ID: 1015174320

View in Genome Browser
Species Human (GRCh38)
Location 6:130289798-130289820
Sequence TGGTTTAAAAATCTTTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4795
Summary {0: 1, 1: 0, 2: 8, 3: 138, 4: 4648}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174320_1015174322 -4 Left 1015174320 6:130289798-130289820 CCCAAGAAAAGATTTTTAAACCA 0: 1
1: 0
2: 8
3: 138
4: 4648
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data
1015174320_1015174325 6 Left 1015174320 6:130289798-130289820 CCCAAGAAAAGATTTTTAAACCA 0: 1
1: 0
2: 8
3: 138
4: 4648
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166
1015174320_1015174324 0 Left 1015174320 6:130289798-130289820 CCCAAGAAAAGATTTTTAAACCA 0: 1
1: 0
2: 8
3: 138
4: 4648
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174320 Original CRISPR TGGTTTAAAAATCTTTTCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr