAGTGTTTTCTTGGCCAGG - Intergenic
1036986033 8:13531980-13532002 TAGAAAATCTTTCCTTGTGCCGG - Intergenic
1037032755 8:14129048-14129070 TAAAAAACCTTCTCTTGGGTCGG + Intronic
1037374546 8:18213398-18213420 TTAAAAATCTTTTCATTGGCGGG + Intronic
1037580492 8:20242970-20242992 TTAGAAATCTCTTCTTCGCCAGG - Intergenic
1037780298 8:21863760-21863782 TTGAAAATCTTTTCTGAGGCGGG + Intergenic
1037840537 8:22242172-22242194 TTAAAGAACTTTTATTGGCCAGG - Intergenic
1038005485 8:23426334-23426356 TTTAAAATCTATTCTAGGCCGGG - Intronic
1038293437 8:26270061-26270083 TAAAAAATCAGTTCTTGGGCTGG - Intergenic
1038458606 8:27696303-27696325 TTAAATATTTTCTCTTGGCCAGG - Intergenic
1038649107 8:29386199-29386221 AGATAAAACTTTTCTTGGGCAGG - Intergenic
1038715814 8:29990052-29990074 TTAAAAATTTATTTTTGGTCTGG - Intergenic
1038808265 8:30813873-30813895 TTAAAAATCCTTACCTGGGCTGG + Intronic
1038893037 8:31748672-31748694 TACAAAATTTTATCTTGGGCTGG - Intronic
1038895250 8:31775589-31775611 TTAAAAATCCATACTTTGGCCGG + Intronic
1039033237 8:33331969-33331991 TTAAAAATCTTTTTAGAGGCCGG - Intergenic
1039507005 8:38059454-38059476 TTAAACCTCTTTTCTTGGCTGGG + Intronic
1039623149 8:39019987-39020009 TTCAAAATGTTTTCCTTGGCTGG + Intronic
1039646241 8:39286328-39286350 TTAAAATTATTTTCTTGAGTTGG + Intergenic
1039923863 8:41911643-41911665 TTAACATTCTGTTGTTGGGCTGG - Intergenic
1039932303 8:42004627-42004649 TTAAAAATCACTACTTCGGCCGG + Intronic
1039932949 8:42011439-42011461 TTAAAAATCACTACTTCGGCCGG + Intronic
1040062918 8:43119725-43119747 TTAAAAAGCTGTTTTTGGGCCGG - Intronic
1040103138 8:43522567-43522589 TTAAACCTCTTTTCTTGGCCTGG + Intergenic
1040580150 8:48691082-48691104 TTTAAATTATATTCTTGGGCCGG - Intergenic
1040988199 8:53319308-53319330 TCAAAAGTCCTTTCTTGGCCAGG + Intergenic
1041052252 8:53946605-53946627 TAAAAAATCTTTTCTTGGCAGGG + Intronic
1041076377 8:54173865-54173887 TTAAAAATCCTTAATTAGGCAGG - Intergenic
1041595221 8:59642839-59642861 ATAAAGATCTTTTTTTGGACTGG - Intergenic
1042018644 8:64345597-64345619 TCAAAAATCTTTTCTTGGCCGGG + Intergenic
1042131476 8:65590730-65590752 TAAAAAATCTTTTCATAGGCTGG - Intergenic
1042167283 8:65958171-65958193 TTAAAAATGTTTTCTTAGGCTGG - Intergenic
1042222156 8:66484381-66484403 TTAAAAAGGTGATCTTGGGCTGG - Intronic
1042280073 8:67046523-67046545 TTTAAAAGCTTTTCTGGGTCGGG + Intronic
1042359651 8:67868116-67868138 TTAAAAATCTTATCCTTGGCCGG - Intergenic
1042550289 8:69988425-69988447 TTAAAAATCATTTTTATGGCTGG - Intergenic
1042648025 8:71008962-71008984 TTAAAAATCTCTTTTAGGCCTGG - Intergenic
1043141144 8:76591861-76591883 TTAGAAAGCCATTCTTGGGCTGG - Intergenic
1043252547 8:78093296-78093318 TCAAAAATCTTTGATTGGGTTGG - Intergenic
1043262332 8:78218407-78218429 TTAAAAACCTTGCCTTGGCCGGG + Intergenic
1043443300 8:80295762-80295784 TTCAAAAACTATACTTGGGCTGG - Intergenic
1043686906 8:83098079-83098101 TTATATATCTTTTATTGGGTGGG - Intergenic
1043942855 8:86215390-86215412 TTAAGAATATCTTCTTGGCCGGG + Intronic
1044066602 8:87706470-87706492 GAAAAAATGTTTTCGTGGGCTGG - Intergenic
1044161571 8:88923468-88923490 CTAAAAATTATTTCTTAGGCTGG - Intergenic
1044229143 8:89755730-89755752 TTAAAAATTTTTGCTAGGGCAGG - Intergenic
1044585294 8:93864053-93864075 TTAAAAATTTTTTGTAGGGATGG + Intronic
1044658112 8:94569607-94569629 TTAAAAAAATTTTTTTGGCCGGG + Intergenic
1045320444 8:101078106-101078128 TTAATAATTGTTTCTAGGGCTGG + Intergenic
1045336640 8:101209968-101209990 TTAAAAAGCCTTTTTTGGCCTGG - Intergenic
1045365058 8:101468531-101468553 TTAAAAATCCTATCTTGGCCGGG + Intergenic
1045824064 8:106376018-106376040 TTAAAAATATTTTCAAAGGCAGG + Intronic
1046086109 8:109437207-109437229 TTAAAAATGTATTCCTGGCCAGG - Intronic
1046102024 8:109625715-109625737 TTAAAAATCCTATGTTTGGCTGG - Intronic
1046307383 8:112386791-112386813 TTTAAAATCTTTAGTTGGGCCGG - Intronic
1046402357 8:113720413-113720435 TTAAAAATTTTGTCTTTGGTAGG + Intergenic
1046599414 8:116298637-116298659 TAAAAATTGTTTTCTTGGCCAGG - Intergenic
1046937438 8:119898424-119898446 TTAAAAGCCTTGTATTGGGCTGG + Intronic
1046960282 8:120104403-120104425 TTAAAAATATTGTTTTGGGTTGG - Intronic
1047060502 8:121219566-121219588 AGAAAAATGTTTTTTTGGGCTGG - Intergenic
1047085894 8:121514832-121514854 TTTTATATCTTTTTTTGGGCGGG - Intergenic
1047379006 8:124338893-124338915 TTAAGAATATATTCTTGGCCAGG + Intronic
1047616951 8:126570475-126570497 TTCAAAATCACTTCTTGGCCAGG - Intergenic
1048678139 8:136807899-136807921 TTAAAAATATTTTGTGGGGTGGG + Intergenic
1049567859 8:143351275-143351297 ATAAAAACATTTTCTTGGCCAGG + Intronic
1049865913 8:144935500-144935522 TTAAAAAGATGTTCTTTGGCCGG - Intronic
1049901291 9:168545-168567 TTAAAAATCTGTTGCTGGCCGGG - Intronic
1049993759 9:1015398-1015420 CTTAAAATATTTTCTGGGGCTGG + Intergenic
1050142735 9:2533240-2533262 TTAAAAATATTGTATAGGGCTGG - Intergenic
1050195456 9:3078449-3078471 TTAAAAAGCATATCCTGGGCCGG + Intergenic
1050271731 9:3953024-3953046 ATAAAGATGTATTCTTGGGCTGG + Intronic
1050350393 9:4735762-4735784 TTTAAAATATTTTTTTGGCCAGG - Intronic
1050559230 9:6817499-6817521 TTATAAATATTTTGCTGGGCTGG - Intronic
1050648828 9:7753049-7753071 TTCAAAATCTTTTCATGACCAGG - Intergenic
1050824553 9:9929685-9929707 TTAAAAGTGTTTTCTTGGCCAGG - Intronic
1050842497 9:10170394-10170416 TTAGAAATCATTTTTTGGCCAGG + Intronic
1050998169 9:12245806-12245828 TTAAAAATTGTCTCTTGGCCGGG - Intergenic
1051062899 9:13065732-13065754 AAAAAAATATTTTCTTGGGAAGG - Intergenic
1051180620 9:14407980-14408002 TTAAAATTTTTTTGTTGGGCTGG - Intergenic
1051395935 9:16620631-16620653 TTACAAATCTTTTCTTATGGTGG - Intronic
1051664201 9:19452929-19452951 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1051665859 9:19466316-19466338 TCAAGAATCTTCTCTTGGCCGGG + Intergenic
1051700511 9:19817902-19817924 TTTAAAATCTTTTATAGGGATGG + Intergenic
1052130364 9:24838640-24838662 TTAAAACAATTTTTTTGGGCAGG + Intergenic
1052189885 9:25647507-25647529 TTAAAGATCTGTTCTTGGCCGGG - Intergenic
1052702476 9:31953711-31953733 TAAAAATTGTTTTCTGGGGCCGG - Intergenic
1052747515 9:32454867-32454889 TAAAAGAACTTTTCTTGGCCAGG + Intergenic
1052761571 9:32597507-32597529 ATAAAAACATTTTCTTGGCCGGG + Intergenic
1052826646 9:33181122-33181144 TTAAAAGTCTATCCTTGGCCAGG + Intergenic
1052921870 9:33977331-33977353 TTAAAAATTTTTTGTTTGGCTGG - Intronic
1052939686 9:34122772-34122794 TTAAAAAGATTTTCTTTCGCAGG - Intronic
1053120563 9:35544210-35544232 TTGAACATCTTTTCATGTGCTGG + Intronic
1053171633 9:35891158-35891180 TTAAAATTTTTTTTTTGGCCAGG + Intergenic
1053533842 9:38906511-38906533 TTAAAAATCAGTTTTTAGGCCGG + Intergenic
1053701229 9:40692893-40692915 TTAAAAATATTCCCTTTGGCTGG + Intergenic
1053744330 9:41178859-41178881 TTAAAAATCTGTTGCTGGCCGGG - Intronic
1053854843 9:42328548-42328570 TTAAAAAACTTTTTCTTGGCCGG + Intergenic
1053854844 9:42328549-42328571 TAAAAAACTTTTTCTTGGCCGGG + Intergenic
1054206065 9:62130940-62130962 TTAAAAATCAGTTTTTAGGCCGG + Intergenic
1054411294 9:64816349-64816371 TTAAAAATATTCCCTTTGGCTGG + Intergenic
1054482939 9:65686339-65686361 TTAAAAATCTGTTGCTGGCCGGG + Intronic
1054632293 9:67457430-67457452 TTAAAAATCAGTTTTTAGGCCGG - Intergenic
1054684015 9:68252394-68252416 TTAAAAATCTGTTGCTGGCCGGG + Intronic
1055043513 9:71900851-71900873 TAAAAAATGTTTGCATGGGCTGG + Intronic
1055046720 9:71934045-71934067 TTAAAAACCATTACCTGGGCTGG + Intronic
1055060364 9:72062379-72062401 TTAAAAATGTATTCTTGGCCGGG - Intronic
1055060841 9:72067120-72067142 TAAAAAATCTTTTCCTTTGCTGG - Intronic
1055062225 9:72081488-72081510 TTAAAAATATTTTCTTGTTTAGG + Intergenic
1055107983 9:72532242-72532264 TTAAAAATGCTTTACTGGGCTGG + Intronic
1055154591 9:73044653-73044675 TTAAAAACCTTTTATTGGCAAGG + Intronic
1055243157 9:74208891-74208913 TTAAAAACCTTTATTTTGGCCGG - Intergenic
1055590333 9:77805873-77805895 TTAAAAATCTTTTCTAGATTGGG - Intronic
1055852271 9:80645852-80645874 TTAAAAACCTATTATAGGGCTGG - Intergenic
1055870928 9:80879146-80879168 TTAAAAATGTATTTTTGGTCAGG + Intergenic
1055956646 9:81780122-81780144 CTAAAATTCTTTTCTTGGGGGGG + Intergenic
1056221662 9:84455963-84455985 TTAAAAACCATTTCTTGGCCGGG - Intergenic
1056380937 9:86056798-86056820 TTAAAAAATTTTTTTTTGGCTGG - Intronic
1056396802 9:86188599-86188621 TTAAGATTCTATTCTTGGCCGGG - Intergenic
1056430669 9:86525053-86525075 TTGAAAATCTCCTCTTGGCCAGG + Intergenic
1057127858 9:92633305-92633327 TTTAAAATGTTATCCTGGGCCGG - Intronic
1057235961 9:93360494-93360516 TTAAAAAAATTTTTTTGGCCGGG - Intergenic
1057681377 9:97188956-97188978 TTAAAAGTCTTTTATTGAACTGG + Intergenic
1057858255 9:98619270-98619292 TAATAAATTTTTTCTGGGGCAGG - Intronic
1057922724 9:99111330-99111352 ATAAAAAACCATTCTTGGGCTGG + Intronic
1058046269 9:100360711-100360733 TTTAAAACCTTTTATTGGCCAGG + Intergenic
1058047887 9:100376458-100376480 TTAAATATCAATTCTTGAGCTGG - Intergenic
1058101757 9:100924771-100924793 GGAAAAATGGTTTCTTGGGCTGG + Intergenic
1058542286 9:106024096-106024118 TCAAACCTCTTTTCTTGGCCAGG - Intergenic
1058701544 9:107604794-107604816 TTAAAAATCTTGAAGTGGGCCGG - Intergenic
1058727994 9:107821879-107821901 TTGAAATTCTTTTCTTTGACTGG + Intergenic
1058818173 9:108704594-108704616 TGAAAAATCTGTTCCTGCGCTGG - Intergenic
1059014809 9:110504353-110504375 TTAAAAAGCTTTCCAAGGGCGGG - Intronic
1059298269 9:113291914-113291936 TTATTAATCTTTTGTTTGGCCGG + Exonic
1059307232 9:113363588-113363610 TTAAAAATGTTTTTTAGGCCCGG + Intronic
1059391803 9:114004033-114004055 TTAAGAATCTTTTTTTGTGATGG - Intronic
1059862326 9:118478606-118478628 TTAAAAATCTCTTTCTGGGCTGG - Intergenic
1059983169 9:119795411-119795433 TTAAAATTCTTTTCATAGGATGG - Intergenic
1060800534 9:126542070-126542092 TTTAAAAGCTTTTCTAGGCCGGG - Intergenic
1060805810 9:126575650-126575672 TTAAAATTCTGTTCCTTGGCCGG + Intergenic
1060928443 9:127472253-127472275 TGAAAAATTATTTCTTGGCCAGG - Intronic
1061003165 9:127914097-127914119 AAAAAAAACATTTCTTGGGCGGG + Intronic
1061076824 9:128346528-128346550 TTTAAAAACTTTTTTTAGGCCGG - Intronic
1061115377 9:128607297-128607319 TGAAAAAGCTTTTGTTGGCCAGG - Intronic
1061317045 9:129802981-129803003 TTAAAAAAATTTTTTCGGGCCGG - Intergenic
1061428108 9:130513728-130513750 TAAAAAATTTTTTCTGGGCCAGG - Intergenic
1061611460 9:131749423-131749445 TTAAAAAGTTTTTTTGGGGCTGG + Intergenic
1061765938 9:132881467-132881489 TTAAAAAACGTTTTTGGGGCTGG + Intronic
1061837246 9:133337405-133337427 TTAAAAAAATTTTTTTGGCCAGG + Intergenic
1062314463 9:135959666-135959688 TTAAAAAACTTCTCTGGGCCGGG - Intronic
1062338960 9:136085309-136085331 TTAAAAAAATTTTTTTGGGTCGG - Intronic
1062608496 9:137360325-137360347 TAAATAATCTTCTCTTGGTCTGG + Intronic
1062654771 9:137597785-137597807 TTAAAAATTTTATTTTGGCCGGG - Intergenic
1203704434 Un_KI270742v1:26219-26241 TTTAAAATATTTACTTGGCCAGG + Intergenic
1203559565 Un_KI270744v1:39603-39625 TTTAAAATATTTACTTGGCCAGG - Intergenic
1185536231 X:863518-863540 TTTAAACTCTTTTCCTGGCCGGG + Intergenic
1185549151 X:969676-969698 TTAAAAATGTGTTTTTCGGCCGG + Intergenic
1185718332 X:2361399-2361421 TTTAAAAACTTTTATTGAGCTGG - Intronic
1186330392 X:8526435-8526457 TTCAAAAATTTTTCTTGGCCGGG + Intergenic
1186508632 X:10113941-10113963 TTAAAAAGCAATTCTGGGGCCGG - Intronic
1187352161 X:18530031-18530053 TTAAAAATCTTTATTTTGCCGGG + Intronic
1187768768 X:22672001-22672023 GTAAAAGTCTCTTCTAGGGCAGG + Intergenic
1187862195 X:23693371-23693393 TTTAAAATATATTTTTGGGCTGG - Intergenic
1187880093 X:23838711-23838733 TTTAAAAGCTTGTCTTGGCCGGG - Intronic
1188305804 X:28558641-28558663 TTAAAAATGGTTTCCTGGGCTGG - Intergenic
1188331547 X:28878152-28878174 ATAAAAATCTTTTCTTTGCCTGG + Intronic
1188384872 X:29543948-29543970 TTTAAAATCTTTTTTTGGTGTGG - Intronic
1188473911 X:30569714-30569736 TTAAAAATCTATATTCGGGCCGG + Intronic
1188857049 X:35209348-35209370 GAAAAAATGTTTTCATGGGCAGG - Intergenic
1188892027 X:35623553-35623575 TTTGAAATATTTTCTTGGCCAGG + Intergenic
1188975668 X:36671797-36671819 TTAACAGTATTTTCTTTGGCTGG + Intergenic
1189044202 X:37573079-37573101 TTAAAAATATTTGCTTAGGATGG + Intronic
1189262380 X:39687951-39687973 TTAAGCCTCTTTTCCTGGGCAGG - Intergenic
1189412540 X:40785988-40786010 TTAAAAAGTGTTTCTTGGGCTGG + Intergenic
1189771761 X:44434212-44434234 TTCAAAATCTGTTCTTGGCTGGG + Intergenic
1189950453 X:46224783-46224805 TTCAAAATATTTTCTAGGCCGGG - Intergenic
1190012521 X:46797522-46797544 TAAACAATCTTGTCTGGGGCCGG - Intergenic
1190068630 X:47261019-47261041 TTAAAATTTTTTTATTGGCCGGG - Intergenic
1190124870 X:47695232-47695254 TTAAAAATCTAGTTTTGGCCAGG - Intergenic
1190219845 X:48504796-48504818 TAAAAATTCTTTTCTGGGCCAGG - Intergenic
1190624929 X:52327917-52327939 ATAAAAATATTTTCCTGGCCGGG - Intergenic
1190706915 X:53036752-53036774 ATAAAAATCTTTTTATGGCCAGG + Intergenic
1190754072 X:53385569-53385591 TTAAAAATCTATCCTGGGGCCGG - Intronic
1190763963 X:53460600-53460622 TTAAATATATTTTTTTGGCCAGG + Intergenic
1190769024 X:53499758-53499780 TAAAAAAATTTTTTTTGGGCCGG - Intergenic
1190834580 X:54088751-54088773 AGAAAATTCTTTTCTTGGCCAGG + Intronic
1191164134 X:57369115-57369137 TTAAAAATTCTTTCTTCTGCTGG - Intronic
1191259241 X:58295506-58295528 TTAAACATCTTCTATTCGGCAGG + Intergenic
1191673330 X:63769607-63769629 GAAAAAATTGTTTCTTGGGCCGG + Intronic
1192008500 X:67242513-67242535 GAAAAAATGGTTTCTTGGGCTGG + Intergenic
1192089103 X:68133877-68133899 TTAAAAACATTTGCTTGGCCGGG + Intronic
1192108697 X:68342264-68342286 TTTAAAATATTTTCTTGGCTGGG - Intronic
1192297140 X:69862737-69862759 TTTAAAATATGTTCTTGGCCAGG - Intronic
1192520785 X:71798058-71798080 TTAACATCCTTTTCTTGGCCAGG - Intergenic
1192566903 X:72172546-72172568 TTAAAAATAATTTTTTAGGCCGG + Intergenic
1192642245 X:72872638-72872660 TGACAAATCTTTGGTTGGGCGGG - Intronic
1192696666 X:73423249-73423271 TTAAAAATCTTTTGTAAGGTAGG - Intergenic
1192739575 X:73879943-73879965 TTTAAGATTTTTTCTTGGGCTGG - Intergenic
1192802975 X:74484919-74484941 TTAAAATTCTTATTTTGGCCGGG + Intronic
1193966352 X:87991805-87991827 TTGAAAATCTGTTGTTGGCCAGG + Intergenic
1194010805 X:88558893-88558915 TTAAAAATGTGTTTCTGGGCCGG + Intergenic
1194276664 X:91892945-91892967 TTAAAATTGTGTTCTTGGCCGGG - Intronic
1194351704 X:92829603-92829625 TTAAAATTCTTTTCTGGGTGTGG - Intergenic
1194675389 X:96788004-96788026 TTAAAACTAATTTCTAGGGCCGG - Intronic
1194699175 X:97092887-97092909 TTAAAAATCTATTCTAGGCCAGG + Intronic
1195064525 X:101228610-101228632 TTAAAAATCATGTTTTAGGCTGG + Intronic
1195110577 X:101644854-101644876 TTAAAAATCTTATGTTAGACTGG - Intergenic
1195628211 X:107026234-107026256 TTAAAAACACTTTATTGGGCCGG + Intergenic
1196439412 X:115704570-115704592 TTAAAAAGGTTTTTTTGGCCGGG - Intergenic
1196582202 X:117391914-117391936 TTAAAAATGTTGTCTGGGGTGGG - Intergenic
1196683014 X:118487683-118487705 TTAAAAATATTTTTTAGGCCGGG - Intergenic
1196732075 X:118951100-118951122 TGAAAAATATTTTCTGGGCCAGG - Intergenic
1196752811 X:119132803-119132825 TTAAAAAACTTTTCTTGTTGGGG + Intronic
1196817378 X:119676163-119676185 TTAAAAAGCAATTATTGGGCCGG + Intronic
1197169760 X:123419109-123419131 TTAAAAATGTTATGCTGGGCCGG + Intronic
1197198435 X:123727044-123727066 TTAAAAACATTTTTTTGTGCGGG - Intronic
1197227342 X:123967177-123967199 TCAATAATCTCTTCTTGGCCAGG - Intronic
1197580995 X:128283483-128283505 TTAAAAATATTTTTTTAGGCTGG - Intergenic
1197690927 X:129500460-129500482 TTAAAAATCTTGTTGTGGGCTGG - Intronic
1198127688 X:133662435-133662457 ATTAAAATCTTCCCTTGGGCTGG - Intronic
1198153683 X:133935915-133935937 ATAACAATCTTTTCTTGAGACGG + Intronic
1198163921 X:134034633-134034655 TGAAATTTCTTTTCCTGGGCTGG - Intergenic
1198270843 X:135054858-135054880 TTAAAATTCATTGCTTGGGAAGG + Intergenic
1198399911 X:136259018-136259040 TTAAAAATCTGTTCTTGCTGTGG + Intergenic
1198538216 X:137607900-137607922 TTATCAATCTTTTCTTGGATGGG - Intergenic
1198693267 X:139307476-139307498 GGAAAAATCATTTCCTGGGCTGG + Intergenic
1198746097 X:139892151-139892173 TTAAAAATCTATTACTAGGCCGG - Intronic
1198931513 X:141866127-141866149 TTAAAAATCTTTTCTTCCCAGGG - Intronic
1198947803 X:142034140-142034162 TCAAAAATCTATTATTGGCCAGG + Intergenic
1199090915 X:143691551-143691573 TGAAAATTGTTTTCTTGGCCGGG + Intergenic
1199412016 X:147535223-147535245 TGAAAAGTCTTTATTTGGGCTGG - Intergenic
1199489673 X:148384396-148384418 TTAAAAAAGTTGTCTTGGCCAGG - Intergenic
1199733254 X:150658603-150658625 TTAAAAAAATTTTCTTGGGGGGG - Intronic
1200170110 X:154066520-154066542 TAATAAATCTTTTTTTGGCCTGG + Intronic
1200342080 X:155408610-155408632 GAAAAAATGTTTTCATGGGCTGG + Intergenic
1200593964 Y:5114731-5114753 TTAAAATTGTGTTCTTGGCCGGG - Intronic
1200689027 Y:6287369-6287391 TTAAAATACATTTCTTGGCCAGG - Intergenic
1201046245 Y:9887353-9887375 TTAAAATACATTTCTTGGCCAGG + Intergenic
1201189296 Y:11432839-11432861 TTAAAAATATTTTTTAGGCCAGG - Intergenic
1201322944 Y:12720404-12720426 TTAAGAATCTTTTTTGGGGTGGG - Intronic
1201336030 Y:12880718-12880740 TTAAATATCTTTTCTTGGCCTGG + Intergenic
1202589320 Y:26465839-26465861 TTAAAAATCTGTCCATGGGCAGG - Intergenic