ID: 1015174321

View in Genome Browser
Species Human (GRCh38)
Location 6:130289799-130289821
Sequence ATGGTTTAAAAATCTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 7, 3: 73, 4: 661}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174321_1015174324 -1 Left 1015174321 6:130289799-130289821 CCAAGAAAAGATTTTTAAACCAT 0: 1
1: 0
2: 7
3: 73
4: 661
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174321_1015174322 -5 Left 1015174321 6:130289799-130289821 CCAAGAAAAGATTTTTAAACCAT 0: 1
1: 0
2: 7
3: 73
4: 661
Right 1015174322 6:130289817-130289839 ACCATGTAGTCAGAAGACCTAGG No data
1015174321_1015174325 5 Left 1015174321 6:130289799-130289821 CCAAGAAAAGATTTTTAAACCAT 0: 1
1: 0
2: 7
3: 73
4: 661
Right 1015174325 6:130289827-130289849 CAGAAGACCTAGGTAGGTGATGG 0: 1
1: 0
2: 1
3: 17
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174321 Original CRISPR ATGGTTTAAAAATCTTTTCT TGG (reversed) Intronic
900863406 1:5249811-5249833 ATGGTATAAGAAACTTTTCTTGG - Intergenic
900863932 1:5253917-5253939 AAGGTCTAAGAAACTTTTCTGGG - Intergenic
902073571 1:13764027-13764049 ATCGTTTTAAAATATTTTCAAGG - Intronic
902452961 1:16509926-16509948 ATGGTTTAATAATCTTGGTTAGG - Intergenic
902473018 1:16662606-16662628 ATGGTTTAATAATCTTGGTTAGG - Intergenic
902485785 1:16744834-16744856 ATGGTTTAATAATCTTGGTTAGG + Intronic
902499520 1:16900310-16900332 ATGGTTTAATAATCTTGGTTAGG + Intronic
903622105 1:24705347-24705369 AAGGTTTAAAAATTGTTTCTAGG - Intergenic
905045942 1:35001242-35001264 ACAGTTTTAGAATCTTTTCTTGG - Intronic
905422558 1:37858487-37858509 AAGGTTGAAACATCTGTTCTAGG - Intronic
905738395 1:40347999-40348021 ATGTTTTAAAAATCCTAGCTGGG + Intronic
906059778 1:42940993-42941015 AGGGTTTAAAAATGGTTTCTAGG - Intronic
906470620 1:46127171-46127193 ATGTTTTAAAAATTATTTTTTGG - Intronic
907064912 1:51471255-51471277 CTGGTTTATAAATCATTTTTTGG + Intronic
907083414 1:51645843-51645865 ATGGTTTAATCATCATTTGTTGG + Intronic
907423933 1:54366789-54366811 ATGGTTTCAAAGTCTTTTGTAGG - Intronic
908409183 1:63845794-63845816 CTGCTTTAAAAATCTCTTTTCGG + Intronic
908455437 1:64299431-64299453 ATAATTTAAAAAAATTTTCTGGG - Intergenic
908749919 1:67411856-67411878 ATGAATTAAAAAAGTTTTCTAGG - Exonic
909821727 1:80071903-80071925 ATTGTTTAAAAATATTCTTTAGG + Intergenic
910207579 1:84763468-84763490 ATTTTTTAAAAATTTTTTGTAGG + Intergenic
910316155 1:85885995-85886017 ATGATTTTTAAATCTTTTTTAGG + Intronic
910389070 1:86718388-86718410 ATGTTTTAAAAAGCTCTTTTTGG + Intronic
910481133 1:87659564-87659586 GTGGTTAAAAAATGATTTCTTGG - Intergenic
910544838 1:88403080-88403102 ATAGTTTCAAAATATTTTGTAGG - Intergenic
911485922 1:98504976-98504998 CTTGTTTAAAAATTTTTACTAGG + Intergenic
911639998 1:100278174-100278196 ATGGCCTCAAAATATTTTCTTGG - Intronic
911818302 1:102383193-102383215 ATTCTTTAAAAATCTTCTCAAGG + Intergenic
911829483 1:102532813-102532835 ATGGTTTAACAATGCTTTCCAGG + Intergenic
912047482 1:105477954-105477976 ATGCATTTAAAATGTTTTCTTGG - Intergenic
912238191 1:107875711-107875733 ATGGTTTAAAAAGGTCTTTTTGG + Intronic
912241523 1:107915130-107915152 TAAGTTTAAAAATCTTTTCTTGG - Intronic
913232481 1:116752354-116752376 ATGTTTTAAAATTCTGTTCAAGG - Intergenic
914220558 1:145678060-145678082 GTTGTTTAATAATCCTTTCTAGG + Intronic
914473137 1:148000930-148000952 GTTGTTTAATAATCCTTTCTAGG + Intergenic
914795895 1:150920136-150920158 ATGGTTTAACAAGCCCTTCTTGG + Intergenic
915412129 1:155709543-155709565 GAGGTTCAAAAATCTTTTCATGG + Intronic
915486830 1:156227201-156227223 ATGAATTAAAAATTTTTTTTTGG + Intronic
915829335 1:159111627-159111649 ATCTTTTAAAAATCTTTTCTAGG - Intronic
916159469 1:161894250-161894272 ATGGTTTTAAAAACTTATTTTGG + Intronic
916264609 1:162878000-162878022 ATGATTTAAAAAACTGTGCTAGG - Intergenic
916845218 1:168643501-168643523 TTTATTTATAAATCTTTTCTTGG - Intergenic
917239721 1:172934464-172934486 ATGGTTAAATAAACTTTCCTAGG - Intergenic
917547585 1:175987192-175987214 ATAGTTCAAAGATCTTTTATGGG + Intronic
918277963 1:182972722-182972744 ATGTTTTATAAATCTTTTAAAGG - Intergenic
918330334 1:183454165-183454187 ATTTTTTAAAAATTTTTTGTAGG - Intergenic
919057832 1:192592715-192592737 ATGGTTCAAGAGTTTTTTCTAGG + Intergenic
919455724 1:197817842-197817864 ATGCTTTAAAAATATGTTATTGG - Intergenic
921566294 1:216724571-216724593 ATGGTTTATAAAATGTTTCTGGG - Intronic
921585639 1:216943220-216943242 TTGTTTTAAAAATATTCTCTGGG - Intronic
921877251 1:220212110-220212132 ATGGTTACAAAAGCTTTACTGGG + Intronic
922057993 1:222059705-222059727 ATGGTATAAAACTTTTGTCTTGG - Intergenic
922939103 1:229445980-229446002 TTTGTTTAAAATTCTTTTCCTGG + Intronic
923190547 1:231616176-231616198 CTGGTTTCAAAATGTTTTATGGG - Intronic
923225509 1:231935542-231935564 ATTGTTTAAAAATGTTTGCATGG - Intronic
924147186 1:241088512-241088534 ATGGTTAAAATATGATTTCTGGG - Intronic
924147308 1:241089511-241089533 ATGGTTAAAATATGATTTCTGGG - Intronic
924252039 1:242142645-242142667 AGAGGTTAAAAATCCTTTCTAGG - Intronic
924295820 1:242586032-242586054 ACTTTTTAAAAATCTTTTCTGGG + Intergenic
1063467425 10:6256211-6256233 AAGGTTTAAATCTCCTTTCTTGG + Intergenic
1063514037 10:6676358-6676380 CTGTTTTAAAATTCTTTTATGGG + Intergenic
1063757977 10:9037652-9037674 TTGGTTTAGATATTTTTTCTTGG - Intergenic
1064067017 10:12190902-12190924 ATCTTTTAAAAATCTTGGCTGGG - Intronic
1064611378 10:17106284-17106306 ATAATTAAAAAATTTTTTCTTGG - Intronic
1064787417 10:18913720-18913742 ATTGTTTAAAAACCTCTTCAAGG - Intergenic
1064957274 10:20924813-20924835 ATGGTTAACTAAGCTTTTCTGGG - Intronic
1066164272 10:32769417-32769439 AATTTTTAAAAATCTTTTCAGGG + Intronic
1066315276 10:34239897-34239919 AGAGTTTAAAAATATTTTATTGG + Intronic
1066318226 10:34270979-34271001 AGGGTTTTAAAATTTTTTCCAGG - Intronic
1067036134 10:42919268-42919290 TTGGATTAAAAATCTCTTTTGGG + Intergenic
1067966617 10:50920504-50920526 ATGGTTAAAAAATATTTTTCAGG - Intergenic
1068130919 10:52894222-52894244 ATGTTTTAAAAATATTGTCCTGG + Intergenic
1068633326 10:59320973-59320995 AGGGTTTCTAAATATTTTCTGGG + Intronic
1068695621 10:59965346-59965368 TTGGTTTTAAAATCCTTTCAAGG + Intergenic
1069019491 10:63470069-63470091 ATGTTTTGAAAATCTGTTATTGG - Intergenic
1069351637 10:67533449-67533471 ATTGTTTATAAATTTTTTATAGG - Intronic
1069647672 10:70015599-70015621 ATGTTTTAAAAATATTTTTCAGG - Intergenic
1069973324 10:72191945-72191967 ATGTCTAAAAAATCTTTTCCTGG - Intronic
1069978254 10:72232902-72232924 CTGGTATAAAAATAATTTCTAGG - Intronic
1071119320 10:82259769-82259791 ATTGTTTAAAAATATTATCCAGG + Intronic
1071208590 10:83312618-83312640 GTGGCTTGAAAATCTTTACTAGG + Intergenic
1071639872 10:87295936-87295958 GGGATTTAAAAATCTTTACTGGG + Intergenic
1071655362 10:87442016-87442038 GGGATTTAAAAATCTTTACTGGG - Intergenic
1072243093 10:93515563-93515585 CTGGTATAAAAATGTTCTCTAGG + Intronic
1072519024 10:96214008-96214030 GTATTTTAAAAATCTTTTCCTGG - Intronic
1072715382 10:97748890-97748912 ATGTTTTAGAAAATTTTTCTTGG + Intronic
1073325257 10:102640742-102640764 ATGTTTTAAAAATGATTCCTAGG - Intergenic
1073613068 10:104963880-104963902 ACAGTTTAAAAATCTTTTAAGGG + Intronic
1073627265 10:105112293-105112315 GTCATTTAAAAATCTTTTTTGGG + Intronic
1073737687 10:106368323-106368345 CTTGGTTAAAACTCTTTTCTAGG - Intergenic
1073857350 10:107693084-107693106 ATGGTCTAAAAATCTTCTAAGGG - Intergenic
1073863760 10:107776910-107776932 ATTGTTTTAAGATGTTTTCTGGG + Intergenic
1074113003 10:110436093-110436115 ATTATTTAATAATTTTTTCTTGG + Intergenic
1074398731 10:113123407-113123429 ATGCTTGAAAAATCTTTAGTCGG + Intronic
1075271508 10:121055936-121055958 ATGGATTATAAATTTTTTTTTGG + Intergenic
1076352489 10:129826771-129826793 ATGTTTTAAAAATCCATTCATGG + Intergenic
1078460187 11:11509302-11509324 ATGTTTAAAAAATCTTTCTTTGG - Intronic
1078820267 11:14872943-14872965 ATGGTTTAAAACTATTGTTTTGG + Intergenic
1078880253 11:15441085-15441107 GTGGTTCAAAAATCTTTAGTGGG - Intergenic
1078950080 11:16120947-16120969 ATGTTTTAAAAATCTTCTTCAGG + Intronic
1079932019 11:26575798-26575820 ATAGGTTTAAAATATTTTCTTGG + Intronic
1080042962 11:27778554-27778576 ATAGTTTAAATATTTGTTCTTGG - Intergenic
1080105627 11:28508816-28508838 TTGGTTTAACAATTTTTTTTTGG - Intergenic
1080152249 11:29066492-29066514 ATGGTTTTAAGATCTCTTCTTGG - Intergenic
1080496003 11:32819759-32819781 ATGGTTTAAAAATAGCCTCTTGG - Intergenic
1081739542 11:45428648-45428670 ATGGTTTAGAAATCCTTTTATGG + Intergenic
1084137100 11:67192778-67192800 AAGGTTTATAAATTTCTTCTTGG + Intronic
1084856658 11:71993211-71993233 ATGGTCTAGAAATCTCTTCTGGG - Intronic
1085064663 11:73483029-73483051 GTGGCTTAAAAACCTGTTCTTGG - Intronic
1085794834 11:79529608-79529630 ATATTTTAAAAATGTGTTCTGGG + Intergenic
1086080477 11:82898840-82898862 CTGGGTTAAAAATTGTTTCTTGG + Intronic
1086238126 11:84657061-84657083 AAGGATTAAGAATCTTTCCTAGG + Intronic
1086315849 11:85591314-85591336 ATGCTTTTAAAATGTCTTCTAGG - Intronic
1086609477 11:88737444-88737466 ATGTATTAAACATCTTTTATGGG + Intronic
1086874274 11:92076212-92076234 TTGGTCTAAAATTCTTTTTTTGG - Intergenic
1087247666 11:95858632-95858654 TTGGTTCCTAAATCTTTTCTAGG - Exonic
1087462735 11:98465628-98465650 ATGTTTTAAAAATTCTTTCATGG - Intergenic
1087760439 11:102099408-102099430 ATTCTTTAAAAATATTTTTTTGG - Intergenic
1087935270 11:104026480-104026502 ATGGTTTAAAAAATGTTTTTTGG - Intronic
1088035258 11:105304358-105304380 ATGGTTATAAAAGCTTTTCACGG - Intergenic
1088418292 11:109613990-109614012 ATGGTTTTGAAAACTCTTCTTGG - Intergenic
1088989214 11:114937268-114937290 ATGCTTTAAAAGTCTTTGCAAGG - Intergenic
1089023939 11:115248230-115248252 ATGGGTGAAAACTCTTTTCAAGG + Intronic
1089544549 11:119213113-119213135 ATCTTTTAAAAATACTTTCTTGG - Intronic
1092437472 12:8461883-8461905 ATGTTTTCAAAATCCTTTTTGGG - Intronic
1092506724 12:9109290-9109312 ATTTTTTAAAAATCTTTTGTGGG - Intronic
1093008582 12:14079944-14079966 CTCGGTAAAAAATCTTTTCTGGG + Intergenic
1093624981 12:21335119-21335141 AAGGCTCAAAAATCTTTTTTTGG + Intronic
1093794520 12:23295614-23295636 ATGGTTTCAAAATTTTATTTGGG - Intergenic
1093794859 12:23299404-23299426 ATGGCTTAAAATACTTTTATGGG + Intergenic
1094403749 12:30092255-30092277 ACAGTTTAAAACTTTTTTCTCGG - Intergenic
1094626473 12:32129222-32129244 ATTTTTTAAAAATTTTTTGTAGG + Intronic
1096133441 12:49179557-49179579 ATGTTTTATAAGTTTTTTCTGGG - Intergenic
1097253886 12:57657232-57657254 TCATTTTAAAAATCTTTTCTAGG - Intergenic
1098527363 12:71501229-71501251 ATGGTTTAAAAATAATTTAAGGG + Intronic
1098619215 12:72571530-72571552 TTGGTTTAAAAATTATTTTTAGG - Intronic
1098646605 12:72909669-72909691 ATGGCCTAAAACACTTTTCTTGG + Intergenic
1099037578 12:77608601-77608623 ATGCAGTAAAAATATTTTCTAGG + Intergenic
1099097632 12:78395003-78395025 ATCGCTTAAAAATCATTTATTGG + Intergenic
1099341381 12:81439477-81439499 ATGATTGAAAAAACTTTTTTGGG + Intronic
1099351175 12:81570558-81570580 TTGGTTTTAAAATCTATTGTGGG + Intronic
1099550321 12:84035501-84035523 ATGTTTTAAAAATGTTTTTTAGG + Intergenic
1099705043 12:86141609-86141631 AGGGTTTTGTAATCTTTTCTTGG + Intronic
1099792041 12:87348373-87348395 ATGGTTTAAAATTCAATTCGAGG - Intergenic
1099852886 12:88125369-88125391 ATTGTTTTAAAATATTTTATAGG - Exonic
1100160075 12:91848361-91848383 ATGGTTTTATAATATTTTTTAGG - Intergenic
1100244716 12:92745829-92745851 GGGGCTTAAAAATGTTTTCTTGG + Intronic
1100848362 12:98683421-98683443 ATAGCTTAAAAATATTTTATTGG + Intronic
1100867081 12:98868400-98868422 ACGGTTTCAAAATCTTTTGCAGG + Intronic
1101638438 12:106566875-106566897 ATGCTTTGAAATGCTTTTCTTGG + Intronic
1101869537 12:108553448-108553470 ATTGTTTAAAAAGCTTTTGTTGG + Intronic
1102401000 12:112629640-112629662 ATAATTTAAAAATTTTTTGTAGG + Intronic
1105346459 13:19577149-19577171 TTGGTCTAAAATTCTTTTTTTGG + Intergenic
1105464353 13:20623786-20623808 ATGTTTTAAAAAATTTCTCTCGG + Intronic
1106139425 13:26999412-26999434 ATGGATTAAACATCTTTTAAGGG - Intergenic
1106263413 13:28088881-28088903 ATTTTTTAAGAATGTTTTCTGGG - Intronic
1106836099 13:33636696-33636718 ATTTTTTAAAAATAGTTTCTGGG - Intergenic
1107870497 13:44742137-44742159 ATTTTTTAAAAATCATGTCTTGG + Intergenic
1108363635 13:49689841-49689863 ATAGCTTAAAAATCAATTCTCGG + Intronic
1109053185 13:57510566-57510588 ATGTTTTCAAAATGTCTTCTTGG + Intergenic
1109339496 13:61037507-61037529 ATATTTTAAAAATCTTATTTGGG + Intergenic
1109647481 13:65277423-65277445 ATGTTTTAATAATGTTTTCATGG - Intergenic
1109762765 13:66851770-66851792 ATATGTTAAAACTCTTTTCTTGG + Intronic
1109913342 13:68945962-68945984 AGGGTTTAAAAATTATCTCTTGG + Intergenic
1110782580 13:79482900-79482922 ATGGTTTGAAAGGCATTTCTAGG + Intronic
1110834292 13:80066126-80066148 AAGGTTTGAAAATCTTTACCAGG + Intergenic
1111136077 13:84046047-84046069 ATTCTGTAAAACTCTTTTCTAGG + Intergenic
1111215049 13:85130658-85130680 ATGGTTTAACAGTACTTTCTGGG - Intergenic
1111669612 13:91313107-91313129 ATATTTTTAAAATCTTTCCTTGG + Intergenic
1112488299 13:99839677-99839699 ATCTTTTAAAAATTTTTTGTGGG + Intronic
1112845082 13:103632315-103632337 ATGCTTTTAAGATGTTTTCTCGG - Intergenic
1113052833 13:106233749-106233771 ATTTTTTAAAATTTTTTTCTGGG - Intergenic
1114800076 14:25764070-25764092 ATTATTTAAAAATATCTTCTCGG - Intergenic
1114955715 14:27815999-27816021 ATGGCCTAAAAATCAATTCTAGG + Intergenic
1115442947 14:33456996-33457018 ATGGTATAAAACGCTTTTGTGGG - Intronic
1115703028 14:35974051-35974073 ATTATTAAAAATTCTTTTCTAGG + Intergenic
1115790233 14:36869815-36869837 AAGATTTAAATGTCTTTTCTGGG - Intronic
1116008186 14:39320217-39320239 ATGTTTTAAAAATGTTATTTTGG + Intronic
1116522000 14:45860648-45860670 ATGGGTTCAAAATATCTTCTTGG + Intergenic
1116598352 14:46884030-46884052 ATGGCTTAAAATTCTATTATTGG + Intronic
1116977289 14:51130548-51130570 ATATTTTATAAATCCTTTCTAGG + Intergenic
1117158279 14:52962071-52962093 AAGTTTTAAAAATTTTTTATAGG - Intergenic
1117924723 14:60766411-60766433 TTGTTTTAAAAATCTTTTTGTGG + Intronic
1118063143 14:62162508-62162530 GTGGATTAAAAGTCATTTCTAGG - Intergenic
1118091518 14:62485443-62485465 AACCTTTAAAAATCTCTTCTGGG - Intergenic
1118144667 14:63122759-63122781 TTGATTTTAAAATCTTTCCTGGG - Intergenic
1118421390 14:65608992-65609014 AGGATTTAAAAATATTTTCTTGG + Intronic
1118657209 14:67965501-67965523 CTGGTTTAAAAACCTTTGATGGG + Intronic
1118981367 14:70719406-70719428 ATGGTTTAAAAATGTTCTTTTGG - Intergenic
1119597663 14:75951041-75951063 ATTTTTTAAAAACCTTATCTGGG + Intronic
1119604858 14:76006820-76006842 ATGTTTAAAAAATATTTTTTAGG + Intronic
1119792661 14:77366942-77366964 CTCTTTTAAAAACCTTTTCTAGG + Intronic
1120045673 14:79802870-79802892 ATGTTTAAAAATTCTTTTTTCGG + Intronic
1120336212 14:83158770-83158792 ATGTATTAACAATGTTTTCTAGG - Intergenic
1120386832 14:83857115-83857137 ATTGTTTTAAAAACTTTTTTTGG + Intergenic
1120909115 14:89649566-89649588 ACGGTTTAAAAATATTTTGGAGG - Intergenic
1120950615 14:90038319-90038341 ATGGTTTTAAAACCTTTTGGAGG - Intronic
1121094116 14:91203970-91203992 AAGATTTAAAAATCTAGTCTGGG - Intronic
1121540706 14:94723908-94723930 ATGCTTTACAAATGTTTTCTAGG + Intergenic
1121683373 14:95813253-95813275 ATTTTTTCAAAATCTTTTCTTGG - Intergenic
1123575365 15:21660976-21660998 ATGGTTTAGGAATCATTGCTGGG - Intergenic
1123840923 15:24246341-24246363 ATATTTTAAAAATATTTTCCTGG + Intergenic
1123959103 15:25375935-25375957 ATAGTTAATAAATATTTTCTAGG + Intronic
1123982716 15:25618537-25618559 ATGATTTAAAAATCTATTCCTGG - Intergenic
1125009442 15:34854998-34855020 CTGCTTTCAAAATCTTTTATCGG + Exonic
1125123093 15:36186979-36187001 ATTGTTTGAAAGTCTTTACTGGG - Intergenic
1125150976 15:36531705-36531727 TAGGTTTAAAAAAATTTTCTTGG - Intergenic
1125399810 15:39289340-39289362 ATTATTTAAAACTTTTTTCTTGG - Intergenic
1126550517 15:49923942-49923964 ATGGTTTATGCATTTTTTCTTGG + Intronic
1126606012 15:50477037-50477059 ATGGTTTAAAATTGTTTTCCCGG + Intronic
1126913644 15:53441414-53441436 AATGTATCAAAATCTTTTCTGGG + Intergenic
1127131022 15:55863995-55864017 ATTTTTTAAAAATCTTTCTTTGG - Intronic
1128025663 15:64434657-64434679 ATGTTTGAAAAATATGTTCTAGG + Intronic
1128430095 15:67584562-67584584 ATGGTTTAGATATATTTTCTAGG + Intronic
1128436080 15:67650024-67650046 ATGATTTAAAAATAATTTTTAGG + Intronic
1128853170 15:70982779-70982801 CTGTTTTAAACATGTTTTCTGGG - Intronic
1129488999 15:75904738-75904760 ATGTTTACAAAATCTTTTCACGG - Intronic
1130079271 15:80717704-80717726 GTGGTTTTAAAATCTTTATTTGG + Intronic
1130389688 15:83444665-83444687 ATTTTTTAAAAAGCTTTTCTAGG - Intergenic
1130608165 15:85336177-85336199 ATTTTTTAAAAATGTTTTGTAGG - Intergenic
1130703860 15:86213211-86213233 ATGTTTATGAAATCTTTTCTTGG + Intronic
1131118955 15:89811344-89811366 TTGGTTTAAAAATTGTTCCTGGG + Intronic
1132233510 15:100201831-100201853 TTTGTTTAAAAATGTTTTGTGGG + Intronic
1202984233 15_KI270727v1_random:395221-395243 ATGGTTTAGGAATCATTGCTGGG - Intergenic
1133100656 16:3477498-3477520 ATGAGTTAAAAAACTGTTCTTGG + Intronic
1134424290 16:14124894-14124916 GTGGTTAAAAAATATTTTATAGG - Intronic
1135357042 16:21777794-21777816 AGGGTTTAAAAAGCTTTTCTCGG - Intergenic
1135455546 16:22593908-22593930 AGGGTTTAAAAAGCTTTTCTCGG - Intergenic
1136055636 16:27687324-27687346 AATATTTAAAAATATTTTCTAGG + Intronic
1136983347 16:35078462-35078484 TTGGTCTAAAATTCTTTTTTTGG - Intergenic
1137301320 16:47150650-47150672 GTGATTTGAAAATATTTTCTTGG + Intergenic
1137449488 16:48557420-48557442 GTGGCTTAAAAATGTTTTCCAGG - Intronic
1137686262 16:50388999-50389021 GTCCTTTAGAAATCTTTTCTGGG + Intergenic
1139080809 16:63518147-63518169 CTGATTTAAAAATCTCTTGTCGG - Intergenic
1139245672 16:65440634-65440656 AGTTTTTATAAATCTTTTCTAGG - Intergenic
1140690260 16:77476983-77477005 AAGAAATAAAAATCTTTTCTAGG + Intergenic
1140990540 16:80206930-80206952 ATGCTTTAAAAATCTCTTGAAGG - Intergenic
1141256326 16:82405658-82405680 ATGGTTTACAGATGTTTTCAAGG + Intergenic
1141310999 16:82913179-82913201 ATGGTCTAAAAAGTGTTTCTAGG + Intronic
1142315596 16:89342684-89342706 ATGGTGTAAAAATCTATTTATGG + Intronic
1144464152 17:15483256-15483278 AGGGCTTCAACATCTTTTCTGGG - Intronic
1145044025 17:19598211-19598233 ATGGTTAAAACATGATTTCTGGG - Intergenic
1145356543 17:22160741-22160763 ACAGTTTAAAAAAGTTTTCTGGG - Intergenic
1145918426 17:28591428-28591450 ATTTTTTAAAAATCTTTTGTAGG + Intronic
1146047745 17:29524262-29524284 TTGGTTTAAAAATCTGTTCATGG - Intronic
1146320574 17:31843392-31843414 TTGGGTGGAAAATCTTTTCTGGG + Intergenic
1146614292 17:34340593-34340615 ATGGTTTTAAGAGCTCTTCTTGG + Intergenic
1147616768 17:41833925-41833947 ATGTATTAAAATTCTTTACTTGG - Intronic
1148187594 17:45655904-45655926 CGGGTTTAGAATTCTTTTCTGGG + Intergenic
1149130215 17:53291412-53291434 ATGGTTTAAAAATCCCTTGAAGG - Intergenic
1149303778 17:55329114-55329136 ATGGTTTAAAAAGAATTTTTGGG - Intergenic
1149310976 17:55393229-55393251 ATGCTTTAAATATTTTTTCTAGG + Exonic
1149817979 17:59745460-59745482 AAGGTTTCAAAATCTGATCTGGG + Intronic
1150175256 17:63048122-63048144 AAGATTAAAAAATCCTTTCTAGG + Intronic
1150503755 17:65677203-65677225 ATAGTTTAAAGATCCTTTTTAGG - Intronic
1151069584 17:71193364-71193386 TTGATATAAACATCTTTTCTTGG + Intergenic
1151325693 17:73378718-73378740 TCTGTTTAAAAATCATTTCTAGG - Intronic
1151549807 17:74815737-74815759 TTGGTTTAAAGATCCATTCTCGG + Intronic
1152048828 17:77957706-77957728 TTGGTTTCAAAATCTTCTCCTGG + Intergenic
1152221386 17:79069945-79069967 ATGTTTTAAAATACTTTTCTGGG - Intergenic
1152268519 17:79310208-79310230 GTGCTTTAAAAATCTACTCTAGG - Intronic
1152773147 17:82182984-82183006 ATGGTTTAAAAGTGTTTGGTGGG - Intronic
1153130119 18:1846099-1846121 ATGCTTTTAAAAGATTTTCTGGG + Intergenic
1153160027 18:2193844-2193866 ATGCTATAAAAACCTTTTCTTGG - Intergenic
1153210006 18:2751907-2751929 ATAGTTTAAAAATTATTGCTAGG + Intronic
1153248946 18:3101096-3101118 ATCGTTCAATTATCTTTTCTTGG + Intronic
1153385736 18:4493241-4493263 ATGGTTTTAAAATATATTTTGGG + Intergenic
1154243545 18:12674843-12674865 AGCTTTTAAAAATCTTTTCTTGG - Intronic
1155305673 18:24475705-24475727 CAGGTTTAAAAATCCTTTTTGGG + Intronic
1155550043 18:26955054-26955076 ATGGGTTAAAAATCTTTAGATGG + Intronic
1155553078 18:26987469-26987491 AAGGTTTAAACAACTTTTTTCGG - Intronic
1155981485 18:32184766-32184788 ATGGTTTAAAAAGCCATTCATGG - Intronic
1156045804 18:32875753-32875775 CTGGTTTAAGGATCTTTACTGGG - Intergenic
1156060175 18:33064222-33064244 ATTGTTTTAAAATCATTTCCAGG - Intronic
1156068056 18:33169490-33169512 ATTCTCTAAAAATCTATTCTTGG + Intronic
1156170978 18:34485361-34485383 AGGTTTTAAAAATCTTAACTTGG - Intergenic
1156379379 18:36544014-36544036 ATGGTTTTAACATCTTATATAGG + Intronic
1157020304 18:43773474-43773496 ATGGTTTAACAATCATTTATGGG - Intergenic
1157025620 18:43839169-43839191 TTGGTCTAAAATTCTTTTTTTGG - Intergenic
1157479834 18:48046554-48046576 ATGTTTTAAAATGCTTTTCAGGG + Intronic
1158755526 18:60320216-60320238 CTGGTTAAAAAATCATTGCTTGG + Intergenic
1158770022 18:60504817-60504839 ATGCATTTAAAATATTTTCTTGG - Intergenic
1159384292 18:67703337-67703359 TTTGTTTTAAAATGTTTTCTAGG - Intergenic
1159480468 18:68984519-68984541 ATAGGTTAAAAATAGTTTCTAGG - Intronic
1159815037 18:73062772-73062794 ATGGTTTAAAAAATTTTTTAAGG + Intergenic
1160391351 18:78535955-78535977 AGGTTTTAAAATTATTTTCTTGG - Intergenic
1162126977 19:8504887-8504909 ATGTTTTAAAAATACTTGCTCGG - Intergenic
1162685748 19:12382644-12382666 ATTTTGTAAAAATTTTTTCTGGG - Intronic
1163931492 19:20397550-20397572 ATGGTATAAAAACCTTTACATGG - Intergenic
1164184614 19:22852509-22852531 ATGGTTGTTTAATCTTTTCTAGG + Intergenic
1165028896 19:32983117-32983139 ATTCTTTGAAAAGCTTTTCTTGG + Intronic
1165086657 19:33353209-33353231 ATCTTTTAAAAATCTTTTGGAGG - Intergenic
1165545969 19:36536131-36536153 ATTGTTTAAAATTGCTTTCTAGG - Intronic
1165882019 19:39051019-39051041 AAGTTTTAAAAATCTTGGCTGGG - Intergenic
1167039955 19:47018082-47018104 ATTTTTTAAAAATGTTTTGTTGG - Intergenic
1168094268 19:54105742-54105764 AGGGTTTAAAACTCTTTTTTGGG - Intronic
1168588653 19:57614806-57614828 ATACTTTAAAAATCCTTTTTCGG - Intronic
1202705202 1_KI270713v1_random:17664-17686 ATGGTTTAATAATCTTGGTTAGG - Intergenic
925981756 2:9182728-9182750 ATGGTTTACAAAACTTCACTTGG - Intergenic
926535775 2:14109784-14109806 ATGCTTTAAAAAACTTTTTGTGG - Intergenic
927479331 2:23438757-23438779 TTGGTCTAAAATTCTTTTTTTGG + Intronic
928348422 2:30521936-30521958 ATGATTTTAAAATCTTTTACTGG - Intronic
928507525 2:31969551-31969573 ATACTTTCTAAATCTTTTCTGGG + Intronic
928619622 2:33075323-33075345 ATGATTTAAAAATATTTTTTGGG + Intronic
928630958 2:33191618-33191640 ATGTTTTCAAAATCCTTTGTAGG - Intronic
928675747 2:33649325-33649347 ATGGTTTAAAAATCTTTCTGAGG + Intergenic
929150621 2:38745031-38745053 ATGGTTGAATTATCTTTCCTAGG + Exonic
929495629 2:42439941-42439963 TTCTTTTAAAAATATTTTCTTGG - Intergenic
929660893 2:43783421-43783443 ATTGATTAAAAATCTATTTTGGG + Intronic
930185905 2:48411748-48411770 CTTGTTTAAAAATATTTTCTAGG - Intergenic
930663849 2:54082599-54082621 ATGGTTTAAAAATTGATTATTGG - Intronic
930824368 2:55681542-55681564 ATCATATAAAAATATTTTCTAGG + Intronic
930931017 2:56882952-56882974 ATGTTATAAAAATATTTACTTGG + Intergenic
930936101 2:56953532-56953554 ACCTTTTAAAAATTTTTTCTTGG + Intergenic
931120110 2:59207116-59207138 ATTTTTTAAAAATCTTTTTGTGG - Intergenic
931956535 2:67432461-67432483 ATGTTTTAAAAAAATTTTTTAGG + Intergenic
932204966 2:69871943-69871965 TTGGTTTAAAAGTCTTTTGAAGG + Intronic
932293122 2:70600345-70600367 ATGTTATATAAATCTTTTCATGG + Intergenic
934481562 2:94652062-94652084 ATGGCCTAAAAATCAATTCTAGG - Intergenic
935511994 2:103987356-103987378 ACGTTTTAAAATTTTTTTCTGGG + Intergenic
936227235 2:110667363-110667385 ATGGGTTAATAATGATTTCTGGG + Intronic
937130762 2:119510895-119510917 ATGTTTTAAAATTATATTCTTGG + Intronic
937538524 2:122921126-122921148 CTGTTTTAAACATATTTTCTGGG + Intergenic
937733950 2:125266734-125266756 ATGGTGTAAACCTGTTTTCTAGG + Intergenic
939362081 2:141185569-141185591 TTGATTTAAAAATCTCTTCTTGG + Intronic
940308430 2:152251168-152251190 ATGGTTAAAAAACATTTCCTTGG + Intergenic
940573021 2:155465749-155465771 ATGGTGGAAAAATATTTTCACGG - Intergenic
940767531 2:157806318-157806340 ATGATATCAACATCTTTTCTGGG - Intronic
941552937 2:166939378-166939400 TGGGTTGAAAATTCTTTTCTTGG + Intronic
941572746 2:167192086-167192108 ATAGTTTCAAAACATTTTCTCGG + Intronic
941580401 2:167290666-167290688 ATACTTTAAAAATTTTGTCTTGG + Intergenic
941902284 2:170690004-170690026 ATAATTTAAAAATCCTTTCTTGG + Intergenic
942309403 2:174641211-174641233 AAGGTGTTAAATTCTTTTCTGGG + Intronic
942424455 2:175845063-175845085 TTGCTTTAAAAATCTATTCCAGG + Intergenic
943091527 2:183381176-183381198 TTTGTTTAAAAATAATTTCTAGG - Intergenic
943852099 2:192736965-192736987 AGACTTTCAAAATCTTTTCTTGG + Intergenic
943864440 2:192910952-192910974 ATATTTTAAAAATATTTTCTTGG - Intergenic
943876061 2:193069441-193069463 ATAGTTTATAAATTTCTTCTTGG + Intergenic
943921819 2:193716703-193716725 ATGATTTTAAAATATTTTCTTGG + Intergenic
944231416 2:197397291-197397313 ATGTTTTAAAAATCTTATTATGG - Intronic
944516310 2:200515081-200515103 ATGGTTTGGGAATCTTTTCCTGG - Intronic
944525873 2:200619169-200619191 ACTGGTTAAAAATCTTTACTGGG - Intronic
944704848 2:202278419-202278441 ATAATTTAAAAAGCTCTTCTGGG + Intronic
945093006 2:206193725-206193747 ATGGTTTAAATATTTTTTAAAGG + Intronic
945369390 2:208998066-208998088 AGGCTTTTAAAATCTTTTTTTGG + Intergenic
946857916 2:223971384-223971406 ATGGTTTAAGAAAACTTTCTGGG + Intergenic
946882141 2:224187115-224187137 AAAGTTTAAAAATTCTTTCTTGG - Intergenic
947167465 2:227277017-227277039 TTGTGTTAAAAATTTTTTCTTGG + Intronic
947596697 2:231417006-231417028 CTGCTTTAAAGTTCTTTTCTGGG - Intergenic
1169910993 20:10647288-10647310 ATGCTTTAAAACTCTTTGCCTGG - Intronic
1170263338 20:14437291-14437313 ATGTTTTAAAAAGGGTTTCTTGG + Intronic
1170430551 20:16272768-16272790 ATAATTTAAAATGCTTTTCTTGG + Intronic
1171539857 20:25940510-25940532 ATAGTTTAAAAATATTATATAGG - Intergenic
1172422942 20:34832903-34832925 ATTGTTTAAAAATCTTTACATGG + Intergenic
1172916278 20:38446471-38446493 ATGTTTCACAAATATTTTCTGGG + Intergenic
1173312115 20:41905790-41905812 ATTGTCTGAAAATCCTTTCTGGG - Intergenic
1173433796 20:43014869-43014891 ATGCTTTAAAATGCTTATCTAGG - Intronic
1174052845 20:47779291-47779313 ATAGTGTTAAAATGTTTTCTGGG + Intronic
1174242926 20:49152661-49152683 ATGGATTAAAAATCTTCTGCTGG - Intronic
1174265148 20:49325901-49325923 GAGGTTTAAAATTTTTTTCTTGG - Intergenic
1174499499 20:50974135-50974157 ATGTTTTAAAAATTTTTTTAGGG - Intergenic
1174947257 20:55001947-55001969 AAGGTTTAAAAATATTGTATTGG - Intergenic
1175472466 20:59240497-59240519 TTGGTTTGAAAATTATTTCTAGG + Intronic
1175566861 20:59986889-59986911 CTTGTTTCAAAATCTTTTCCTGG + Intronic
1176156693 20:63625895-63625917 CTAGTTTAAAAATATTTTCTTGG - Intronic
1176961053 21:15159132-15159154 AGGGTTGAAAAGTCTTTTCCAGG - Intergenic
1177304830 21:19300978-19301000 ATGTTTTCATAATCTCTTCTGGG + Intergenic
1177576681 21:22965856-22965878 ATGGTATACAAATCTTCCCTTGG - Intergenic
1177908986 21:27007509-27007531 ACGTTTTAAAATTCTTCTCTAGG - Intergenic
1178159732 21:29898089-29898111 ATGTTCTAATAATCTGTTCTTGG + Intronic
1178333131 21:31718594-31718616 TTGTTTTAAAAAGCTTTTCGGGG - Intronic
1179223749 21:39433556-39433578 ATGGATTAAAATTCATTTTTTGG + Intronic
1179305526 21:40150730-40150752 ATGCTTTAGACATCTTTGCTTGG + Intronic
1179442735 21:41406869-41406891 GAGGGTTAAAAATCTCTTCTCGG - Exonic
1180227158 21:46401167-46401189 TTGTTTGAAAAATTTTTTCTAGG + Intronic
1181290548 22:21789459-21789481 AAGGTCTAAAAACCTTTTCTGGG + Intronic
1181536106 22:23546304-23546326 ATGCCTCAAAAATTTTTTCTTGG - Intergenic
1181758488 22:25041560-25041582 ATGGTTTAAACATCTAGTCTAGG + Intronic
1183056397 22:35309061-35309083 GTGATTTAAAAATCTCTTATGGG + Intronic
1184198570 22:42948684-42948706 TTGGTTTTCAAATATTTTCTGGG + Intronic
949104270 3:184500-184522 AAGGTATAAAAATGTCTTCTAGG + Intergenic
949344437 3:3063735-3063757 TTGTCTTAAAACTCTTTTCTGGG - Intergenic
949557647 3:5171030-5171052 ATAGATTAAAAATCTATTCTTGG - Intronic
949587995 3:5462008-5462030 ATGATTTACAAATATTTTTTGGG - Intergenic
949964749 3:9345927-9345949 TGGATTTAAAAATCTCTTCTTGG - Intronic
951917596 3:27818408-27818430 TTGGTCTAAAATTCTTTTTTTGG + Intergenic
952201249 3:31130269-31130291 ACTCTTTAAAAAACTTTTCTTGG - Intergenic
952428491 3:33199571-33199593 ATTCTTTAAAAAACTTTTTTTGG - Intronic
952957874 3:38569546-38569568 ATAGGTTTAAATTCTTTTCTAGG + Intronic
953114088 3:39974594-39974616 TTGGTCTAAAATTCTTTTTTTGG - Intronic
953691275 3:45121934-45121956 ATGGTTTAATAATATTTTGGGGG + Intronic
954910203 3:54099187-54099209 TTAGTTTAAAAATGTTTTCCAGG + Intergenic
954971921 3:54658584-54658606 ATGGTTTATAAATGATTTCTTGG + Intronic
955076952 3:55622907-55622929 CTGGTTTAGAAACATTTTCTGGG - Intronic
955726077 3:61934370-61934392 AAAATTTAAATATCTTTTCTCGG + Intronic
955875272 3:63482562-63482584 GTGGTTTTAAAATTGTTTCTAGG - Intronic
956154810 3:66284179-66284201 ATTTTTTAAAAATTTTTTGTAGG - Intronic
956209738 3:66790373-66790395 ATTTTTTAAAAATCCCTTCTTGG + Intergenic
956246114 3:67185550-67185572 ATGGCTGAAAAAGCTGTTCTGGG + Intergenic
957220413 3:77375228-77375250 ATGGAATTAAAATGTTTTCTTGG + Intronic
957601948 3:82348272-82348294 ATGTTTTAATAATTTTTTCCAGG + Intergenic
957656142 3:83078954-83078976 ATGGTTTAAAAATGTAGTTTAGG + Intergenic
957737183 3:84217116-84217138 ATGGTTTTCAAATATCTTCTTGG - Intergenic
958052443 3:88365618-88365640 ATGATATAAGGATCTTTTCTTGG - Intergenic
958180686 3:90056513-90056535 ATGTTTTAAAAATATACTCTTGG - Intergenic
958462021 3:94410473-94410495 ATGGTTTAAAAAAATCTCCTAGG + Intergenic
958488003 3:94736220-94736242 AAAGTGTAAAAATCTTTTCTTGG - Intergenic
958493171 3:94804730-94804752 ATGGTATTAAAATCTTGTCATGG - Intergenic
958823684 3:99004747-99004769 ATGGTTTGGAAATATTTTCTTGG + Intergenic
958824540 3:99014795-99014817 ATGTATTAAAAACATTTTCTTGG + Intergenic
959043710 3:101448363-101448385 AGAGTTAAAAAATATTTTCTTGG - Intronic
959138528 3:102455547-102455569 TTTGTTTGAAAATCCTTTCTGGG + Intronic
959343061 3:105156217-105156239 TTGGTTAGAAAATATTTTCTTGG + Intergenic
959434537 3:106298166-106298188 ATGGTTTAAAAGTGTTTGGTAGG + Intergenic
959690873 3:109196733-109196755 ATGTTTATAACATCTTTTCTCGG + Intergenic
959987175 3:112586994-112587016 ATATTTTAAAAATCTTTCCAGGG - Intergenic
960066219 3:113376272-113376294 ATGGTTTAAAAGTAATGTCTTGG + Intronic
960189937 3:114691715-114691737 ATGTTTTAAAAATATATCCTCGG + Intronic
960335297 3:116410454-116410476 TAGTTTTAAAAATCTTTTGTAGG + Intronic
960346561 3:116539734-116539756 CTGGTTTAAAAACCATTGCTGGG - Intronic
960609305 3:119540746-119540768 CTGTATTAAAAATCTTTTCAAGG + Intronic
960614348 3:119583058-119583080 ATGTTTTAAAAATTTTTTTCTGG - Intronic
960711952 3:120539186-120539208 ATAGTTTACAAATATTTTCTTGG + Intergenic
960981339 3:123229920-123229942 ATGGATTCAAATTATTTTCTAGG - Intronic
961599086 3:128045158-128045180 ATAGTTTGAAAATATTTTTTAGG + Intergenic
962048116 3:131782986-131783008 ATGGTTTAAGAATCCTGGCTGGG + Intronic
962079132 3:132118468-132118490 ATGTTTTAATAAACTTTTTTTGG + Intronic
962476457 3:135759383-135759405 ATTCTTTAAAAATCTGTTCCAGG + Intergenic
962645781 3:137438276-137438298 ATGTTTTAAAAATATTGCCTGGG - Intergenic
963157723 3:142117219-142117241 AAGGTTCAAAAATCTTTTTCGGG - Intronic
963160381 3:142144836-142144858 ATGTTTTAAAAGTCGTTTCTGGG - Intronic
963285690 3:143432537-143432559 TTGTTTTAACAACCTTTTCTCGG - Intronic
963322577 3:143825141-143825163 ATTTTTTAAGAAACTTTTCTAGG - Intronic
963441835 3:145349801-145349823 ATGTTCTAAAACTCTTCTCTGGG - Intergenic
963583141 3:147152200-147152222 ATTATTTGAAAATCTTCTCTTGG + Intergenic
963686067 3:148435940-148435962 ATCATTTAAAAATTTTTTGTGGG + Intergenic
964095054 3:152921742-152921764 ATGTTTTATAAATCTTTACCAGG - Intergenic
964528551 3:157642687-157642709 AGGGTTTAAAAAAATTTTGTTGG - Intronic
964588205 3:158330677-158330699 ATGTTTTAAATATTTTCTCTAGG + Intronic
964609121 3:158591458-158591480 AAGTTTTTAAAATTTTTTCTTGG - Intronic
965310857 3:167126427-167126449 ATGGTTAAATAATTCTTTCTAGG - Intergenic
965397900 3:168182784-168182806 AAGGTTTAAAAATCTTTTAGAGG + Intergenic
965465431 3:169024129-169024151 ATAGTTTAAAAAACTTTTGTTGG - Intergenic
965848853 3:172996934-172996956 ATGAGTTAAAAATTTTTTCATGG + Intronic
966554439 3:181243301-181243323 TTTGTTTAAAAAGCTTTTTTTGG + Intergenic
967025453 3:185560459-185560481 CTGTTTTAAAAATACTTTCTGGG - Intergenic
967550811 3:190793546-190793568 CTGGTTTACAAGTCTGTTCTGGG - Intergenic
970153933 4:13121730-13121752 ATGGCTTAAAAATCACATCTAGG + Intergenic
970289190 4:14553076-14553098 GGGGATTAAAAATGTTTTCTGGG - Intergenic
971134398 4:23852252-23852274 AATGTTTAAAAACCTTTTGTAGG - Intronic
971408477 4:26344663-26344685 CTGCTTTAAAAGTCATTTCTAGG - Intronic
971434747 4:26608739-26608761 AGCTTTTAAAAATCTTTTCTAGG + Intronic
971991971 4:33910097-33910119 ATTGTTTAAAATTCTTTTTATGG - Intergenic
972308090 4:37851668-37851690 ATGATTTACAAATCTAGTCTTGG - Intronic
973098721 4:46234707-46234729 ATGCTTTAAAAATGGTTACTGGG - Intergenic
973154470 4:46932801-46932823 ATGGATTCAAAATCTTTTTGAGG - Intronic
973289693 4:48458353-48458375 TTTGTTTTAATATCTTTTCTTGG - Intergenic
973998545 4:56485493-56485515 ATGGATTAAAAACATTTTGTGGG + Intronic
974696194 4:65376190-65376212 ATGCATTAGAAATCTTTTCTTGG + Intronic
974701153 4:65448967-65448989 ATTTTTTAAAAATTATTTCTTGG - Intronic
974712616 4:65619979-65620001 AGTGTTTAAAACTCTGTTCTGGG - Intronic
974802132 4:66831347-66831369 ATTTTTTAAAAATCTATTCTTGG + Intergenic
974915253 4:68171495-68171517 ATTGTTTAAATACTTTTTCTGGG - Intergenic
974941106 4:68469168-68469190 ATGTTATAAAATTGTTTTCTGGG + Intronic
975099247 4:70493448-70493470 GTGGGTTAGAAATCTATTCTTGG - Intergenic
975555465 4:75660159-75660181 ATTGTTTTAAAATTTGTTCTTGG + Intronic
976012995 4:80515130-80515152 TTGGTTTAAAAATGTTTCTTTGG - Intronic
976368395 4:84258026-84258048 ACAGTTTAAACAGCTTTTCTAGG - Intergenic
976472357 4:85444581-85444603 ATTTTTTAAAAATATTTTTTAGG - Intergenic
976586002 4:86797801-86797823 ATTGTTTAAAAATATTTTTATGG - Intronic
976602852 4:86954424-86954446 ATGTTATTAAAATCATTTCTAGG + Intronic
976619257 4:87111652-87111674 ATTGATTAAAAATATTTTTTAGG - Intronic
976735156 4:88301706-88301728 ATGATTTACAAATATTTTCTTGG - Intergenic
977398160 4:96497447-96497469 ATGTTTTAAAATTTTTTTCTTGG - Intergenic
978324295 4:107534426-107534448 ATGGTTTGGAAATTTTTTATAGG + Intergenic
978461267 4:108955980-108956002 ATGGTTGAATAATTTTTTTTTGG - Intronic
978820862 4:112964086-112964108 AAGGTTTTAAAATTTTTTGTGGG + Intronic
978821032 4:112966639-112966661 ATTCTCTAAAAATCTATTCTAGG - Intronic
979077864 4:116297391-116297413 ATGGTTAAAATATGATTTCTGGG - Intergenic
979428094 4:120592868-120592890 ATCGGTTTAAAATCTTTTCATGG + Intergenic
979683714 4:123488107-123488129 TTGACTTAAAAATTTTTTCTTGG + Intergenic
980272767 4:130608078-130608100 TTGTTTCAAGAATCTTTTCTGGG + Intergenic
980331215 4:131414281-131414303 ATTCTTTAAAAATAATTTCTGGG + Intergenic
980619165 4:135275081-135275103 AACATTTAAAAATTTTTTCTAGG + Intergenic
980654455 4:135764614-135764636 AAAGTTTAAAAATTATTTCTTGG + Intergenic
980703416 4:136460475-136460497 ATGGTTTAAAAATAGTTAATTGG + Intergenic
981597166 4:146439123-146439145 ATGATTTTAAAATATTTTCTTGG + Intronic
981716981 4:147761346-147761368 AAATTTTAAAAATCTTTTCTAGG + Intronic
981928395 4:150164496-150164518 ATTGTTTAAAAATATTTTAAGGG + Intronic
982271762 4:153597630-153597652 ATCATTTAAAAATCATTTCCAGG + Intronic
982330622 4:154178165-154178187 ATTGTTTGTAAATCATTTCTTGG + Intergenic
982628492 4:157800604-157800626 TTGTTTTAAAAATCTTCTTTTGG + Intergenic
982694133 4:158580364-158580386 ATCTTTTAAAAAACCTTTCTAGG - Intronic
982975502 4:162053152-162053174 ATTGTTTAAAAATAATTTTTTGG + Intronic
983085521 4:163439439-163439461 AGGTTTTAAAATTGTTTTCTAGG - Intergenic
983351213 4:166591942-166591964 ATCATTAAAAAATGTTTTCTTGG - Intergenic
983991398 4:174124513-174124535 TTGATTTAAAAATATTTTGTTGG - Intergenic
984027351 4:174559160-174559182 ATTGTATAGAAATGTTTTCTGGG + Intergenic
984205258 4:176780077-176780099 ATCTATTAAAACTCTTTTCTAGG + Intronic
984371161 4:178866734-178866756 GTAGTTTACAATTCTTTTCTTGG + Intergenic
985559121 5:573456-573478 ATAGTTTAAAAATATTCTTTTGG - Intergenic
986075587 5:4334371-4334393 AGGGTTTAAAAATATGTTCATGG - Intergenic
986465814 5:8022406-8022428 ATGGTATATACATCTTTTTTTGG + Intergenic
987057441 5:14207780-14207802 CTGGATTAAAAATCCTTTATTGG - Intronic
987137482 5:14913403-14913425 ATGCTTTAAAAATTATTCCTAGG + Intergenic
987595733 5:19996421-19996443 ACAGTTTATAAATCTTTCCTGGG + Intronic
988252357 5:28776017-28776039 AAGGCTTGAAAATCATTTCTTGG + Intergenic
988344373 5:30018926-30018948 ATGGTTTATAAATGTTTTCAGGG - Intergenic
988363693 5:30268864-30268886 CTCTTATAAAAATCTTTTCTTGG + Intergenic
989092953 5:37753716-37753738 ATTCTTTAAAAATATTTTTTGGG - Intergenic
989374482 5:40746682-40746704 CATGTTTAAAAATCTATTCTAGG - Intronic
989732306 5:44663689-44663711 AAGGTTTAAAATTGTTTCCTTGG - Intergenic
990018132 5:51091384-51091406 GTGGTTTACAAATGTTTTTTAGG + Intergenic
991047875 5:62241855-62241877 TTGGTTTTTCAATCTTTTCTTGG - Intergenic
992473920 5:77083999-77084021 TTAGTTTAAAAATTTTTTCAAGG - Intronic
992525054 5:77601207-77601229 ATGATTTAAAAAACTATTTTAGG - Intronic
993316646 5:86415337-86415359 GTATTTTAAAAAGCTTTTCTGGG + Intergenic
993765074 5:91845645-91845667 TTATTTTTAAAATCTTTTCTGGG - Intergenic
994045085 5:95299126-95299148 AAGGTTTAAAACTCTATTGTGGG + Intergenic
994096933 5:95855695-95855717 AAAGTTTTAAAATCTTGTCTGGG - Intronic
994118491 5:96088122-96088144 CTGGTTTAAAAATCTTTGACAGG + Intergenic
994448480 5:99908762-99908784 ATTGTTTTAAAATTTTTGCTTGG - Intergenic
994731072 5:103490786-103490808 ATGTTTTAAAAATCTATCCATGG + Intergenic
994853019 5:105081003-105081025 ATCAATAAAAAATCTTTTCTTGG - Intergenic
994953112 5:106490692-106490714 AGGGTTTAATGATCTGTTCTTGG - Intergenic
995035239 5:107526851-107526873 ATGGTTTTATAATATTTTCCTGG - Intronic
995039607 5:107572501-107572523 ATGACTTAAGAATCTTTTCATGG - Intronic
995495278 5:112735476-112735498 ATGCATTAAAAATATTTTCTGGG - Intronic
995844781 5:116481838-116481860 ATGGCTTAGAATTCTTTTCATGG - Intronic
995986101 5:118176019-118176041 ATAGTTTAAAAATATTATTTTGG - Intergenic
996034634 5:118744778-118744800 ATAGTTTAAAAATAATTACTGGG - Intergenic
996558563 5:124803899-124803921 AAGGTCAAAAAATCCTTTCTAGG + Intergenic
996758079 5:126956240-126956262 TTGGTTTAAAAATATCTTCAGGG - Intronic
996820596 5:127622322-127622344 ATACTTTAAAAATCATTTATTGG + Intergenic
996989924 5:129616575-129616597 CTTGTTTAAAAATCTTTGCCAGG - Intronic
997014385 5:129914525-129914547 AGTCTTTCAAAATCTTTTCTTGG + Intronic
997706358 5:135957193-135957215 AAGTTTTAAAAATGTTTTGTAGG - Intergenic
998597193 5:143544240-143544262 AAGGTTTACACATCTTTTGTAGG + Intergenic
999836665 5:155380813-155380835 ACCTTTTAAAAATCTTTTCTAGG + Intergenic
999848691 5:155513943-155513965 AGGGTTTAAAAATATTTATTTGG + Intergenic
1000149864 5:158489254-158489276 ATTATTTCAAAATATTTTCTGGG + Intergenic
1000161691 5:158603931-158603953 ATGCTTTAAACTTCATTTCTCGG + Intergenic
1000649560 5:163800275-163800297 ATGATTTAAAATTCATTTTTTGG + Intergenic
1000942562 5:167379946-167379968 ATGGCTTAAAACTTTGTTCTGGG - Intronic
1003258301 6:4492903-4492925 ATTATTTTAAAATTTTTTCTGGG + Intergenic
1003729076 6:8800262-8800284 TTGCTTTAAAAATCTATTCCAGG - Intergenic
1003835480 6:10068190-10068212 ATTGTATAAAACTCTGTTCTTGG + Intronic
1003932909 6:10944033-10944055 ACAGGTTAAAAATCTTGTCTAGG + Intronic
1005124548 6:22431462-22431484 ATGGGTTCAAAAACTTTTCATGG - Intergenic
1005197117 6:23300455-23300477 GTTTTTTAAAAATATTTTCTCGG - Intergenic
1005559633 6:27025172-27025194 ATGGTTGACTAATCTTTTGTAGG + Intergenic
1006264467 6:32907323-32907345 AGGATTTAAAAATGATTTCTTGG + Intergenic
1006286875 6:33103653-33103675 ATTTTTTAAAAAACTTTTATTGG + Intergenic
1006977421 6:38116187-38116209 ATTGGTTAGATATCTTTTCTTGG - Intronic
1007448395 6:41924645-41924667 ATGGTTTTAAAATCTTTTGTAGG - Intronic
1008243333 6:49140543-49140565 AAAGTTTTAAAATCTTTGCTAGG - Intergenic
1008258224 6:49331319-49331341 ATGATTTAAGAATGTTTTATTGG + Intergenic
1008471794 6:51892696-51892718 ATGCTTTAATAGTCTTTACTAGG + Intronic
1009561387 6:65249011-65249033 TTGATTTAAGAATATTTTCTGGG + Intronic
1009805735 6:68599914-68599936 ATGGATTAAAAATTATCTCTTGG + Intergenic
1009972375 6:70638163-70638185 GTTGTTTAAAAATATTTTTTAGG - Intergenic
1010686744 6:78861737-78861759 ATGACTTGAAAAACTTTTCTGGG + Intergenic
1011352615 6:86439104-86439126 ATGGTTTAGAAATATATTCATGG + Intergenic
1012082491 6:94778970-94778992 CTGGTTAAAAAATCTTTTCGGGG + Intergenic
1012964704 6:105661065-105661087 ATGTTATAAATATCTTTTCCCGG - Intergenic
1013115293 6:107098975-107098997 TTGGTTTAAACATCTTTTTTTGG + Intronic
1013322009 6:109002343-109002365 ATGGTGTAATTTTCTTTTCTAGG - Exonic
1013606037 6:111749493-111749515 ATGTTTTAATAAGCTTTTGTTGG - Intronic
1013778613 6:113706012-113706034 CTAGTTTAAAATTTTTTTCTTGG - Intergenic
1014383312 6:120771250-120771272 ATGATTCAAAAATCATGTCTTGG + Intergenic
1015101666 6:129488825-129488847 AAGCATTAAAAATTTTTTCTGGG - Intronic
1015174321 6:130289799-130289821 ATGGTTTAAAAATCTTTTCTTGG - Intronic
1015411843 6:132902677-132902699 ATGGTCTAATAATCTTTCCCAGG + Intergenic
1016531409 6:145061538-145061560 ATGATTAAAAAAACCTTTCTGGG + Intergenic
1016980981 6:149853810-149853832 TTGTTTTAATAATCTTTTCAAGG - Intronic
1017625614 6:156345408-156345430 CTCCTTTAAAAATCTTTTCTGGG + Intergenic
1017794916 6:157835306-157835328 ATATTTTAAAAATCTTGGCTGGG - Intronic
1017865217 6:158437261-158437283 ATGGTTTAAAAATAAATTTTAGG + Intronic
1018242244 6:161789194-161789216 AAGGAGTAAAAATCTTTTCATGG + Intronic
1019627597 7:2028095-2028117 ATTGTTTCATAATGTTTTCTGGG - Intronic
1020843069 7:13245514-13245536 ATAGTTTAAAAATATTATATTGG - Intergenic
1021137245 7:16980310-16980332 ATGGATTAAGCAACTTTTCTGGG + Intergenic
1021227450 7:18044863-18044885 AGGTTTTAAAAATATTTTATGGG - Intergenic
1021485856 7:21167783-21167805 ATTATTTTAAAAACTTTTCTGGG + Intergenic
1021844666 7:24752774-24752796 ATGGCTTCTAATTCTTTTCTGGG + Intronic
1022178557 7:27895930-27895952 TTGGGTTTAAAAACTTTTCTTGG + Intronic
1022394512 7:29974165-29974187 TTACTTTAAAAATCATTTCTGGG - Intronic
1022731206 7:33027674-33027696 ATGGTTAAAATATGATTTCTGGG - Intronic
1023229588 7:38012453-38012475 ATTTTTTAAAAATGTTTTCAAGG - Intronic
1024311854 7:47976841-47976863 ATATTTTTAAATTCTTTTCTTGG - Intronic
1024444487 7:49461062-49461084 ATTGTTTATAAAACTGTTCTAGG + Intergenic
1024800480 7:53072038-53072060 ATCTCTCAAAAATCTTTTCTTGG + Intergenic
1024970437 7:55064680-55064702 ATGGTTTCACTATCTTTTCTTGG - Intronic
1025018576 7:55463241-55463263 ATTATTTAAAATTCTTTTTTGGG + Intronic
1025934589 7:66024987-66025009 GGGTTTTAAAAATCTTTTCTTGG - Intergenic
1025949812 7:66135620-66135642 GGGGTTTAAAAATCTTTTCTTGG + Intronic
1026115532 7:67492630-67492652 ATGATTTATAAATCATTACTAGG + Intergenic
1027661453 7:80992735-80992757 ATGAGTGAAAAATATTTTCTTGG + Intergenic
1027687579 7:81296202-81296224 ATGATTTAAAAATTTTTTCTAGG + Intergenic
1028173188 7:87624069-87624091 GAGTTTTAAAAATGTTTTCTCGG + Intronic
1028236323 7:88366516-88366538 AAGGTTAAAAAATTTGTTCTAGG - Intergenic
1029325667 7:99806717-99806739 ATGGCTTAAAAATATCTTTTTGG - Intergenic
1030133762 7:106226308-106226330 ATATTTCAAAAATCTTTCCTTGG + Intergenic
1030423419 7:109339105-109339127 ATGGTTTACACATCTATCCTTGG + Intergenic
1030584716 7:111403228-111403250 ATGGTTTAAAATTGTTTAATAGG + Intronic
1030685512 7:112482945-112482967 ATGGACTAAAAATTTTTTTTAGG - Intronic
1030736744 7:113058013-113058035 GTGCTTTACATATCTTTTCTAGG + Intergenic
1030918296 7:115345562-115345584 AAAGATAAAAAATCTTTTCTGGG + Intergenic
1030942266 7:115667779-115667801 ATGTTTTAAAAATACATTCTAGG - Intergenic
1031027144 7:116692036-116692058 TTGGAATAAAAATCTTTTCCAGG + Intronic
1031521584 7:122772812-122772834 ATGGCTTAAGTATCTTATCTAGG - Intronic
1031573960 7:123393350-123393372 ATGGCATAAAAATGTATTCTAGG - Intergenic
1031968400 7:128045291-128045313 ATGGCTTAGAACTCTATTCTGGG - Intronic
1032314918 7:130828906-130828928 ATGGTTTATAAATCATTTTATGG - Intergenic
1032544182 7:132728139-132728161 ATGGTTTAAATCTTTTTTCTTGG + Exonic
1032628689 7:133622881-133622903 ATAGTTGAAAAAACTGTTCTTGG + Intronic
1032924635 7:136589437-136589459 ATGGTTTAAAAACATGGTCTTGG - Intergenic
1033138807 7:138807117-138807139 ATCATTTAAAAATCTATTCCTGG + Intronic
1033171360 7:139087322-139087344 AAGGTTTAAAGGTCTTGTCTTGG - Intronic
1033967253 7:146991083-146991105 AAGGTTTAAAAAACTTTTAAAGG + Intronic
1034233034 7:149547544-149547566 GTCATTTAAAAAGCTTTTCTAGG + Intergenic
1034604315 7:152296654-152296676 AGGGTCTTAACATCTTTTCTTGG - Intronic
1036286164 8:7445800-7445822 GTGGTTTAAAAATCCATTCTAGG + Intronic
1036335311 8:7865728-7865750 GTGGTTTAAAAATCCATTCTAGG - Intronic
1036536905 8:9658439-9658461 TGGGTTGAAAATTCTTTTCTTGG - Intronic
1036766485 8:11552683-11552705 ATGGTTGAAATATCATTTCCAGG - Intronic
1037028028 8:14063761-14063783 TTGGTTTAAATGTCTGTTCTTGG - Intergenic
1037293928 8:17381216-17381238 AGGGTTTCATCATCTTTTCTAGG + Intronic
1037313562 8:17580549-17580571 AGGGTTTTAAAACCTTGTCTAGG - Intronic
1037644460 8:20779450-20779472 ATTTTATAAAAATATTTTCTAGG - Intergenic
1038235751 8:25752600-25752622 CTACTTTAAGAATCTTTTCTGGG - Intergenic
1039204442 8:35135277-35135299 ATGGTTTAAAGAGCTATTATGGG - Intergenic
1039226391 8:35392985-35393007 CTTTTTAAAAAATCTTTTCTGGG + Intronic
1039355782 8:36814143-36814165 ATTCTTTAAAAATCTTCTCTTGG + Intronic
1039625114 8:39041704-39041726 ATGTTTTAAAGATATTTTATTGG + Intronic
1040100032 8:43491417-43491439 TTGGTCTAAAATTCTTTTTTTGG - Intergenic
1040463085 8:47668953-47668975 CTGGTAGATAAATCTTTTCTTGG - Intronic
1040931600 8:52740890-52740912 GTGGTTTACAAATACTTTCTAGG + Intronic
1041052250 8:53946600-53946622 ATTTGTAAAAAATCTTTTCTTGG + Intronic
1041130957 8:54699445-54699467 ATACTTTAAAAATGTTTTCCAGG + Intergenic
1042018642 8:64345592-64345614 ATGCTTCAAAAATCTTTTCTTGG + Intergenic
1042542048 8:69917139-69917161 TTTCTTTAAAAATATTTTCTAGG - Intergenic
1042599397 8:70483174-70483196 ATGGCATAAATATCTTTTATGGG - Intergenic
1042857295 8:73280331-73280353 ATTATTTAAAAAGCTATTCTGGG - Intergenic
1043152457 8:76735362-76735384 ATGGTTGAAAAATGCTTTATAGG - Intronic
1043188923 8:77192134-77192156 ATGAAGTAAAAATATTTTCTTGG + Intergenic
1043207565 8:77465923-77465945 GTGGTTAAAAAATATTTTATGGG - Intergenic
1043210721 8:77512844-77512866 ATGGTTTATACATCTTTGGTTGG - Intergenic
1043619615 8:82173279-82173301 TTGGTTTAAAACTCTATTCGGGG + Intergenic
1044117587 8:88353133-88353155 ATATTTTTAAAATATTTTCTTGG + Intergenic
1044229145 8:89755735-89755757 ATAATTTAAAAATTTTTGCTAGG - Intergenic
1044795821 8:95896531-95896553 ATGGCTTTACAATCTCTTCTGGG + Intergenic
1045068396 8:98474297-98474319 ATTGTTTAAAAATGTATACTGGG + Intronic
1045205326 8:100033661-100033683 TTGGTCTAAAATTCTTTTTTTGG - Intronic
1045228252 8:100273160-100273182 TTTGTTTAAAAATCTTGGCTGGG - Intronic
1045641080 8:104251629-104251651 ATGGATCACAAATCTTTTATGGG + Exonic
1046024664 8:108707774-108707796 TTGGTTTAAAAATGACTTCTTGG + Intronic
1046058715 8:109110222-109110244 ATATTTTAAAAATCCTGTCTGGG + Intronic
1046060311 8:109131506-109131528 AAGCTTTTAGAATCTTTTCTGGG - Intergenic
1046096885 8:109573170-109573192 ATATTTTAAAAATATTTTGTGGG + Intergenic
1046420405 8:113975267-113975289 ATATTTTCAAAATATTTTCTGGG + Intergenic
1046497313 8:115031989-115032011 TTGGTTTATAAATATATTCTAGG - Intergenic
1047153328 8:122289406-122289428 ATGGTTTATAGATTTTTTATAGG - Intergenic
1048068146 8:130992713-130992735 ATCATTTAAAAATTTTTTTTTGG - Intronic
1048581510 8:135732881-135732903 TTGTCTTAAAAATCTTTTCTGGG - Intergenic
1048691092 8:136964238-136964260 ATGTTTTAATAATATTTTCTTGG + Intergenic
1048890762 8:138944359-138944381 ATGGTATAGTAATCCTTTCTTGG + Intergenic
1049821717 8:144638267-144638289 TTGCTTTTAAAATCTTCTCTTGG + Intergenic
1050260137 9:3832827-3832849 TTAGTGAAAAAATCTTTTCTTGG - Intronic
1050523608 9:6526935-6526957 ATGGTTTAATAGGCTTTTGTAGG - Intergenic
1051407253 9:16751112-16751134 ATCATTTAAAAAGCTTTTCCAGG + Intronic
1051839170 9:21374971-21374993 ATAATTTAAAAATCTTTTGGAGG + Intergenic
1052118150 9:24674545-24674567 CTGGTTTTGAAATCTTTTATAGG + Intergenic
1053676270 9:40432042-40432064 ATGGCCTAAAAATCAATTCTAGG + Intergenic
1053926042 9:43058154-43058176 ATGGCCTAAAAATCAATTCTAGG + Intergenic
1054165204 9:61718939-61718961 ATAATTTAAAAATATTTTATAGG + Intergenic
1054287449 9:63192851-63192873 ATGGCCTAAAAATCAATTCTAGG - Intergenic
1054289338 9:63267567-63267589 ATGGCCTAAAAATCAATTCTAGG + Intergenic
1054387372 9:64572113-64572135 ATGGCCTAAAAATCAATTCTAGG + Intergenic
1054508351 9:65944252-65944274 ATGGCCTAAAAATCAATTCTAGG - Intergenic
1054698245 9:68384516-68384538 ATGGTTTGAATTTGTTTTCTAGG - Exonic
1055178610 9:73353190-73353212 ATTCTTTAAAAATCCTTTTTTGG - Intergenic
1055259002 9:74410312-74410334 ATGGTTTCAAAATGTTTCCTTGG + Intergenic
1055669288 9:78584825-78584847 ATGTTTTTAAAATATCTTCTAGG - Intergenic
1055736070 9:79332437-79332459 ATAGTATAAAAAACATTTCTAGG - Intergenic
1056046100 9:82718374-82718396 TTGGTTGTAAAATCTCTTCTGGG - Intergenic
1056149487 9:83770902-83770924 ATCTTTTAAAAATCTTCTATTGG - Intronic
1056239997 9:84635512-84635534 CTATTTTATAAATCTTTTCTTGG - Intergenic
1057335237 9:94150150-94150172 CTGGTGTATAAATCTTTTCCAGG - Intergenic
1057979413 9:99644940-99644962 GTGATTTAAAATTTTTTTCTAGG - Intergenic
1058093532 9:100832924-100832946 AGGGTTTCAAAATTTTTTCTCGG + Intergenic
1058129499 9:101233886-101233908 ATGGTTTGAAAATAATTTTTGGG + Intronic
1058154309 9:101496789-101496811 ATGCTATAAAAATGTATTCTTGG - Intronic
1058300396 9:103364411-103364433 ATGATCTAAAATTCTTTACTAGG + Intergenic
1058302032 9:103387362-103387384 ATAGTTTAAAAATCTGTTTATGG - Intergenic
1059217518 9:112579890-112579912 CTGGTTTGAAAATCTGTCCTTGG - Intronic
1060271054 9:122141955-122141977 ATGGTTTCAAATTCAATTCTAGG - Intergenic
1061550790 9:131333642-131333664 ATGGTTTAAAAACCGTTTACAGG - Intergenic
1061722979 9:132565120-132565142 ATGGAGTAGAAATCTCTTCTAGG + Intronic
1203356369 Un_KI270442v1:152215-152237 ATGGTCTAAAATTCTCTTTTTGG - Intergenic
1185915594 X:4031113-4031135 ATGTTGCAAAAATCTTTTATGGG - Intergenic
1186745284 X:12561537-12561559 TAGTTTTAAAAATCTTTTATGGG - Intronic
1186816556 X:13243345-13243367 AATATTTAAAAATTTTTTCTTGG - Intergenic
1186844021 X:13513109-13513131 ATTTTTTAAAAATTTTTTGTGGG + Intergenic
1187290851 X:17951835-17951857 ATGGTTCACCAATCATTTCTGGG - Intergenic
1187870343 X:23759836-23759858 TTGGATTAAAAATCATTCCTTGG - Intronic
1188067908 X:25684167-25684189 ATGGTTGAAAATTCTTTGTTGGG - Intergenic
1188217429 X:27496235-27496257 ATGTTTTAAAAAACTTTAATGGG + Intergenic
1188256985 X:27974591-27974613 ATGGTTTAAAATTCATCTGTGGG + Intergenic
1188311515 X:28622745-28622767 ATTGTTTAAAAGTCTTTGGTTGG - Intronic
1188670886 X:32880340-32880362 ATTGATTAAACATCTTTTATAGG - Intronic
1188962089 X:36504733-36504755 ATGGTTTAAAAATATCTGATGGG + Intergenic
1190016026 X:46828077-46828099 ATAGTTTAAAAATAATTTCAAGG - Intergenic
1190089476 X:47425308-47425330 CAGGTTTAAAAATCTCTACTGGG + Intergenic
1190542733 X:51495725-51495747 ATGCTTTCAAAATCGCTTCTTGG - Intronic
1191768224 X:64725279-64725301 ATGTTTTTTAAATCTTTACTGGG - Intergenic
1192038931 X:67596497-67596519 ATGGTTTAAAAAATCTATCTTGG + Intronic
1192615074 X:72611733-72611755 ATAGGTTAAAAATGTTATCTTGG - Intronic
1193063553 X:77233126-77233148 AGTGTCTAGAAATCTTTTCTAGG - Intergenic
1193754800 X:85395301-85395323 ATTTTTTAAAAATGTTTTCTGGG + Intergenic
1194084362 X:89507968-89507990 ATGTTTTTAAGATGTTTTCTAGG - Intergenic
1194328642 X:92554032-92554054 ATGATTAAAAAATTTTTTCTTGG - Intronic
1194464510 X:94216682-94216704 ATGGTATAAAAATCATTGCCAGG - Intergenic
1194644590 X:96443469-96443491 TTGTTTTAAAAATCTTTGTTGGG + Intergenic
1195338598 X:103881549-103881571 AAAGTTTAAAAATGGTTTCTTGG + Intergenic
1195874935 X:109530015-109530037 AATATTTAAAAATCTATTCTTGG - Intergenic
1196068637 X:111494506-111494528 ATCCTTTAAATATTTTTTCTTGG - Intergenic
1196336014 X:114535757-114535779 ATGGTTTACATCCCTTTTCTTGG + Intergenic
1197095405 X:122588721-122588743 ATGGTTTAATCCTCTTTTCCAGG + Intergenic
1197130015 X:122994525-122994547 TTGTTTTCAAAATCTTTTTTTGG - Intergenic
1197318573 X:124999524-124999546 TTGGTTTAAAAATGTATTTTAGG - Intergenic
1198787619 X:140306489-140306511 ATAGTTTAAAAAATTCTTCTTGG - Intergenic
1199055188 X:143285721-143285743 ATGCTTTAAAGATGTTTTCTTGG - Intergenic
1199382988 X:147192286-147192308 ATAGTTTAAAAATCTTATGATGG + Intergenic
1200437002 Y:3163857-3163879 ATGTTTTTAAGATGTTTTCTAGG - Intergenic
1200637348 Y:5673229-5673251 ATGATTAAAAAATTTTTTCTTGG - Intronic
1200770832 Y:7123848-7123870 ATAGTGTAAAAATCTATTGTGGG + Intergenic
1200848986 Y:7863016-7863038 TTGGTTTAAATTTCTTCTCTTGG - Intergenic
1200867910 Y:8065111-8065133 ATGATTTAATAATTTTGTCTAGG + Intergenic
1200972570 Y:9169887-9169909 ATTGTTTACAAATCTTGTTTTGG + Intergenic
1201929988 Y:19333316-19333338 TTGGTTCACAAATATTTTCTTGG - Intergenic
1202138448 Y:21694362-21694384 ATTGTTTACAAATCTTGTTTTGG - Intergenic