ID: 1015206241

View in Genome Browser
Species Human (GRCh38)
Location 6:130642746-130642768
Sequence CTCCATAGCCATACTTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015206238_1015206241 -9 Left 1015206238 6:130642732-130642754 CCAAACCATATCATCTCCATAGC No data
Right 1015206241 6:130642746-130642768 CTCCATAGCCATACTTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015206241 Original CRISPR CTCCATAGCCATACTTGGCA TGG Intergenic
No off target data available for this crispr