ID: 1015180166

View in Genome Browser
Species Human (GRCh38)
Location 6:130353219-130353241
Sequence CAGAGCTATCAAATAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015180166 Original CRISPR CAGAGCTATCAAATAAAAGC TGG (reversed) Intronic
900850772 1:5141195-5141217 CAGAGCTTCCAGATAAAAGGTGG + Intergenic
903098330 1:21002558-21002580 CAAAGCTAACAAATAATAGTAGG + Intronic
905035454 1:34915383-34915405 CAGGGCCATCAAAGAATAGCAGG + Intronic
907813825 1:57898804-57898826 CAGAGATATCAAAGATCAGCTGG - Intronic
907871488 1:58447618-58447640 CAGTGCTATGAAAGAAAAGAAGG + Intronic
907911530 1:58831402-58831424 CAGAGCTGTAAAAAAAAAGATGG - Intergenic
907914445 1:58855749-58855771 AAGAGCTGTCAAAGCAAAGCAGG + Intergenic
908522155 1:64954714-64954736 CAGAACCATCAATTAAAAGAAGG + Intronic
909627155 1:77730617-77730639 CAGAGCTGTGGCATAAAAGCAGG - Exonic
909882381 1:80896172-80896194 CAGTGTTATCAAATAAGAGATGG + Intergenic
910922907 1:92368714-92368736 CTGAGCTATCAAACAACATCTGG - Intronic
913090415 1:115472939-115472961 AAGAGCTATTAGCTAAAAGCTGG + Intergenic
914763460 1:150617770-150617792 CAGAGTTATAAAAAAAAATCAGG + Intronic
915902680 1:159857640-159857662 CAGTGCCATCAAATCAAACCTGG - Intronic
918862563 1:189850508-189850530 AAGAGCTAGAAAATAAAAGTGGG + Intergenic
919600662 1:199618286-199618308 CAGAGCTAGCAAATGAAACATGG - Intergenic
921002730 1:211060526-211060548 AAGAGAAATGAAATAAAAGCTGG + Intronic
923727732 1:236522177-236522199 CAGAGTTAACAAAGAAAATCTGG - Intronic
1064405107 10:15054673-15054695 AAGAGCTAGGAAACAAAAGCGGG - Intronic
1067357625 10:45545278-45545300 AAGATCTATTAAATAAATGCTGG + Intronic
1068397032 10:56476172-56476194 CAGAAGTTGCAAATAAAAGCAGG - Intergenic
1069147072 10:64906484-64906506 CAGAGCCCTCATATAAAGGCTGG - Intergenic
1071667737 10:87576978-87577000 CACAGCCAGCAAATAAAAGAGGG - Intergenic
1073758166 10:106603336-106603358 CAGAGATCCCAAATAAAGGCTGG + Intronic
1079295319 11:19228112-19228134 CAGAGATATAAAAAAGAAGCAGG + Intronic
1080675328 11:34421132-34421154 CAGTGCTATAAAATAAAAGATGG - Intergenic
1080911013 11:36598738-36598760 CAGAGCTGGCAAAGAAAACCAGG - Intronic
1085610320 11:77941968-77941990 CAGAGCTAGGAAATAAATCCAGG + Intronic
1086592861 11:88536438-88536460 GAGAGCTAACAAATAAAAACTGG - Intronic
1088767708 11:113000362-113000384 CAGAGCTATCTAGTAAAATTGGG + Intronic
1090200966 11:124855884-124855906 CAGAGAAATAAAATAAAATCTGG - Intergenic
1090314362 11:125771916-125771938 CAGAGATAACGAATAAAACCTGG - Intergenic
1090819611 11:130329567-130329589 CAGAGCTCTAAAATTAAATCAGG - Intergenic
1092621126 12:10270388-10270410 CAGAGCGATTAAATAAAGGAAGG + Intergenic
1094349915 12:29512951-29512973 CAGGTCCATCAAATAAAATCTGG + Intronic
1095506538 12:42904841-42904863 CAGAGCTGGCTACTAAAAGCAGG + Intergenic
1096062020 12:48709532-48709554 AATAGCTATCAATAAAAAGCTGG + Intronic
1096851019 12:54437489-54437511 CAGAGCTTTCATATACAACCAGG - Intergenic
1096889349 12:54751386-54751408 CAGTGCTTACAAATAAAAGTAGG + Intergenic
1097044266 12:56175668-56175690 CAGAGCTAGTAAATAAAACCAGG - Intronic
1100904641 12:99283869-99283891 CAGATAAATGAAATAAAAGCAGG - Intronic
1101685013 12:107010738-107010760 CAGAGATCTCTGATAAAAGCTGG - Intronic
1107701578 13:43053907-43053929 CAGAGCAATCAAACAAGAGAGGG - Intronic
1107998192 13:45882340-45882362 CAGTGCTATCCAATAAACACTGG - Intergenic
1109221981 13:59648994-59649016 AAGAGCCAGCAGATAAAAGCTGG + Intergenic
1109679895 13:65737163-65737185 CAGAGCAATCAGACAAAAGAGGG + Intergenic
1111741748 13:92213791-92213813 CAGATCTATCTAATGAAAGCAGG - Intronic
1112110562 13:96293173-96293195 AAGAAATATCAAATAAAAGATGG - Intronic
1115383437 14:32767353-32767375 AAAAGCTATCAAATAAAACAGGG - Intronic
1116644296 14:47506887-47506909 CAGAGCCATAAAATAAACTCTGG - Intronic
1117874196 14:60234552-60234574 CAGAGTTATGAAAAAAAAACTGG + Intergenic
1120697686 14:87662289-87662311 CAGTGGAAACAAATAAAAGCAGG + Intergenic
1121748289 14:96320830-96320852 CTGAACTATGAAATAAAAGGAGG + Intronic
1121923801 14:97909141-97909163 CAGAGATATTAAATAACAGTTGG - Intergenic
1123103386 14:105821184-105821206 CAGAGCTACAATCTAAAAGCAGG + Intergenic
1202900096 14_GL000194v1_random:30660-30682 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1123716158 15:23034162-23034184 CAGAGCCTTCAAAGGAAAGCAGG - Intronic
1125422665 15:39520066-39520088 CAGCATTATCAAATAAAGGCTGG + Intergenic
1127693181 15:61417917-61417939 CAGAGAGATCAAATAATAGGAGG - Intergenic
1128561858 15:68673924-68673946 AAGAGCTGACAAATAAAAGAAGG + Intronic
1129868585 15:78926712-78926734 CAGAGCTAGGAAATAGATGCTGG - Intronic
1130615354 15:85401459-85401481 CAGAGAAAACAAATCAAAGCTGG - Intronic
1134838858 16:17384749-17384771 CAAAGCTATTAGCTAAAAGCAGG + Intronic
1135037849 16:19093151-19093173 CAGAGAGAAGAAATAAAAGCAGG - Intergenic
1135169904 16:20174755-20174777 CAGGGCTCTCAGATAAAAGCTGG + Intergenic
1135467001 16:22695212-22695234 CAGAAGCTTCAAATAAAAGCAGG - Intergenic
1136735638 16:32464182-32464204 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1138751493 16:59427813-59427835 CAGAGCTAGTAAAGAAAAACTGG - Intergenic
1140355759 16:74304676-74304698 GAGAGGTATGAAATAAATGCAGG + Intronic
1140897130 16:79334633-79334655 CAGAGCATTCAATGAAAAGCAGG + Intergenic
1203017439 16_KI270728v1_random:365388-365410 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203035774 16_KI270728v1_random:638546-638568 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1146728229 17:35172868-35172890 CAGAGGAATGAAATAAAAGACGG - Intronic
1151104274 17:71594332-71594354 CAGAGCTATCTAATTGTAGCAGG - Intergenic
1153621019 18:6977877-6977899 CAGAGCTAACAAATACAAGAAGG + Exonic
1154487140 18:14881079-14881101 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1154498791 18:14983319-14983341 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1155969810 18:32071441-32071463 CAGAGCCATCAAATAAAAACTGG - Exonic
1156616873 18:38797252-38797274 ATTATCTATCAAATAAAAGCTGG + Intergenic
1157536141 18:48458990-48459012 CAGAGCTATTACATAAAACTGGG + Intergenic
1158249687 18:55473772-55473794 CATAGTAATCAAATCAAAGCAGG + Intronic
1164174062 19:22752023-22752045 CAGAGCTCTCATACAAAAGGAGG - Intergenic
1202647386 1_KI270706v1_random:155009-155031 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
925116173 2:1380056-1380078 CAGGGTTATCAAATAAAATAAGG - Intronic
929008608 2:37419102-37419124 CAGGACGATCCAATAAAAGCGGG + Intergenic
929942633 2:46346698-46346720 CAGAGCTAACAATACAAAGCAGG + Intronic
930667597 2:54115360-54115382 CAAAGTTAGTAAATAAAAGCCGG - Intronic
936591847 2:113811823-113811845 CAGTGCTATTAAAAAAAATCAGG + Intergenic
938497750 2:131811440-131811462 CAGAGCAATCAGACAAAAGAAGG + Intergenic
940137920 2:150460149-150460171 CAGACCTCTCAAACAAAAGAGGG - Intergenic
940403943 2:153279350-153279372 CAGAGCAGTCAAGTAAAAGGAGG - Intergenic
940475747 2:154160092-154160114 CAGATAAATCAAATAAAGGCTGG - Intronic
940557232 2:155245579-155245601 AAGAGCTATTATATAGAAGCTGG - Intergenic
940771712 2:157845689-157845711 CAGAGCAAGCAAAGACAAGCCGG + Intronic
941051617 2:160740764-160740786 CAGAGCTATCAAGAACAAGATGG - Intergenic
941867226 2:170347654-170347676 CAGAGCTATCATTTAACACCAGG + Intronic
942329287 2:174805158-174805180 GAGAGTTATGAAATAAAAACAGG + Intronic
943962800 2:194288870-194288892 CAGAGCTATCAAGGAAAAAATGG + Intergenic
945850163 2:214996123-214996145 CAGAGCTACCAAACAGAAACTGG + Intronic
948623262 2:239250164-239250186 CAGAGTCATGGAATAAAAGCAGG - Intronic
1169886339 20:10402871-10402893 AATAGCTATCTAATAAAGGCAGG - Exonic
1170822208 20:19764131-19764153 CTGATCTACCAAATAAAATCAGG - Intergenic
1173115828 20:40241788-40241810 CATAGCCTGCAAATAAAAGCAGG - Intergenic
1173143785 20:40507457-40507479 CATAGCTAGCAAAAAGAAGCAGG - Intergenic
1174537790 20:51266064-51266086 CAGAGCTAATAAATAAAGGCAGG - Intergenic
1174909955 20:54596847-54596869 CAGAACTGTCACATAAAACCTGG - Intronic
1176604479 21:8817764-8817786 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1176619469 21:9045438-9045460 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1176794142 21:13358234-13358256 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1177663028 21:24112622-24112644 CAGAGCTAGCACACAAAAGTTGG - Intergenic
1180346770 22:11709372-11709394 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1180354522 22:11827488-11827510 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1180383733 22:12164871-12164893 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1180536918 22:16401747-16401769 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
1183226017 22:36550479-36550501 CAGAGCTTTCCAATAAAGGCAGG + Intergenic
1184633820 22:45809136-45809158 CTGAGCTATAAATTAAAATCTGG + Intronic
1184907190 22:47496763-47496785 CAGAGCTGACACCTAAAAGCAGG - Intergenic
949590466 3:5488938-5488960 CAGAGACATAAAATAGAAGCTGG - Intergenic
950927911 3:16760816-16760838 CAGCGCTATGAAGTAAAACCAGG + Intergenic
951454965 3:22881056-22881078 CAGAGTAATCAAATAAATGAAGG + Intergenic
952187656 3:30988020-30988042 TAGAAATATAAAATAAAAGCTGG + Intergenic
952796922 3:37247615-37247637 CAGAACTATAAAATAATAACTGG - Intronic
952979694 3:38724669-38724691 CAGAGCCAGCAAATAAGAGTTGG - Intronic
953430144 3:42832647-42832669 CAGTGCTGTCCAATAAAAACAGG + Intronic
954226644 3:49185979-49186001 AAGAGCTATAAAATTATAGCCGG - Intronic
954391885 3:50271927-50271949 CAGAGCTAGCAATGAAAAGGGGG + Intronic
954638907 3:52086467-52086489 ATGAGCTATCAAAACAAAGCAGG + Intronic
955442490 3:58972355-58972377 CAATGCTATAATATAAAAGCTGG + Intronic
957434339 3:80154251-80154273 CACAGCTATAAAAAAAAATCTGG - Intergenic
958949814 3:100404224-100404246 CAGTGGTATCAAGTAAAAGTGGG - Intronic
959685966 3:109146793-109146815 CAGCCCTATTAAATAAAAGAGGG + Intergenic
959970162 3:112400406-112400428 AAGAGCGATCAGATGAAAGCTGG - Intergenic
961681896 3:128604947-128604969 CAGAGCTTCCAAAGCAAAGCTGG - Intergenic
962003802 3:131327858-131327880 CAGTGCTACAAAATAAAAACAGG - Intronic
964550209 3:157877261-157877283 CAGAGGTATCAGAGAAAAGCAGG + Intergenic
964764503 3:160166693-160166715 AAGAGCAATGAAATAAAGGCCGG + Intergenic
965525491 3:169712413-169712435 AATAGCAATCAAATGAAAGCTGG - Intergenic
966547941 3:181171931-181171953 CAGTGCTATCAAATAGAGGTAGG + Intergenic
967292086 3:187931220-187931242 AAAAGCTATCCAAGAAAAGCAGG + Intergenic
970316316 4:14831620-14831642 CAGAGCTATGTAATAAATTCTGG + Intergenic
972683546 4:41329950-41329972 CAGAGCTGTCAAATAAACTCTGG - Intergenic
972837710 4:42893795-42893817 AACAGCTATCAATTAAAAACTGG + Intronic
973186936 4:47340818-47340840 CACAGCTATCATAGAAAAGATGG - Intronic
973373646 4:49273176-49273198 CAGAGCAATCAGACAAAAGAAGG + Intergenic
973387371 4:49522036-49522058 CAGAGCAATCAGACAAAAGAAGG - Intergenic
975610640 4:76199289-76199311 CAGATTTAGCAAATAAAACCTGG + Intronic
975818653 4:78246759-78246781 CAGACATATCAAATAAGAGGTGG + Intronic
976979871 4:91214118-91214140 CAGAGTTATTAAAGAAGAGCAGG + Intronic
977368234 4:96101109-96101131 CAAAACTATTAAATTAAAGCTGG - Intergenic
977834081 4:101628698-101628720 CAGAGCAATCAGATAACAGAAGG - Intronic
978661597 4:111133611-111133633 CAGAGCAATCAGACAAAAGAAGG - Intergenic
978824788 4:113008897-113008919 CACAGCTAACAAAGAAAAGCAGG + Intronic
980227694 4:130008785-130008807 CAGAGCTATCTCTTAAAAGAAGG - Intergenic
982176554 4:152710385-152710407 CAGGGGTATCAATGAAAAGCAGG + Intronic
983270218 4:165552297-165552319 CAAAGCTAACAAATCAAAGCAGG - Intergenic
984950896 4:185006942-185006964 CAATGGTATCAAATAAATGCAGG + Intergenic
988985911 5:36618815-36618837 CAGAAATAGCAATTAAAAGCAGG - Intronic
995006690 5:107205605-107205627 CAAAGCTATAAAATATAAGAAGG + Intergenic
995014697 5:107296871-107296893 CAAACCTATCAATTAAATGCAGG - Intergenic
997051026 5:130380268-130380290 CCAAACTATAAAATAAAAGCTGG - Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999577105 5:152991304-152991326 AACAGCTATTAAATAAAAGCAGG + Intergenic
1000860076 5:166446982-166447004 CAGAGATATTAAAAAAAAGGGGG - Intergenic
1001279923 5:170379358-170379380 CAGAGCTATCTAAGGAAACCAGG + Intronic
1006414229 6:33893883-33893905 CAGGGCTATTAAATAATAACAGG + Intergenic
1006708729 6:36046632-36046654 CAGAGTGATTAAATAAGAGCTGG - Intronic
1007153643 6:39720459-39720481 CAGAGCTAGTAAAGAAAGGCTGG + Intronic
1008121909 6:47628296-47628318 CAGTTCTAGGAAATAAAAGCAGG + Intergenic
1008722251 6:54370074-54370096 CTGAGATGTCAAATAAAACCAGG + Intronic
1012016487 6:93858857-93858879 GAGAGCTATCAGATTATAGCTGG + Intergenic
1013374289 6:109499118-109499140 CAGAGCAATCAAATAATTCCTGG + Exonic
1014230590 6:118897801-118897823 CAGAGGAATTAAATGAAAGCTGG + Intronic
1015180166 6:130353219-130353241 CAGAGCTATCAAATAAAAGCTGG - Intronic
1015874736 6:137811442-137811464 CAGAACTATCAAATATAATTGGG + Intergenic
1016552092 6:145293447-145293469 CACAGTTATGAAATAAAAGAGGG + Intergenic
1016602986 6:145884011-145884033 AAGAGCTATTAAATGAGAGCAGG + Intronic
1020065255 7:5183433-5183455 TAGAGCAATTAAACAAAAGCTGG + Intergenic
1021779571 7:24089685-24089707 CAGAGCAATCAGATAAGAGAAGG - Intergenic
1024674373 7:51624765-51624787 CAGAGATATCAAGGAAAAACTGG - Intergenic
1024696189 7:51858957-51858979 CAGAGCTTCCAAATAAGGGCAGG - Intergenic
1024942607 7:54777927-54777949 CTGAGCTATTATATAAAGGCAGG + Intergenic
1028672785 7:93423048-93423070 AAGAGCAATCAAGTAAAAGCAGG - Intergenic
1031895517 7:127344000-127344022 AAGAGCTAACATTTAAAAGCTGG + Intergenic
1034710525 7:153187141-153187163 CAGACATATCACATGAAAGCAGG + Intergenic
1036097981 8:5745665-5745687 CAGTGCTATGAAAGAAATGCAGG + Intergenic
1036910189 8:12752361-12752383 CAGAGCTAACAAATTAGAGTTGG - Intronic
1036950385 8:13133727-13133749 CAGAGCTACCAAGAAAAAGAAGG - Intronic
1037338396 8:17814237-17814259 CATAGATCTCAGATAAAAGCTGG - Intergenic
1037424962 8:18745706-18745728 CAGAGCTAAGAAATATATGCAGG + Intronic
1038371233 8:26993618-26993640 CAGAGCTTTCTTAAAAAAGCAGG - Intergenic
1038907766 8:31926214-31926236 CAGAGGTCTCAAATGAAAGACGG + Intronic
1039372522 8:37001221-37001243 CAGAGAAATCAAATTAAAACAGG - Intergenic
1039734965 8:40321957-40321979 CAGAGCTATCCAATAAACCCAGG - Intergenic
1042188548 8:66162011-66162033 CAGAGCAATCAGATAAGAGAAGG - Intronic
1043189561 8:77201476-77201498 CCAAACTATAAAATAAAAGCTGG + Intergenic
1043631656 8:82342789-82342811 CAGAGCAACCAAATAGAAGAAGG + Intergenic
1044255535 8:90056206-90056228 CAGAGCTAACAAATAAATGGTGG - Intergenic
1045131248 8:99155953-99155975 CTGAGCTTTCAAATAAATACAGG - Intronic
1045615972 8:103911895-103911917 CAGTGCTTTGAAATGAAAGCTGG + Intronic
1045637308 8:104207264-104207286 CAGAGCTAGCAAATAGAGACTGG + Intronic
1046098690 8:109589951-109589973 CAAAGCTATCAAATTAATTCAGG + Intronic
1048154644 8:131934187-131934209 CAGAGCTTTGAAAGAAAAGTGGG - Intronic
1048190488 8:132283767-132283789 TAGTTCTATAAAATAAAAGCTGG + Intronic
1051811457 9:21054312-21054334 CAGAACTATCACAGAAAGGCAGG + Intergenic
1053753207 9:41276266-41276288 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1053884593 9:42634408-42634430 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1054223615 9:62441853-62441875 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1054258735 9:62840632-62840654 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1054333044 9:63779411-63779433 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1055343448 9:75309355-75309377 CAGAGAGAGCAAAGAAAAGCAGG - Intergenic
1062292683 9:135804102-135804124 CTGTGCTTTCAAATAAAAACTGG - Intergenic
1202800038 9_KI270719v1_random:167722-167744 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203697344 Un_GL000214v1:111180-111202 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203551863 Un_KI270743v1:169847-169869 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1185853859 X:3514868-3514890 AAGTGCTATGAAATAATAGCTGG + Intergenic
1190834488 X:54087795-54087817 CAGAGCAAGCTAATTAAAGCAGG - Exonic
1192035270 X:67556293-67556315 AAGAGCTGTGAGATAAAAGCAGG - Intronic
1192991061 X:76456911-76456933 AAGAGCTTTAAAAAAAAAGCAGG + Intergenic
1193151306 X:78127529-78127551 CAGAGCTAGTAAGTAACAGCAGG + Exonic
1193689707 X:84625927-84625949 CAGAGCAATCAGATAAGAGAAGG - Intergenic
1196531082 X:116787019-116787041 CAGAGCAATCAAACAAGAGAGGG + Intergenic
1197028676 X:121787298-121787320 CAGAGCTATAAAGTAAAATAAGG - Intergenic
1197802410 X:130365426-130365448 CAGACCCATCAGATAAAACCTGG - Intronic
1201153136 Y:11105429-11105451 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1201756085 Y:17486683-17486705 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
1201845467 Y:18419302-18419324 CAGAGCAATCAGAAAAAAGAAGG - Intergenic