ID: 1015174324

View in Genome Browser
Species Human (GRCh38)
Location 6:130289821-130289843
Sequence TGTAGTCAGAAGACCTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015174318_1015174324 5 Left 1015174318 6:130289793-130289815 CCCAGCCCAAGAAAAGATTTTTA 0: 1
1: 2
2: 11
3: 155
4: 1296
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174321_1015174324 -1 Left 1015174321 6:130289799-130289821 CCAAGAAAAGATTTTTAAACCAT 0: 1
1: 0
2: 7
3: 73
4: 661
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174320_1015174324 0 Left 1015174320 6:130289798-130289820 CCCAAGAAAAGATTTTTAAACCA 0: 1
1: 0
2: 8
3: 138
4: 4648
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174317_1015174324 10 Left 1015174317 6:130289788-130289810 CCGTGCCCAGCCCAAGAAAAGAT 0: 1
1: 3
2: 13
3: 137
4: 984
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174319_1015174324 4 Left 1015174319 6:130289794-130289816 CCAGCCCAAGAAAAGATTTTTAA 0: 1
1: 2
2: 29
3: 218
4: 1436
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data
1015174316_1015174324 13 Left 1015174316 6:130289785-130289807 CCACCGTGCCCAGCCCAAGAAAA 0: 2
1: 12
2: 150
3: 1102
4: 5095
Right 1015174324 6:130289821-130289843 TGTAGTCAGAAGACCTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015174324 Original CRISPR TGTAGTCAGAAGACCTAGGT AGG Intronic
No off target data available for this crispr