ID: 1015219486

View in Genome Browser
Species Human (GRCh38)
Location 6:130787868-130787890
Sequence CTGCATATCAATAAATAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015219477_1015219486 19 Left 1015219477 6:130787826-130787848 CCTCCTCCCTTCCCCTGGTTACT No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219483_1015219486 6 Left 1015219483 6:130787839-130787861 CCTGGTTACTCTCACACAATCTA No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219479_1015219486 13 Left 1015219479 6:130787832-130787854 CCCTTCCCCTGGTTACTCTCACA No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219478_1015219486 16 Left 1015219478 6:130787829-130787851 CCTCCCTTCCCCTGGTTACTCTC No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219481_1015219486 8 Left 1015219481 6:130787837-130787859 CCCCTGGTTACTCTCACACAATC No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219482_1015219486 7 Left 1015219482 6:130787838-130787860 CCCTGGTTACTCTCACACAATCT No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data
1015219480_1015219486 12 Left 1015219480 6:130787833-130787855 CCTTCCCCTGGTTACTCTCACAC No data
Right 1015219486 6:130787868-130787890 CTGCATATCAATAAATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015219486 Original CRISPR CTGCATATCAATAAATAGAA GGG Intergenic
No off target data available for this crispr