ID: 1015213157

View in Genome Browser
Species Human (GRCh38)
Location 6:130720783-130720805
Sequence CCTCGCACAGAGAAGTCGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015213152_1015213157 13 Left 1015213152 6:130720747-130720769 CCACTCTCATCGCTTACACTGAC No data
Right 1015213157 6:130720783-130720805 CCTCGCACAGAGAAGTCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015213157 Original CRISPR CCTCGCACAGAGAAGTCGAC TGG Intergenic
No off target data available for this crispr