ID: 1015218769

View in Genome Browser
Species Human (GRCh38)
Location 6:130780624-130780646
Sequence CAGTGTGACCTATAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015218765_1015218769 18 Left 1015218765 6:130780583-130780605 CCTGGCTGAGTGCAAAAGAGAAT No data
Right 1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015218769 Original CRISPR CAGTGTGACCTATAGGAAGA TGG Intergenic
No off target data available for this crispr