ID: 1015205926

View in Genome Browser
Species Human (GRCh38)
Location 6:130638565-130638587
Sequence GCTTAAGAAGTTTTGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015205926_1015205931 5 Left 1015205926 6:130638565-130638587 CCGGCCCCCAAAACTTCTTAAGC No data
Right 1015205931 6:130638593-130638615 AGCCATTTCAGCTAAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015205926 Original CRISPR GCTTAAGAAGTTTTGGGGGC CGG (reversed) Intergenic
No off target data available for this crispr