ID: 1015210663

View in Genome Browser
Species Human (GRCh38)
Location 6:130694865-130694887
Sequence ATGGAGAAGCAGCAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015210660_1015210663 -7 Left 1015210660 6:130694849-130694871 CCAGCCAAGGAGAAACATGGAGA No data
Right 1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG No data
1015210659_1015210663 -6 Left 1015210659 6:130694848-130694870 CCCAGCCAAGGAGAAACATGGAG No data
Right 1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015210663 Original CRISPR ATGGAGAAGCAGCAGCAGGA AGG Intergenic
No off target data available for this crispr