ID: 1015187586

View in Genome Browser
Species Human (GRCh38)
Location 6:130435879-130435901
Sequence CTTCATACACTGAAGGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015187583_1015187586 -8 Left 1015187583 6:130435864-130435886 CCTTTGAGTCTGCATCTTCATAC 0: 1
1: 0
2: 2
3: 4
4: 156
Right 1015187586 6:130435879-130435901 CTTCATACACTGAAGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015187586 Original CRISPR CTTCATACACTGAAGGGATA TGG Intronic
No off target data available for this crispr