ID: 1015194058

View in Genome Browser
Species Human (GRCh38)
Location 6:130506043-130506065
Sequence CCCAACTAGAAAATAACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015194056_1015194058 -4 Left 1015194056 6:130506024-130506046 CCAAGATAAACACTAAGATCCCA No data
Right 1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015194058 Original CRISPR CCCAACTAGAAAATAACCCA AGG Intergenic
No off target data available for this crispr