ID: 1015190603

View in Genome Browser
Species Human (GRCh38)
Location 6:130467816-130467838
Sequence CAGAGTGAGCAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015190603_1015190609 5 Left 1015190603 6:130467816-130467838 CCTCCCTCCCTCTGCTCACTCTG No data
Right 1015190609 6:130467844-130467866 GTGAAAACTGTAAAGAAGGCAGG No data
1015190603_1015190608 1 Left 1015190603 6:130467816-130467838 CCTCCCTCCCTCTGCTCACTCTG No data
Right 1015190608 6:130467840-130467862 TATTGTGAAAACTGTAAAGAAGG No data
1015190603_1015190611 17 Left 1015190603 6:130467816-130467838 CCTCCCTCCCTCTGCTCACTCTG No data
Right 1015190611 6:130467856-130467878 AAGAAGGCAGGTCTTGTTCAGGG No data
1015190603_1015190610 16 Left 1015190603 6:130467816-130467838 CCTCCCTCCCTCTGCTCACTCTG No data
Right 1015190610 6:130467855-130467877 AAAGAAGGCAGGTCTTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015190603 Original CRISPR CAGAGTGAGCAGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr