ID: 1015210005

View in Genome Browser
Species Human (GRCh38)
Location 6:130686208-130686230
Sequence AAAGATAGCATGTCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015210005_1015210006 -1 Left 1015210005 6:130686208-130686230 CCAGTTTCAGACATGCTATCTTT 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1015210006 6:130686230-130686252 TAGTTGCTTAGTTGAAGTAGTGG 0: 1
1: 0
2: 0
3: 9
4: 106
1015210005_1015210007 11 Left 1015210005 6:130686208-130686230 CCAGTTTCAGACATGCTATCTTT 0: 1
1: 0
2: 0
3: 14
4: 217
Right 1015210007 6:130686242-130686264 TGAAGTAGTGGAAATGAGTTTGG 0: 1
1: 0
2: 0
3: 23
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015210005 Original CRISPR AAAGATAGCATGTCTGAAAC TGG (reversed) Intergenic
900583882 1:3423215-3423237 AAACCTAGCAAGTCTGAAAATGG - Intronic
902472095 1:16656275-16656297 AAAGACAGTCTGTCTGAGACAGG - Intergenic
902486708 1:16751171-16751193 AAAGACAGTCTGTCTGAGACAGG + Intronic
902993742 1:20207855-20207877 AAATATAGCATTTCTTAAAATGG - Intergenic
904594506 1:31634898-31634920 AAAGATAACATATCCCAAACAGG + Intronic
906370155 1:45247179-45247201 AAAGATACCATTTATGAACCAGG + Intronic
907535323 1:55149162-55149184 AAATATATTATTTCTGAAACTGG + Intronic
908957914 1:69657781-69657803 AAACATAACATGACAGAAACTGG - Intronic
910232511 1:85000676-85000698 TAAGATAGCTTGTTGGAAACTGG - Intronic
910328270 1:86036988-86037010 AAAGTTAACATTTGTGAAACTGG - Intronic
910799062 1:91127773-91127795 AAAGATAGCAGGCCTGTGACTGG + Intergenic
913071489 1:115302948-115302970 AAAGAAAGCAGGGCTGAAAGTGG - Intronic
916959573 1:169875489-169875511 TAAGATACCATGTATGAAATTGG + Intronic
918780316 1:188691389-188691411 AGAGATTACATATCTGAAACTGG + Intergenic
922737508 1:227995545-227995567 TATGACAGCATGCCTGAAACTGG + Intergenic
1062897512 10:1115732-1115754 AAAGAAAGCAGATCTGAAAGTGG - Intronic
1064885070 10:20102702-20102724 AAATTTACCATGCCTGAAACAGG - Intronic
1064988722 10:21237154-21237176 AAAGATGTCATATTTGAAACAGG - Intergenic
1067248375 10:44565725-44565747 AAAAAAAGCATGTCTGGCACAGG + Intergenic
1070948246 10:80410499-80410521 AAAGACAGGATATCTGAAGCAGG - Intronic
1071079322 10:81791501-81791523 AAAGATACAATGTCTAACACTGG - Intergenic
1071132270 10:82408432-82408454 TAAAATATCATGTCTGAAAAAGG - Intronic
1071167564 10:82824093-82824115 TAAAATAAAATGTCTGAAACAGG - Intronic
1071381860 10:85073639-85073661 AAAGACAGGATTTCTTAAACAGG + Intergenic
1072762661 10:98069934-98069956 AAAGATAGCATTTACGAAAAAGG + Intergenic
1073039159 10:100588057-100588079 AAAGAGAGCAGGGCTGAAAAAGG + Intergenic
1073864871 10:107790873-107790895 AAAGGTAAAATGTCTGAAAAAGG + Intergenic
1075869836 10:125763149-125763171 AAAGAAGGCAGGTCTGAACCCGG + Intronic
1076231265 10:128821723-128821745 AAAAATAGTATGTCTGCCACAGG - Intergenic
1077859421 11:6161758-6161780 AAAGATAGGATGACTCAAACAGG + Intergenic
1079031753 11:16991399-16991421 AAATATAACATGTCTGAGTCAGG + Intronic
1079969157 11:27015426-27015448 GAAGATAGCATCTATGAACCAGG - Intergenic
1080043607 11:27785257-27785279 AAAGATAGCATTTCTTCTACAGG + Intergenic
1081254527 11:40876027-40876049 AAAGATAGAATGTTGGAAATGGG + Intronic
1081809373 11:45906532-45906554 AAAGATACCATGTGTGACAAAGG - Exonic
1085414301 11:76310101-76310123 AGAGATGGCCTGGCTGAAACAGG + Intergenic
1085708785 11:78810626-78810648 AAAGTTAACAGGTCTGAATCAGG + Intronic
1086698928 11:89877024-89877046 AGAGATAGAATGACAGAAACAGG - Intergenic
1086707243 11:89967479-89967501 AGAGATAGAATGACAGAAACAGG + Intergenic
1087257575 11:95973663-95973685 AAAGAAAACATGTCTCCAACAGG - Intergenic
1090427619 11:126619757-126619779 AAAGATAGAATCTCTGACACTGG + Intronic
1090687409 11:129138959-129138981 AAACCTACCATGTCTAAAACAGG + Intronic
1091232006 11:133994211-133994233 AAAGAAAGCATCTCTTAGACTGG - Intergenic
1093033832 12:14314473-14314495 AAAGCCCTCATGTCTGAAACTGG - Intergenic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1094498460 12:31003828-31003850 AAAGACAGCTTCTCTGAGACAGG - Intergenic
1096884348 12:54701526-54701548 AAAGATCAGATGTCTGAAATGGG - Intergenic
1098101690 12:67024470-67024492 CAAGGCAGCATGTCTGAAATAGG + Intergenic
1098919275 12:76288487-76288509 AAAGATAGCAAGTATGAGAAAGG - Intergenic
1100480380 12:94972259-94972281 AATCATGGCATGTCTGAAAATGG - Intronic
1102212193 12:111135654-111135676 AAAGAATGCATCTCTGACACAGG + Intronic
1103698857 12:122837254-122837276 AAAGAGAGAATCTCTGATACAGG + Intronic
1105506265 13:21012882-21012904 AAAGATAACATGGATGAAAGAGG + Intronic
1105897680 13:24730926-24730948 AGAGCTAGCATATCTGGAACAGG + Intergenic
1106140726 13:27008694-27008716 AAACACAGCATCACTGAAACAGG - Intergenic
1106602083 13:31196861-31196883 TAAAATAGAATGTCTAAAACAGG - Intergenic
1110246561 13:73331675-73331697 AAAGACAGCATGTAGGACACTGG + Intergenic
1111178028 13:84623851-84623873 TTAGATAGGATGTCTGAAAGAGG - Intergenic
1111297515 13:86301766-86301788 AAGGATAGCATGTCTCATAACGG + Intergenic
1111515946 13:89331202-89331224 GAAAATAGCATTTCTGAAACTGG - Intergenic
1112287301 13:98115671-98115693 AAAAATAGCATTTCCCAAACTGG - Intergenic
1113331255 13:109330063-109330085 AATGATTGCATGTCTGTAATTGG - Intergenic
1113714030 13:112490041-112490063 AAAGACAGTATGTGTGAAAGTGG + Intronic
1114011657 14:18375696-18375718 AAACATAGCCTGTCTCACACAGG + Intergenic
1116325261 14:43525602-43525624 AAAGATAGCATGGCTACAAATGG - Intergenic
1118379509 14:65206021-65206043 AAAGAAAGCATGGCTGCAGCAGG + Intergenic
1118469603 14:66063053-66063075 GAAGAAAGCTTATCTGAAACTGG + Intergenic
1118652498 14:67912404-67912426 AATGTTATCATGTCTAAAACAGG - Intronic
1118904990 14:70017369-70017391 TCAGGTAGCATGTCTGGAACAGG + Intronic
1120540802 14:85747995-85748017 AAAGATGGCTTCTCTGAACCAGG + Intergenic
1121326381 14:93022317-93022339 ACAGAGAGCATGTGTGAAAACGG + Intronic
1121708960 14:96022738-96022760 AAAAATAGAATGGTTGAAACTGG + Intergenic
1123955079 15:25326764-25326786 AAGGTTACCATGTCTGAAGCTGG + Intergenic
1124239352 15:28017128-28017150 GAAAATAGGATCTCTGAAACCGG + Intronic
1124737627 15:32265342-32265364 AAAGTTATCATGTCTGAGCCTGG - Intergenic
1125391893 15:39201263-39201285 AAAGATATTATTTCTGAAAGGGG - Intergenic
1131659145 15:94495452-94495474 AAAAATGGCATGTTTGTAACAGG - Intergenic
1135574086 16:23571695-23571717 AAAGGCAGCATCTCTGAACCTGG - Exonic
1137842932 16:51656648-51656670 AGAGAAAGGATGTCTGAAAATGG - Intergenic
1138874520 16:60933356-60933378 AAAGATAGAATGTCAAAAATAGG - Intergenic
1139017930 16:62712253-62712275 AAACATCTCATGGCTGAAACTGG - Intergenic
1142905683 17:3040174-3040196 AAAGAGAGCTTTTCTGAAATTGG + Intergenic
1143039776 17:4025388-4025410 AAAGATAGCATATATGAGGCCGG + Intronic
1145265967 17:21379723-21379745 AAAGAGAGCTGGCCTGAAACTGG + Intronic
1146666270 17:34706283-34706305 AAAACTAGAATGTCAGAAACTGG + Intergenic
1147855974 17:43480364-43480386 AAGGATAGGAGGTCTGAAAGTGG - Intergenic
1149095705 17:52837978-52838000 TTAGATGTCATGTCTGAAACAGG - Intergenic
1149167984 17:53776569-53776591 AAAGATAGCATGGATGAACCAGG - Intergenic
1149303252 17:55324919-55324941 AAAGATCGCATCTGTTAAACAGG + Exonic
1151165574 17:72200380-72200402 AAAGATAGCCTACCTCAAACTGG - Intergenic
1153448547 18:5199768-5199790 AAAGAAAGAATGCCTGAAAATGG + Intergenic
1154062677 18:11077647-11077669 AAAGAGAGAACTTCTGAAACAGG - Intronic
1155011033 18:21777856-21777878 AAAATTAGAATGTCTGAATCTGG - Intronic
1156583137 18:38402495-38402517 ATATATAGCATATCTGAAAATGG - Intergenic
1157136176 18:45058011-45058033 AAAGATAGAATGTCTAGATCTGG + Intronic
1157905162 18:51563278-51563300 ATAGGTAGCATGTCTGAAGAAGG - Intergenic
1157912279 18:51628114-51628136 AAAGTTAAAATGTCTGAAAGGGG - Intergenic
1158012400 18:52743943-52743965 AAAGCTAGCATGACTGAATCAGG - Intronic
1159361503 18:67410487-67410509 AGAAATTGCATTTCTGAAACTGG + Intergenic
1160230390 18:77044277-77044299 AAAGACTGCATGCCTGAGACGGG + Intronic
1164742412 19:30585686-30585708 AAAGATAGCAGGGATGAGACTGG - Intronic
1164962578 19:32447287-32447309 AAAGACAGAAAGTCTGAAATCGG + Intronic
1166879663 19:45920122-45920144 AAAGAGAGCTTGTCTGAAGAAGG - Intergenic
1168207966 19:54866227-54866249 AGAGATAGAATGTCTGAGTCTGG + Intronic
1202704492 1_KI270713v1_random:13069-13091 AAAGACAGTGTGTCTGAGACAGG - Intergenic
929377820 2:41311454-41311476 ATAGATAGCAAGTCTGTATCTGG - Intergenic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
931697517 2:64882568-64882590 CAAGAAAGCATGCCTGGAACAGG + Intergenic
932426958 2:71643926-71643948 AAAGAGACCATTTCAGAAACAGG - Intronic
933328652 2:80870051-80870073 AAGGTCAGCATTTCTGAAACAGG + Intergenic
933500274 2:83102162-83102184 AAAGATAATATTTCTGTAACCGG - Intergenic
934532969 2:95107225-95107247 AAAGGTAGAGTATCTGAAACTGG - Intronic
937891856 2:126945226-126945248 AAAGAGAGAATGTGGGAAACAGG + Intergenic
943345417 2:186732918-186732940 ATAGATAGAAAATCTGAAACTGG - Intronic
946817052 2:223589898-223589920 GGAGATAGCATTTCTGAAAGAGG + Intergenic
948313094 2:237004406-237004428 AAAGGTAGCATGGCAGAAAGCGG + Intergenic
1168847656 20:956563-956585 AAGGAGCGCATTTCTGAAACGGG - Intergenic
1169822633 20:9729341-9729363 AAAGTTAGGATGTCTGATAATGG + Intronic
1173041065 20:39463273-39463295 AAAGAAATTATGTCTGAAAAAGG + Intergenic
1174170069 20:48611795-48611817 AAAGATAGCATGTCAAGAATAGG + Intergenic
1175978253 20:62724339-62724361 AAAGGAAGCATGCCTGGAACAGG + Intronic
1176942910 21:14945395-14945417 AAACATAGCATGTTTACAACAGG - Intergenic
1177014264 21:15764801-15764823 ACAGATAGCATTTTTGAAAGTGG + Intronic
1178752216 21:35315768-35315790 AAAGATGGCATCTCTTAAAAAGG + Intronic
1179400816 21:41081368-41081390 AATGAAAACATATCTGAAACAGG + Intergenic
1180436150 22:15306504-15306526 AAACATAGCCTGTCTCACACAGG + Intergenic
1182900151 22:33891163-33891185 AAAGATAACATTTCTGGAGCTGG - Intronic
949416507 3:3820655-3820677 GAACAAAGCCTGTCTGAAACAGG - Intronic
950471622 3:13189907-13189929 AAGGATTGCATGTCAGCAACAGG - Intergenic
951071930 3:18339094-18339116 AAAAATAGCCTTTCTGAAATCGG + Intronic
951119262 3:18905482-18905504 AAAGACAGTCTGTCTGAGACAGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952582059 3:34846102-34846124 AAAGAGAACATCTCTGAAATGGG - Intergenic
953010377 3:39019621-39019643 AAAGATGGCATAACAGAAACTGG - Intergenic
955302216 3:57791511-57791533 TAAGATAACATCCCTGAAACAGG + Intronic
955841254 3:63115247-63115269 AAAGAAAGCCTGTCTGTATCTGG + Intergenic
960460658 3:117930789-117930811 AAAGAAAGCCTGTCTAAGACTGG + Intergenic
960887369 3:122409780-122409802 AAAGAAAGCTCGTCTGAAAGAGG + Exonic
961162595 3:124741846-124741868 AAAGTTACTATATCTGAAACAGG - Intronic
962146307 3:132843609-132843631 AAAGATAAGATTTCTGAAAGTGG - Intergenic
962388855 3:134955052-134955074 AAAGAAAGGATGTCAGGAACAGG - Intronic
962636466 3:137337208-137337230 TAAGAAAGCATGTCAGAAATTGG + Intergenic
962695289 3:137941755-137941777 AAAGATACCAGATCTGACACAGG + Intergenic
963356313 3:144212595-144212617 AAAGATAGGATGTTGGAAATGGG + Intergenic
963794385 3:149617071-149617093 AGAGATAGCATGTCTAAAAATGG - Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
965536508 3:169829050-169829072 AATGATTGCTTGTCTGAAGCTGG - Intronic
966684009 3:182674367-182674389 ACTCATAGAATGTCTGAAACTGG - Intergenic
967078266 3:186024866-186024888 AAAGGGAGCAGGTCTGAGACTGG + Intergenic
968423959 4:508871-508893 GACCATGGCATGTCTGAAACAGG + Exonic
969465649 4:7354730-7354752 ACAGGGAGCATCTCTGAAACTGG + Intronic
970066800 4:12104367-12104389 AAAGATAAAATGTTTGAAATTGG + Intergenic
970611023 4:17725392-17725414 AAAAATAGCATTTCTTAAATAGG - Intronic
971426103 4:26517209-26517231 AAAGTTATCATGTCCGAATCTGG - Intergenic
972499731 4:39666885-39666907 AATGAGACCATGTGTGAAACTGG - Intergenic
973793964 4:54404681-54404703 AAAAAGAGCATGTTTTAAACTGG - Intergenic
974136784 4:57827874-57827896 AAAGTTAGAATGTTTAAAACAGG - Intergenic
974954194 4:68618319-68618341 AAGGATAGCATTTCTAATACTGG - Intronic
976858289 4:89630358-89630380 ATAGATAGAATCTCTGACACTGG + Intergenic
977862198 4:101975927-101975949 AAGGATAGCATATCTGAATGCGG - Intronic
980365352 4:131796890-131796912 AATGATACCATGTTTGAAATTGG + Intergenic
980657504 4:135809182-135809204 AAAGACAACATGTTTTAAACAGG - Intergenic
984382228 4:179009779-179009801 ATACATACCATGTCAGAAACAGG + Intergenic
985445682 4:190020158-190020180 CAATATAGCCTGTTTGAAACTGG + Intergenic
985925928 5:3019085-3019107 AAAGAAAGCTTTTGTGAAACGGG + Intergenic
987361937 5:17115316-17115338 AAAATTAGCAGGTCTGAAACAGG - Intronic
988230797 5:28476314-28476336 AAAGGTAGCGTGTTTGAAACAGG - Intergenic
990988191 5:61660307-61660329 AGAATTAGCAAGTCTGAAACTGG - Intronic
991977047 5:72193732-72193754 TGAGAGTGCATGTCTGAAACTGG + Intronic
992380808 5:76235423-76235445 AAAGAAAACATGTCTGAAGCTGG + Intronic
994132153 5:96242261-96242283 AAAGTTAGCTGGGCTGAAACTGG - Intergenic
1000818087 5:165948800-165948822 AAACATGGCATCTCTCAAACTGG + Intergenic
1000858711 5:166431014-166431036 AATGATAGCTTGTCTGACAGGGG - Intergenic
1001866058 5:175106516-175106538 AAATATTGAATGTCTAAAACAGG - Intergenic
1002209253 5:177586479-177586501 AAAGAAAGCATGCATGAAAGGGG + Intergenic
1005120057 6:22379803-22379825 TAATTTAGAATGTCTGAAACAGG + Intergenic
1006350243 6:33515655-33515677 ACAGATAGCATGTGTGCAAATGG - Intergenic
1006979322 6:38134004-38134026 ATAAAAAGCATCTCTGAAACGGG - Intronic
1010262043 6:73828730-73828752 AAAGATAGCATTTCACAATCGGG + Intergenic
1010701328 6:79051557-79051579 AAACATAGTATGTTTCAAACAGG - Intronic
1011206901 6:84909016-84909038 ACAGATATGAAGTCTGAAACTGG + Intergenic
1011257868 6:85442346-85442368 ATAGATAGAATCTCTGGAACTGG - Intergenic
1014986116 6:128012476-128012498 AAGGAAAGCATTTCTGAAAAAGG - Intronic
1015210005 6:130686208-130686230 AAAGATAGCATGTCTGAAACTGG - Intergenic
1016019574 6:139221695-139221717 TAAGATACAATGTCTAAAACTGG + Intergenic
1016645413 6:146401520-146401542 AAAGAAGGCATTTCTTAAACTGG + Intronic
1017267831 6:152471472-152471494 AAAGATAGCGTGTGTTAAATGGG - Intronic
1017708924 6:157148455-157148477 AGAGAGAGCATGTTTGAGACTGG + Intronic
1018531303 6:164766455-164766477 GAAGAAAGCATGTCTTAGACTGG - Intergenic
1021855190 7:24848350-24848372 AAATTTAGCATATCTGAAGCAGG + Intronic
1022877560 7:34551179-34551201 ACAGATGGCATGTCTAAAATAGG + Intergenic
1023311514 7:38892054-38892076 ATAGAAAGCAATTCTGAAACTGG + Intronic
1023708924 7:42971045-42971067 AAAAAAAAAATGTCTGAAACAGG - Intergenic
1024886644 7:54149534-54149556 AAATTTAACATGTCTGAAACTGG - Intergenic
1028331208 7:89594347-89594369 CAAGGTACCATCTCTGAAACTGG + Intergenic
1030916683 7:115323259-115323281 AAGGCTAGCAAGTCTGAAATCGG + Intergenic
1030988098 7:116265739-116265761 AAGGATAGCATGGCAGACACTGG + Intergenic
1032487158 7:132296618-132296640 AAAGCCAGCATTTCTGAACCTGG - Intronic
1033473632 7:141670104-141670126 AAAAATAGCATGTATGAGGCCGG - Intronic
1033586552 7:142778883-142778905 GAAGATACCATGTGTGCAACTGG - Intergenic
1033641673 7:143267932-143267954 AAAGAGAGCATCTTAGAAACAGG + Intronic
1034716945 7:153252297-153252319 AAAGATAGCAAGTAAGAAAATGG + Intergenic
1035049959 7:155993049-155993071 AGAGATGCCATGTCTGACACTGG - Intergenic
1037410480 8:18590692-18590714 AAAAAGAGTATGTCTGAAAGTGG + Intronic
1037443734 8:18943788-18943810 AAAGATACCATAGCGGAAACTGG + Intronic
1039045254 8:33443803-33443825 AATGATTGCATGCATGAAACTGG - Intronic
1040118854 8:43657940-43657962 AAAGAAACTATGTGTGAAACTGG + Intergenic
1041645839 8:60251641-60251663 AAAGATAGGAGGTATGAAATTGG - Intronic
1044596235 8:93961477-93961499 AAACATAGCATGTCTGAGGCTGG - Intergenic
1044970028 8:97610382-97610404 AAAGTTAGTATGTCTCAATCTGG - Intergenic
1045042554 8:98240406-98240428 GAAAATAGCCTGTCTGAATCAGG - Intronic
1045535479 8:103023146-103023168 AAGGCTAGCATGGCTGAAACGGG + Intronic
1047831046 8:128630196-128630218 ACAGGTAGCATGACTGAAGCAGG + Intergenic
1050624832 9:7492189-7492211 CAAGTTAGCATGTCTTAAATTGG - Intergenic
1051915189 9:22199285-22199307 AAATAAAACATGTCTGAGACTGG - Intergenic
1052345131 9:27401511-27401533 AAAGATAGATGATCTGAAACAGG + Intronic
1052849618 9:33369040-33369062 AAAGATAGCATGGGATAAACGGG - Intronic
1053501069 9:38592523-38592545 AAAGACAGCATGGGTAAAACTGG + Intergenic
1055400774 9:75921512-75921534 AAAGAACACATGTCTGAAAATGG - Intronic
1059631758 9:116132074-116132096 AAAGATAACATGTCTTAGAGAGG + Intergenic
1060009181 9:120028336-120028358 GAATATAGCAAGTCTGAAACTGG + Intergenic
1185698784 X:2214779-2214801 ACAGGCAGCAGGTCTGAAACTGG - Intergenic
1185966852 X:4615279-4615301 ATAGATGGCATTTCTGAAATTGG - Intergenic
1186786654 X:12962281-12962303 AAAGCCAGCATGGCTGAAGCAGG - Intergenic
1189874329 X:45420279-45420301 TTAGATAGCATTTCTGAATCTGG - Intergenic
1192452078 X:71250952-71250974 AGAGATGGCATAGCTGAAACAGG + Intronic
1194149872 X:90310371-90310393 AAAAACAGATTGTCTGAAACTGG - Intergenic
1197415386 X:126166475-126166497 AAACAACGCATGTCTGATACTGG - Intergenic
1197914737 X:131522238-131522260 AAATATGGGATGCCTGAAACAGG - Intergenic
1198628942 X:138613158-138613180 AAAGAAAACATGTATGAAGCAGG + Intergenic
1198644878 X:138795475-138795497 ATAGATAGCAGGTCTGGGACAGG + Intronic
1199704142 X:150409485-150409507 AAGTATTGCATGTCTGAAAAAGG + Intronic