ID: 1015195116

View in Genome Browser
Species Human (GRCh38)
Location 6:130517164-130517186
Sequence CCTACTATGTATCAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015195116_1015195120 12 Left 1015195116 6:130517164-130517186 CCCTGTTCCTGATACATAGTAGG No data
Right 1015195120 6:130517199-130517221 GTTTGCTGAGTGAATAATGAAGG No data
1015195116_1015195121 13 Left 1015195116 6:130517164-130517186 CCCTGTTCCTGATACATAGTAGG No data
Right 1015195121 6:130517200-130517222 TTTGCTGAGTGAATAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015195116 Original CRISPR CCTACTATGTATCAGGAACA GGG (reversed) Intergenic
No off target data available for this crispr