ID: 1015217560

View in Genome Browser
Species Human (GRCh38)
Location 6:130767641-130767663
Sequence CCTTCCAAAGAATCCACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015217555_1015217560 4 Left 1015217555 6:130767614-130767636 CCCTGAAAATTTGGTACACTCAG No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data
1015217552_1015217560 27 Left 1015217552 6:130767591-130767613 CCCTGTACTGGTTTTGGAAGTAG No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data
1015217551_1015217560 28 Left 1015217551 6:130767590-130767612 CCCCTGTACTGGTTTTGGAAGTA No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data
1015217556_1015217560 3 Left 1015217556 6:130767615-130767637 CCTGAAAATTTGGTACACTCAGA No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data
1015217550_1015217560 29 Left 1015217550 6:130767589-130767611 CCCCCTGTACTGGTTTTGGAAGT No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data
1015217553_1015217560 26 Left 1015217553 6:130767592-130767614 CCTGTACTGGTTTTGGAAGTAGC No data
Right 1015217560 6:130767641-130767663 CCTTCCAAAGAATCCACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015217560 Original CRISPR CCTTCCAAAGAATCCACTGT GGG Intergenic