ID: 1015189985

View in Genome Browser
Species Human (GRCh38)
Location 6:130461783-130461805
Sequence TTGGCAACCCACTTAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015189979_1015189985 -9 Left 1015189979 6:130461769-130461791 CCACAATCTCCCTCTTGGCAACC No data
Right 1015189985 6:130461783-130461805 TTGGCAACCCACTTAGGGGCTGG No data
1015189976_1015189985 18 Left 1015189976 6:130461742-130461764 CCATAGATGTTTTTCCTGTAGGC No data
Right 1015189985 6:130461783-130461805 TTGGCAACCCACTTAGGGGCTGG No data
1015189977_1015189985 4 Left 1015189977 6:130461756-130461778 CCTGTAGGCTTTTCCACAATCTC No data
Right 1015189985 6:130461783-130461805 TTGGCAACCCACTTAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015189985 Original CRISPR TTGGCAACCCACTTAGGGGC TGG Intergenic
No off target data available for this crispr