ID: 1015225190

View in Genome Browser
Species Human (GRCh38)
Location 6:130849617-130849639
Sequence CTGAATAGGAAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 7, 2: 18, 3: 83, 4: 586}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015225185_1015225190 26 Left 1015225185 6:130849568-130849590 CCATCATGCGTCCATTCAACTAA 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG 0: 1
1: 7
2: 18
3: 83
4: 586
1015225186_1015225190 15 Left 1015225186 6:130849579-130849601 CCATTCAACTAATCTCTATAAGA 0: 1
1: 0
2: 1
3: 13
4: 268
Right 1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG 0: 1
1: 7
2: 18
3: 83
4: 586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015225190 Original CRISPR CTGAATAGGAAAATGGACAA AGG Intronic
900698749 1:4030272-4030294 CTGAAAAGGAAAATGGAAACAGG - Intergenic
900961098 1:5920654-5920676 CAGAAAAGAAAAATGGGCAAAGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
905174898 1:36129099-36129121 CACAATAGGAAAATGGAAGAGGG - Intergenic
905459106 1:38110244-38110266 CTCATTAGAAAAATGGGCAAAGG + Intergenic
906664618 1:47611238-47611260 CTCAATAGAAAAATTGGCAAAGG + Intergenic
906699361 1:47846733-47846755 TTGAGTTGGAACATGGACAATGG + Intronic
906760827 1:48376385-48376407 TGAAATAGGAAAATGTACAAGGG - Intronic
907531062 1:55097511-55097533 CAGAATATGAAAATTGAAAAAGG + Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909128145 1:71701400-71701422 CTGGTTTGGAAAATGGAGAAAGG - Intronic
909817848 1:80018772-80018794 CACAATAGGAATATGGTCAATGG - Intergenic
910175266 1:84423479-84423501 AGGAATAGGAATAAGGACAATGG - Intergenic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
911846236 1:102754767-102754789 CCAAATAGAAAAATGCACAATGG + Intergenic
912275071 1:108247610-108247632 CTGAATTGGAAAATGTGGAAAGG - Intergenic
912293151 1:108446741-108446763 CTGAATTGGAAAATGTGGAAAGG + Intronic
913050398 1:115112578-115112600 CTGAATAGGCAAATGCCCAGAGG - Intergenic
913479224 1:119269838-119269860 GTGACAAGGAAAATGAACAAAGG + Intergenic
914325340 1:146609442-146609464 CACAATAGAAAAATGGGCAAAGG - Intergenic
916193991 1:162206211-162206233 CTGGAAAGGAAAATGGACTGGGG + Intronic
916402725 1:164466567-164466589 CTGAATAGGCAAATAAACAGTGG - Intergenic
916803161 1:168233114-168233136 CTGGATAGGGAATGGGACAACGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919286782 1:195573604-195573626 CCCAATTGGAAAATGGGCAAAGG + Intergenic
919306856 1:195851957-195851979 CTTGCTAGGAACATGGACAAAGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919512563 1:198483992-198484014 CAGAATAGGAAAATCTGCAAAGG - Intergenic
919525926 1:198650373-198650395 CTGAATGGGAGGATGGAGAAAGG + Intronic
919687167 1:200494744-200494766 CCTAATAGGAAAATAGAAAAGGG + Intergenic
919736358 1:200954487-200954509 TTCAATAGGACAATGGGCAAAGG - Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922392074 1:225154951-225154973 ATCAACAGGAAAATGGGCAAAGG + Intronic
922655265 1:227376773-227376795 CTCAATTTGAAAATGGGCAAAGG - Intergenic
922988368 1:229884383-229884405 CTGAATCAGAAAATTCACAAGGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923760564 1:236839348-236839370 CCCAGTAGGAAAATGGACAAAGG + Intronic
924209908 1:241754067-241754089 CAGATTAGAAAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924379113 1:243445446-243445468 ATGAAAAGGAAAATATACAATGG + Intronic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065198752 10:23293390-23293412 CTCATTAGCAAAATGAACAAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067457293 10:46428059-46428081 CTGAAAAAGAAAATGGCCAATGG + Intergenic
1067629909 10:47956579-47956601 CTGAAAAAGAAAATGGCCAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069320504 10:67165564-67165586 CTATATAGGAAACTGGGCAAAGG + Intronic
1069644253 10:69980772-69980794 CTGAATAAGAAATTCAACAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070058485 10:72957881-72957903 CCCAATTGAAAAATGGACAAAGG - Intergenic
1070082067 10:73198824-73198846 TTCAATTGAAAAATGGACAAAGG + Intronic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1071128410 10:82363170-82363192 CTCAATAGGGAAATTGACAAAGG + Intronic
1071155342 10:82681992-82682014 CTGAATAGAACACTGGGCAAGGG + Intronic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1072546548 10:96443993-96444015 CCCAATAGGAAAATGGGCACAGG + Intronic
1073630961 10:105148703-105148725 CTCAATAGGAAAACCCACAAGGG - Intronic
1073723381 10:106200994-106201016 CTGAACAGAAAAATGATCAAAGG - Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074411919 10:113235839-113235861 TTGTGTAGGAATATGGACAATGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075334636 10:121599372-121599394 GTGAAAAGGTAAATGGACATAGG - Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1078106352 11:8360426-8360448 TTGTATTGGACAATGGACAATGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078717321 11:13852497-13852519 CTAAGTAGGAAGATGTACAAAGG - Intergenic
1078887390 11:15517476-15517498 CTGAATTGGAAAATGCCCCAAGG + Intergenic
1079176850 11:18150076-18150098 CTGAAGAGGAGAATGGAGATTGG + Intronic
1079259713 11:18866719-18866741 CTGAAAAGGAAAATGGATATGGG - Intergenic
1080427192 11:32166804-32166826 TTGAATGAGAAAATGGACAGAGG + Intergenic
1081763572 11:45593724-45593746 CTCAATAGGAATATGGGCAATGG + Intergenic
1082740618 11:56906975-56906997 CTGAGTAAGAACATGGGCAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083698814 11:64460662-64460684 GAAAATGGGAAAATGGACAAAGG - Intergenic
1084576362 11:69990789-69990811 CTCAATTAGAAAATAGACAAAGG - Intergenic
1085021151 11:73209309-73209331 CTTAATAGAAAAATGGCTAAAGG + Intergenic
1085330773 11:75648754-75648776 CTGAATAGGACAATGGGAAAGGG + Intronic
1085444416 11:76590830-76590852 CTGAAGAAGAAAAGGGTCAAGGG + Intergenic
1085453414 11:76652209-76652231 CTCAGTAGAAAAATGGGCAAAGG + Intergenic
1085787381 11:79465697-79465719 ATTAGTAGGAAAATGGACAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086527919 11:87750717-87750739 CTGGGTGGGAAAATGGCCAATGG + Intergenic
1086578519 11:88368989-88369011 CTGAGTAGGAACATGGTCCATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087107824 11:94429012-94429034 CTGCATCAGAAAATGGGCAAAGG + Intronic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088849914 11:113696087-113696109 CTGAATGGGAAAATGGAAGTAGG - Intronic
1089318276 11:117606894-117606916 TTGGATAGGAAACTAGACAAGGG + Intronic
1089751986 11:120658676-120658698 TCCAATAGGAAAATGGGCAAAGG - Intronic
1090475356 11:127015239-127015261 CTGGATAGGAAGATGGAAAGAGG - Intergenic
1090834182 11:130441894-130441916 CAGAATGGGAAAATGAAAAATGG + Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091314138 11:134598776-134598798 TTCAATAGGAAAATCCACAATGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092246892 12:6868698-6868720 CTGGGCTGGAAAATGGACAAAGG + Intronic
1092633206 12:10408328-10408350 CTGAATAGAAGAATGCAGAAAGG - Exonic
1093476487 12:19560766-19560788 GTTAATGGAAAAATGGACAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093618938 12:21264367-21264389 GTTAACAGGAAAATGGTCAAAGG - Intergenic
1095560359 12:43557384-43557406 AAGAATGAGAAAATGGACAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096095866 12:48935272-48935294 CTGAAAAGGAAAATTGGCAGGGG + Intronic
1096542423 12:52315273-52315295 CTGAAAAGGAAAATGTAGACTGG - Intronic
1096937514 12:55298804-55298826 CTCAATTAGAAAATGGGCAAAGG - Intergenic
1097395436 12:59067566-59067588 CTGATTTGGAAAATGGGAAAAGG + Intergenic
1098967894 12:76812693-76812715 CAAAATGGGAAAATGGAAAAAGG - Intronic
1099552672 12:84067784-84067806 CTGAATGGGAAACTTGAGAATGG + Intergenic
1099572540 12:84342240-84342262 TTGAATAGGTAAATAGATAAGGG - Intergenic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1100584273 12:95964970-95964992 GTGAATAGGAAATTGCAAAATGG + Intronic
1101383273 12:104232979-104233001 CTAAATAGGTAAATGCACAATGG + Intronic
1101711812 12:107274765-107274787 CTGAAAAGGAAAATGGTGCATGG - Intergenic
1102968116 12:117144379-117144401 CTGATGAGGAACATGGACAGTGG + Intronic
1104047121 12:125171264-125171286 CAAATTAGGAAAATGGACAATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104235558 12:126932315-126932337 CTGAAAAGGAAAATGAACCTGGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104359818 12:128122046-128122068 CTGAGTAGTAAAATGGAAAGAGG - Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1105365726 13:19762750-19762772 ATGAGTCAGAAAATGGACAAAGG - Intronic
1105484491 13:20813363-20813385 CCCATTAGGAAAATGGGCAAGGG + Intronic
1106645209 13:31626728-31626750 CTAAATAGCAAAATGAATAAAGG - Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107085983 13:36428699-36428721 CTGAATTGTAATTTGGACAAGGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109224630 13:59677845-59677867 GTGAATGGCAAAATAGACAAAGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1110595097 13:77311652-77311674 CTCAATAAGAAAATGGAGATGGG + Intronic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111116138 13:83780015-83780037 CTGCATAGGAAAAAGGAGATGGG - Intergenic
1111373056 13:87342364-87342386 CTGACTAGAAGAAAGGACAATGG - Intergenic
1111708271 13:91778693-91778715 CAGCAAATGAAAATGGACAAGGG - Intronic
1111785673 13:92783728-92783750 CACAGTAGGAAAATAGACAAGGG - Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112524403 13:100130398-100130420 CTGAATTGGAACCTGTACAAAGG + Intronic
1113272397 13:108687665-108687687 CACAATAGAAAAATGAACAAGGG + Intronic
1113294595 13:108944349-108944371 TTGAAGAGGAAAAGGGAAAAAGG + Intronic
1113417145 13:110137179-110137201 CTAATTAGGAATTTGGACAATGG + Intergenic
1114805474 14:25830779-25830801 CTGAAGGGGATTATGGACAATGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1115603485 14:34977899-34977921 CTAATTAGGAAAATGAAAAATGG + Intergenic
1116592608 14:46798225-46798247 CCGAGTAGGAAACTGGAAAAAGG - Intergenic
1117469952 14:56033518-56033540 CAGAATAGAAAAATTGATAATGG + Intergenic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119089527 14:71768052-71768074 TCCAATAGAAAAATGGACAAAGG + Intergenic
1119398020 14:74342590-74342612 TCCAATAGGAAAATGGGCAAAGG + Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121936923 14:98028349-98028371 ATGAATAGGAAAAAGGACTCAGG + Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1122434548 14:101685632-101685654 CCTGATATGAAAATGGACAAAGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124401163 15:29348706-29348728 CCCAGTAGGAAAATGGCCAAAGG + Intronic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124950657 15:34317136-34317158 CTGAATAGGATGATGGAAAGTGG - Intronic
1125072553 15:35573359-35573381 CAGAGTAGAAAAATGGACACTGG + Intergenic
1125131864 15:36291243-36291265 CTAAAGAGGAAAATGGACAGTGG + Intergenic
1125499414 15:40229820-40229842 CTTAATAGGAAAAAGGAAAGGGG + Intergenic
1126307343 15:47275043-47275065 GAGAGTAGGAAAATAGACAAAGG + Intronic
1126384434 15:48079329-48079351 CCCAATAAGAAAATAGACAAAGG + Intergenic
1127899305 15:63329477-63329499 CTGATTAGGAGAATGGGGAATGG - Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1129984609 15:79906786-79906808 AATAATAGGAAAATGGGCAAAGG + Intronic
1130178604 15:81601901-81601923 CTAAATAAGAACATGGAAAATGG + Intergenic
1130437258 15:83913646-83913668 ATAAATAGGAAAATGCAGAATGG + Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1132971668 16:2692253-2692275 CAGAACAGGAACTTGGACAAAGG - Intronic
1133333872 16:4994006-4994028 GCAAATAAGAAAATGGACAAAGG - Intronic
1133902570 16:9991120-9991142 ATTAAAAGGAAAATGGAAAAAGG + Intronic
1135408019 16:22212089-22212111 TTGATTAGCAAAATGCACAAGGG - Intronic
1135422068 16:22312047-22312069 CAGAATAGGCAAATGTACAGAGG + Intronic
1135475103 16:22767382-22767404 CCCAATAGAAAAATGGTCAATGG - Intergenic
1135785335 16:25343723-25343745 CCCAACAGGAAAATGGAAAAAGG - Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1136674503 16:31890700-31890722 CTGCATAGTAACATGGCCAAAGG + Intronic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137842030 16:51649654-51649676 CCGAATAGAAAAAAGGAGAATGG + Intergenic
1138018984 16:53459660-53459682 AAGAATAGGAAATTGGAAAATGG - Intronic
1138073341 16:54015890-54015912 CAGGATAGAAAAATGGCCAAGGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1139419576 16:66842253-66842275 CTGAAGAGGAAATGGGTCAATGG + Intronic
1139612973 16:68072224-68072246 TTGAACAGGAAATAGGACAAAGG - Intronic
1139656963 16:68394240-68394262 CTGATTTGGAAAATGGAAAATGG - Intronic
1140008221 16:71101505-71101527 CACAATAGAAAAATGGGCAAAGG + Intronic
1140974556 16:80046413-80046435 TAGAATAGGGTAATGGACAAAGG + Intergenic
1141770323 16:86085843-86085865 CAGGAAAGGAAAATGGATAAGGG - Intergenic
1142175841 16:88644859-88644881 CACAATAGAAAAATGGGCAAAGG + Intronic
1143089890 17:4443797-4443819 CCCAATAGAAAAATGGACAGTGG + Intronic
1143241753 17:5449352-5449374 CCCAGTAGAAAAATGGACAAAGG + Intronic
1143823271 17:9582476-9582498 CTCAATAGAAAAATGAGCAAAGG - Intronic
1144004271 17:11085994-11086016 CTGAAAAGGAATCTGGAGAATGG + Intergenic
1144570416 17:16394548-16394570 CACAATAGGAAAATGGACAAAGG + Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145362565 17:22224310-22224332 CACAATAGGAAAATGGACATAGG + Intergenic
1146152511 17:30487472-30487494 GACAGTAGGAAAATGGACAAAGG + Intronic
1146223186 17:31043949-31043971 TTCAACAGGAAAATGAACAAAGG + Intergenic
1146341809 17:32026037-32026059 TTCAACAGGAAAATGAACAAAGG - Intronic
1146350995 17:32093601-32093623 TTCAACAGGAAAATGAACAAAGG + Intergenic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146788509 17:35738203-35738225 CCCAATAGAAAAATGGGCAAAGG - Intronic
1146967148 17:37042004-37042026 CTCAAAAAGAAAATGGGCAAAGG - Intronic
1147535536 17:41319239-41319261 CCGAGTAGAAAAATTGACAATGG + Intergenic
1148173519 17:45544302-45544324 TTCAACAGGAAAATGAACAAAGG + Intergenic
1148275751 17:46301147-46301169 TTCAACAGGAAAATGAACAAAGG - Intronic
1148297861 17:46518723-46518745 TTCAACAGGAAAATGAACAAAGG - Intronic
1148362409 17:47023205-47023227 TTCAACAGGAAAATGAACAAAGG - Intronic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1149749047 17:59127914-59127936 CTGGATAAGAAAATGGAGTATGG + Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150232373 17:63563175-63563197 TGCAATAGAAAAATGGACAAAGG + Intronic
1150404726 17:64891217-64891239 TTCAACAGGAAAATGAACAAAGG + Intronic
1150896825 17:69221378-69221400 GTGAAGAGGAAAGTGGATAAAGG + Intronic
1150927415 17:69547596-69547618 CAGATTAGGAAGATGGACATAGG + Intergenic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1153359985 18:4183568-4183590 AAGAAAAGGAAAATGTACAAAGG - Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153884520 18:9451627-9451649 CTGATTAGGAAGGTGCACAAAGG + Intergenic
1154227461 18:12519643-12519665 CTCATTAGAAAAATGAACAAAGG + Intronic
1155424145 18:25688515-25688537 CTCATTGGGAAAATGGAAAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155615730 18:27719056-27719078 CTGAATAAGAAACTGGAGATTGG - Intergenic
1156077004 18:33291197-33291219 CACAAAAGGAAAATGCACAAAGG + Intronic
1156159645 18:34343945-34343967 CTCAAGAGTTAAATGGACAATGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1157404514 18:47411754-47411776 TGGAATAGGAAACTGGAGAAAGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158343818 18:56494384-56494406 CAGAATAGGAAAATGAACAGAGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159899593 18:74033335-74033357 CTTAATAGGAAAATGGGCAAAGG + Intergenic
1160480346 18:79234333-79234355 CGGAATGGGAAAAAGGTCAACGG - Intronic
1161042821 19:2119071-2119093 CAGAAGAGGAAAAAGGACAACGG + Intronic
1164735390 19:30537262-30537284 CTGGGGAGGAAAATGGACATTGG - Intronic
1166579090 19:43877013-43877035 CGGAATAGAAAAAAGGACAGTGG + Intronic
1166864228 19:45826374-45826396 CTGAGGAGGAAGATGGAGAAGGG + Intronic
1167527278 19:49992686-49992708 CTTAGTAGGAAAATGGACAAAGG - Intronic
1167580642 19:50339834-50339856 CTCATTAGGAAAATGGACAAAGG + Intronic
1167983393 19:53295156-53295178 CTAAATAGGTAAAGGCACAATGG + Intergenic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
926097334 2:10090483-10090505 CTGAAGAAGAAAAAGAACAAGGG - Intergenic
926160027 2:10481357-10481379 CCAAATAGGAAGAGGGACAAGGG + Intergenic
926436192 2:12840556-12840578 CTGCATGGGAGAAAGGACAAAGG - Intergenic
926667036 2:15536955-15536977 CTGATTAGGCAAATGGAAACTGG - Intronic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928034732 2:27811383-27811405 CTGAATAAGAAAGTGTACAGTGG + Intronic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929821705 2:45279382-45279404 CCCAAAAGAAAAATGGACAAAGG - Intergenic
929891786 2:45924368-45924390 TTGAATAGGAAAATGAAGGATGG + Intronic
930083836 2:47478095-47478117 TTCAATAGAAAAATGGGCAAGGG - Intronic
930698575 2:54436517-54436539 CTCTATAGGAAAATAGGCAAAGG + Intergenic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
931957377 2:67442549-67442571 TTTGATAGAAAAATGGACAAGGG + Intergenic
932118693 2:69078126-69078148 CTGAATAGTAAACAGGACACTGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932931017 2:76038815-76038837 CACAATAGGAAAAAGGGCAAAGG + Intergenic
933161587 2:79029993-79030015 TTGATGAAGAAAATGGACAATGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
933593008 2:84253392-84253414 CACAGTAGGAAAATGAACAAAGG - Intergenic
933808935 2:86020144-86020166 CCCAATAGAAAAATGGGCAAAGG + Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
934522474 2:95027895-95027917 CCCAATTAGAAAATGGACAATGG + Intronic
935012280 2:99146308-99146330 CCCAATAGAAAAATGGGCAAAGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
936607757 2:113975096-113975118 CTGAATAGGAGTAGGAACAAAGG + Intergenic
937039771 2:118812293-118812315 CCGAACAGAAAAATTGACAAAGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938640504 2:133273363-133273385 CCCAATGTGAAAATGGACAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939299709 2:140319817-140319839 CTGACTGGGAGAATGGATAAAGG + Intronic
939340665 2:140892390-140892412 CTTAATAGGAGAATGACCAAAGG + Intronic
939385789 2:141495359-141495381 ATGAGCAGGAAAATGGTCAACGG + Intronic
939483385 2:142778007-142778029 CTAAATGGGAAAATGGTTAAGGG - Intergenic
939632550 2:144542950-144542972 CAGAATAGGCAAATTTACAAAGG - Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
941269003 2:163401815-163401837 CTGAATAGGGACAAAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942242862 2:173979561-173979583 CTCAATAGAAAATTGGATAAAGG - Intergenic
942657287 2:178227121-178227143 CCCACTAGAAAAATGGACAAAGG + Intronic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
944122451 2:196254903-196254925 CCCAATAGAAAAATGGATAAAGG - Intronic
944588826 2:201198175-201198197 CCGAATTAGAAAATGAACAAAGG - Intronic
945456066 2:210053907-210053929 CTCAACAGAAAAATGGGCAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945602397 2:211884388-211884410 CTGACTATGAAAATGTACCACGG + Intronic
945819342 2:214644606-214644628 CTCAATTGAAAAATGGGCAAAGG - Intergenic
945907552 2:215612352-215612374 CTGATGAGGAAAAGGCACAAGGG + Intergenic
946611027 2:221458108-221458130 CTGAAGAGTAAAATGGTCAAGGG - Intronic
946684045 2:222249391-222249413 CTGAAGATGAAAATGGGAAAAGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946880731 2:224174981-224175003 CGAAATAGGAAAATGCAAAAAGG + Intergenic
946930871 2:224669099-224669121 CTGAATATGAAACTGGGGAAAGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947482646 2:230515317-230515339 CAGAACAGGAAAAAGGCCAAAGG - Intronic
947772241 2:232679765-232679787 CTGAATAGAAACGTGGGCAAAGG + Intronic
948269616 2:236664298-236664320 CTGAATTGGAAAAGGCACTAAGG + Intergenic
948589933 2:239042641-239042663 TTGAAAAGGAACATGGCCAAAGG - Intergenic
948923557 2:241079465-241079487 TTGTGTAGGAAAATGGAGAAGGG + Intronic
1168940248 20:1705109-1705131 CTGATAAGGAAAATACACAATGG + Intergenic
1169323218 20:4652634-4652656 CAGAATAGTATAATGGATAATGG - Intergenic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1169965967 20:11217789-11217811 CTGAATACGAAAATAGAACAAGG - Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171498640 20:25576120-25576142 CTGAATTGGAAACTGGACTGGGG - Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172651800 20:36508388-36508410 ATCAGTAGGAAAATGGTCAAAGG - Intronic
1172782082 20:37442867-37442889 CTGGAGAGGAAAAAGGACATGGG - Intergenic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1174994855 20:55554849-55554871 CTGAATAGAAAAATGTAATAAGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177256256 21:18666607-18666629 CTTATTAGAAAAATAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1177883853 21:26725023-26725045 CAGAGTGGTAAAATGGACAATGG - Intergenic
1178227479 21:30739766-30739788 CTCAATGGAAAAATGGGCAAAGG + Intergenic
1178251206 21:31004841-31004863 CTGAATGAGATAATGGAGAAAGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178376265 21:32070097-32070119 CCTAATGGGAAAATGGAGAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179401288 21:41086421-41086443 CTGGAACGGACAATGGACAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1180910400 22:19446150-19446172 CAGAATGGAAAAATGGCCAAAGG - Intronic
1181373803 22:22440317-22440339 GTGAAGAAGAAAATAGACAAAGG + Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1183015963 22:34986952-34986974 CTGCATAGGAAGTTGGACACTGG + Intergenic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
949354440 3:3163324-3163346 CTGAATATGAAAATAACCAAGGG + Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951364778 3:21768179-21768201 TTGATTATGAAAAAGGACAAAGG + Intronic
951616648 3:24554345-24554367 CTTAATAGGAAAAAAGATAATGG - Intergenic
951872918 3:27385183-27385205 CTGAATGGGAAAATGGAGCAAGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953288572 3:41638285-41638307 CCCAAAGGGAAAATGGACAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
954288034 3:49632933-49632955 CTGAAAAACAAAATGGGCAAAGG + Intronic
954924744 3:54223429-54223451 CTGTATAGGAAAATGATAAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957276882 3:78101704-78101726 CTGAACAGGAAAATGAAAAATGG - Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
957941883 3:87016872-87016894 ATTAATAGGAAAATTGACAGGGG - Intergenic
957946594 3:87070877-87070899 ATGAATAAGAGAATGGATAATGG - Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
959687267 3:109161216-109161238 CTGAATAGGAAATGGGATGAAGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960927613 3:122811217-122811239 CTCAATAGGAAAATAGGTAATGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961315217 3:126030349-126030371 CTAACTAGAAAAATGCACAAGGG + Intronic
961499901 3:127324778-127324800 CCAAATAGGAAAATGGCCAAAGG + Intergenic
961700012 3:128736318-128736340 CTGAATGATAAAATGTACAAAGG - Intronic
961709468 3:128816456-128816478 CTAAATAGGAATATAGAAAAAGG - Intergenic
961988762 3:131165584-131165606 TTGGGTAGGAAAAGGGACAAGGG + Intronic
962113703 3:132478296-132478318 ATGAATAGGAAAATGAATAATGG + Intronic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
963254209 3:143128649-143128671 TTGAATAGGAAAATGTATTACGG + Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964246757 3:154662768-154662790 CTGATTAGGAAAATAGTAAAAGG - Intergenic
964260686 3:154832842-154832864 CTGGATAGGAAAAAGGGCAAAGG - Intergenic
964823887 3:160804607-160804629 CTAAATAAGAAAATGAGCAATGG - Intronic
965924709 3:173963585-173963607 CTGAGAAGAAAAAAGGACAAAGG + Intronic
966178186 3:177162344-177162366 CTGACTGGAAGAATGGACAAGGG + Intronic
966479870 3:180394948-180394970 ATCAATGGGAAAATGGACAAAGG + Intergenic
966903187 3:184502118-184502140 CTCAGGAGAAAAATGGACAAAGG + Intronic
966946684 3:184781762-184781784 CACAACTGGAAAATGGACAAAGG + Intergenic
967172981 3:186838184-186838206 TTCAATTAGAAAATGGACAAAGG - Intergenic
967672498 3:192254558-192254580 CTATGTAGGAAAATGTACAAAGG + Intronic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
968773991 4:2528093-2528115 CCCAATTTGAAAATGGACAAAGG + Intronic
968993880 4:3933268-3933290 ATGAGTAGCAAAATGGACATTGG + Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
970765174 4:19539524-19539546 ACGAATAAGAAAATGAACAAAGG - Intergenic
971097944 4:23429270-23429292 CTAAATAGGAAAAAGGAAATTGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971423432 4:26493916-26493938 CAGAATAGGAAAAAGGGAAAGGG - Intergenic
971682333 4:29716733-29716755 GTGAAGAGGATAATGGACATAGG - Intergenic
971715373 4:30168642-30168664 ATGAATAAGATAATGAACAAGGG + Intergenic
971771216 4:30899402-30899424 CTAGATAGGAAATTAGACAAGGG - Intronic
972751449 4:41993443-41993465 TCCAGTAGGAAAATGGACAAAGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832760 4:54778716-54778738 CAGAACTGGAAACTGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
974256097 4:59457615-59457637 CTGAAGAGGACAGTGGCCAAAGG - Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974993154 4:69119371-69119393 CTTGATAGGAAAATTGTCAATGG - Intronic
975216688 4:71763599-71763621 ATGAATAGGAAACTGAACACTGG + Intronic
976443122 4:85099420-85099442 TTCAATTAGAAAATGGACAAAGG - Intergenic
976482758 4:85563741-85563763 TGGAGTTGGAAAATGGACAAAGG + Intronic
976868694 4:89763856-89763878 TTGAATAAGAATATGTACAAGGG - Intronic
977326792 4:95584139-95584161 CTGAATAAGAAATTCAACAAAGG - Intergenic
977770433 4:100851340-100851362 CTAAAGAGGAATATGGAAAAAGG + Intronic
977874373 4:102131213-102131235 CCGAATATGAAAATTCACAATGG - Intergenic
977902213 4:102435809-102435831 CCCAATATGAAAATGGGCAAAGG + Intergenic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978236279 4:106464955-106464977 CTGAATTGGACAGTAGACAAAGG + Intergenic
979124601 4:116952464-116952486 TTGAATAGGAAAAGGAATAAAGG + Intergenic
979435787 4:120688304-120688326 CCCAATTGAAAAATGGACAAAGG - Intronic
979546037 4:121941067-121941089 GGGAATAAGAAAATGAACAATGG + Intronic
981015572 4:139970484-139970506 CTTAAGAGGAAAATGGAGCATGG + Intronic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981305537 4:143243318-143243340 CCCAATAGAAAAATGGGCAAGGG - Intergenic
981341630 4:143628297-143628319 ATGAAGAGGACAATAGACAAGGG + Intronic
981528195 4:145728783-145728805 CCTAGTAGGAAAATGGATAAAGG - Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982109277 4:152039062-152039084 AAGAGTAGGAAAATGGTCAAAGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982548454 4:156764911-156764933 CTGAATGGGAAAATGCATACAGG - Intronic
983758620 4:171375992-171376014 CTGATTAAGTAAATGGACACTGG + Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985276136 4:188239749-188239771 ACCAATAGGAAAATGGGCAAAGG - Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
985558634 5:570362-570384 CAGACCAGGAAAATGGGCAAGGG - Intergenic
986180454 5:5388436-5388458 CCCAAAAGGAAAATGGACAAAGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987048645 5:14130720-14130742 CTGAAAGAGAAAAGGGACAATGG + Intergenic
987222089 5:15801295-15801317 CTTAGTAGGATAAAGGACAATGG + Intronic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989632502 5:43500278-43500300 CCTAATAGAAAAATGGGCAAAGG - Intronic
989807598 5:45629206-45629228 CTGAAAGGGGAAATGGAGAAAGG + Intronic
990327540 5:54693189-54693211 TTCAATAGAAAAATGGGCAATGG + Intergenic
990550415 5:56871036-56871058 ATAAATAGTACAATGGACAAAGG - Intronic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
991188660 5:63841960-63841982 CTGAATAAGATAATTGATAATGG + Intergenic
991250481 5:64555084-64555106 CAGAACAGGAAAATAGACAATGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
992252412 5:74888532-74888554 CCCAATAGAAAAATGGGCAAAGG - Intergenic
992758740 5:79933214-79933236 CTTCAGAGGCAAATGGACAATGG + Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993172243 5:84433686-84433708 CTGATTAGGAAACTGGACAATGG + Intergenic
993366806 5:87043592-87043614 CTGAAAAGAAAAATGAACAGAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995501424 5:112811157-112811179 TTGGATAGGAAAAAGGACAGTGG + Intronic
996446557 5:123560042-123560064 CCCAATTGAAAAATGGACAAAGG + Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997050575 5:130374942-130374964 CTGATTAGGAAAATAGTCGAGGG - Intergenic
997090568 5:130851669-130851691 CTCAATAGAAATATGGGCAAAGG - Intergenic
998473623 5:142402736-142402758 CCCAATAGGAAAATGAATAAAGG - Intergenic
999004039 5:147956321-147956343 CTGAATGAGAAAAGGAACAAGGG + Intergenic
999333729 5:150696976-150696998 CTAAATAGGAAAGAGGAGAAGGG - Intronic
999634506 5:153606938-153606960 CTGAATACCAAATTGAACAAGGG - Intronic
1000036025 5:157448494-157448516 CAGAAGAGGAAAATCAACAAAGG - Intronic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1000934850 5:167295063-167295085 ATGAATAGGGAAATAAACAAAGG + Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002627833 5:180544143-180544165 ATCAACAGGAAAATGAACAATGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003869223 6:10388815-10388837 CTGAATCTGAAAGTGGACCAAGG + Intergenic
1004047012 6:12035932-12035954 TACAATAGGTAAATGGACAAAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004362176 6:14980985-14981007 ATCAATAGGAAAATAGACACTGG + Intergenic
1005108482 6:22251630-22251652 CTGACTTGGAAATTGGAGAAAGG + Intergenic
1005152770 6:22771884-22771906 CCGAAGATGAAAATGAACAAAGG + Intergenic
1005176279 6:23048192-23048214 CTGCCTAGGAAGATGAACAAAGG - Intergenic
1005914904 6:30343395-30343417 CTGAAAAGGGAAATGGCAAAGGG - Exonic
1008757303 6:54811528-54811550 CTGATTAAGACAATGGGCAAAGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009370381 6:62893558-62893580 CACAATAGGAAAATGAAAAAAGG + Intergenic
1010766955 6:79786731-79786753 CCTCATAGGAAAATGGGCAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012721102 6:102746746-102746768 CTGAATAGGATAATGACCTATGG - Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013731859 6:113177488-113177510 CAGAATAGTATAATGGACATTGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015214539 6:130734708-130734730 CTGGAAGGGAAAATGGACTAGGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015381015 6:132569225-132569247 ATGAACAGGAAACTGGAAAATGG - Intergenic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016554473 6:145320295-145320317 TTCAATAGAAAAATGGACAGTGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016941894 6:149489262-149489284 CAGAATAGGAAAATGGGCAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017349934 6:153428024-153428046 CTGGATATGTGAATGGACAATGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017765023 6:157599964-157599986 TTGTATAGGAAAATGGGCCAAGG + Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019986003 7:4656421-4656443 CTGGATAGGAAAAGGGGGAAGGG - Intergenic
1020853159 7:13382905-13382927 CTGTACAGCAAAATGGACCACGG - Intergenic
1020917839 7:14218972-14218994 CAGAATAGGAAAATCTACAGAGG - Intronic
1021035882 7:15797621-15797643 CTGAAGAGAAAAATTGAAAAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021596387 7:22321687-22321709 CAGAATAGGAAAAGGGACAGTGG - Intronic
1021683324 7:23156755-23156777 CTGAATATGAAAATGCACCCAGG - Intronic
1021775111 7:24046486-24046508 TTCAATGGAAAAATGGACAAAGG + Intergenic
1022637094 7:32146449-32146471 CTAACTAGGAAAATGGAGGAAGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1022872705 7:34495999-34496021 CTGATTAGAAAAGTGGACAGGGG - Intergenic
1023677685 7:42647621-42647643 ATGATTAGGAAAATGGACATTGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1025074298 7:55929237-55929259 CTGAAAAGGAAAATCGATGAGGG + Intronic
1025195696 7:56930874-56930896 CTGAATTAGAATATGGGCAAAGG - Intergenic
1025676253 7:63646065-63646087 CTGAATTAGAATATGGGCAAAGG + Intergenic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026612287 7:71870717-71870739 CTGAGGAGGAAAATGGATCAAGG + Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1028138931 7:87250765-87250787 GTCAATAGCAAAATGGGCAAAGG - Intergenic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029673947 7:102053263-102053285 CTGAATTAGAATATGGGCAAAGG - Intronic
1030258595 7:107539478-107539500 CTGAATAGGGAAATCCAAAAAGG + Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1030995819 7:116357236-116357258 CAGAATAGGACAATGGACAGTGG + Intronic
1031106781 7:117553743-117553765 CTCATTAGGAAAATGTACAAAGG + Intronic
1031346807 7:120676834-120676856 CTGGATAGGAAAAAGAAAAAAGG + Intronic
1031586527 7:123537092-123537114 ATGAAAAGGAAAATGGAAAATGG - Exonic
1031651157 7:124291364-124291386 CTCAATTAGAAAATGGCCAAAGG - Intergenic
1032180028 7:129667424-129667446 CTGAGTTGGGAAATGGGCAAAGG - Intronic
1032241849 7:130167490-130167512 TTTATTAGAAAAATGGACAAAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1032692701 7:134304919-134304941 GAGAATAGGAACATGGGCAAGGG + Intronic
1032766926 7:135002885-135002907 ATCAATAGCAAAATGGGCAAAGG - Intronic
1033210549 7:139457123-139457145 GTGCATAGGAAAATGGAGAGTGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035079368 7:156203399-156203421 TTGAATAGTAAAACAGACAATGG - Intergenic
1035160673 7:156948380-156948402 CCTATAAGGAAAATGGACAAAGG + Intergenic
1037197581 8:16209969-16209991 CTGATAAGGAAAATGGACTCAGG + Intronic
1037346919 8:17910598-17910620 CAGAAAATGAAAACGGACAACGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039012696 8:33112022-33112044 CTGGAAAGGAAAATGGCCAAAGG + Intergenic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039359521 8:36860776-36860798 CTGAAAAGGAAATTGGAAAGAGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041435416 8:57834562-57834584 CAGAATAGAAAAATCTACAAAGG + Intergenic
1041448544 8:57981565-57981587 CTTATTAGTAAAATTGACAAGGG - Intergenic
1041532862 8:58891311-58891333 CTAAATAGGAAAAAGAAAAAAGG + Intronic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043953917 8:86340175-86340197 CTCAGTAAGAAAATGGACAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044687053 8:94836249-94836271 CTGACTAGAAAAAAGGGCAAAGG - Intronic
1044895433 8:96886597-96886619 CAGATTAGGAAAATTGACCAAGG + Intronic
1045029210 8:98118740-98118762 CACAATAGGAAACAGGACAAGGG - Intronic
1045141362 8:99287657-99287679 CACCATAGGAAAATGGCCAAAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045233913 8:100332813-100332835 CCTAATAGGAAAATGGGCAAAGG - Intronic
1045373873 8:101552168-101552190 CTGTGTAGGAAGGTGGACAAAGG + Intronic
1045887678 8:107118937-107118959 CTGTATGGGAAAATGGAAATGGG - Intergenic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1047104075 8:121713918-121713940 CTGCACAGGCAAATGGACAGAGG + Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1047766533 8:127994403-127994425 CATAACAGGAAAGTGGACAAGGG - Intergenic
1047848856 8:128834323-128834345 CTGAATAAGAAAAGGGGTAAAGG + Intergenic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1048413864 8:134204570-134204592 CTCAATAGGAAAATGAGCACAGG - Intergenic
1048694364 8:137008568-137008590 CTTTATGGGATAATGGACAAAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048906600 8:139095108-139095130 ATGAACAGGGAAATAGACAATGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051530502 9:18097066-18097088 CTGACTAGGAAGGTGGACAAGGG - Intergenic
1051748029 9:20314149-20314171 CACAACAGGAAAATGGGCAAAGG + Intergenic
1052669661 9:31539815-31539837 CTGCATAGGAAAATTAAAAACGG - Intergenic
1052711462 9:32061656-32061678 CAGAATAGTATAATGGACATTGG - Intergenic
1052713422 9:32086186-32086208 CTTAATTGAAAAATGCACAAAGG + Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053195362 9:36113800-36113822 CCTAATAGAAAAATGGACCAAGG + Intronic
1053573280 9:39331881-39331903 CTGGATAGGAGAATGGGGAAGGG + Intergenic
1053624637 9:39856113-39856135 CTGTATAGGAGAATGGGGAAGGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053880233 9:42587115-42587137 CTGTATAGGAGAATGGGGAAGGG - Intergenic
1053892431 9:42707211-42707233 CTGTATAGGAGAATGGGGAAGGG + Intergenic
1054094850 9:60890587-60890609 CTGGATAGGAGAATGGGGAAGGG + Intergenic
1054116317 9:61166491-61166513 CTGGATAGGAGAATGGGGAAGGG + Intergenic
1054123864 9:61287130-61287152 CTGGATAGGAGAATGGGGAAGGG - Intergenic
1054219259 9:62394585-62394607 CTGTATAGGAGAATGGGGAAGGG - Intergenic
1054231455 9:62514588-62514610 CTGTATAGGAGAATGGGGAAGGG + Intergenic
1054591442 9:67016053-67016075 CTGGATAGGAGAATGGGGAAGGG - Intergenic
1055498923 9:76884087-76884109 CAGAATAGGCAAATGGAGAGAGG - Intronic
1055533587 9:77212946-77212968 CTGAAAAGGAAAAAAAACAATGG - Intronic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057561357 9:96130451-96130473 CTGAATAGGAAGATGGCGCATGG + Intergenic
1057979309 9:99642871-99642893 CTCAATTTGAAAATGGCCAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059533866 9:115063083-115063105 CTGAATAGTAAACTGGTCATAGG + Exonic
1059607968 9:115856842-115856864 CTGACTAGGAAGATGGACATTGG + Intergenic
1060179113 9:121520147-121520169 CAGAACAGGAAAAGGGTCAAAGG + Intergenic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061461338 9:130741858-130741880 CTGAAAAGGAAATTGGATGAGGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061755704 9:132810957-132810979 CTTAACTGGAAAATGGGCAAAGG + Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1186375772 X:8998034-8998056 CTGGAAAGGAAATAGGACAAGGG - Intergenic
1186801248 X:13094230-13094252 TTGACTAGGAAAAGGGAAAAAGG - Intergenic
1187105623 X:16238534-16238556 CTGACTAGGGAAATGGTGAATGG + Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188209945 X:27410366-27410388 CTGAAGAAGAATATGGCCAAAGG + Intergenic
1189417162 X:40825550-40825572 CTCAGTAGGACAAAGGACAATGG + Intergenic
1189448647 X:41105947-41105969 CTCAATTGAAAAATGGGCAAAGG - Intronic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189638370 X:43037945-43037967 CTGTATAGGAGGAAGGACAATGG - Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190487795 X:50945854-50945876 TTGAAGAGGATAATGGAGAAGGG - Intergenic
1190500267 X:51068918-51068940 TTGAATTGAAAAATGGGCAAGGG + Intergenic
1190751487 X:53365885-53365907 CCCAATAGGAAAATGGGCATAGG - Intergenic
1190871186 X:54426013-54426035 CCCAATAGAAAAATGGCCAAGGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1192281131 X:69687238-69687260 CTCAATTGAAAAATGGGCAAAGG - Intronic
1193860346 X:86658109-86658131 GTGAAGAGCAAAATGCACAATGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194247269 X:91531104-91531126 CTGAATAGGAAAAAAAAAAATGG - Intergenic
1194682461 X:96870641-96870663 ATCAATAGTAAAATGGCCAAAGG - Intronic
1195092953 X:101480712-101480734 CTGAATAGGAAAATACTCAAAGG + Intronic
1195271816 X:103239313-103239335 CTAAAGAGTAAAATGGACAAGGG - Intergenic
1195551848 X:106180435-106180457 AGGAGTAGGAAGATGGACAATGG - Intronic
1195888159 X:109663269-109663291 CTGTGGATGAAAATGGACAAAGG - Exonic
1196034540 X:111129881-111129903 AAGAAGAGGAAAATTGACAAAGG + Intronic
1196149231 X:112354061-112354083 CTAAATAGGACAATAGACTAAGG + Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1196779292 X:119368253-119368275 CCCAATAGGAAAATTGTCAAGGG - Intergenic
1197490696 X:127113393-127113415 CTCAACAGTAAAATGGACACAGG - Intergenic
1199223844 X:145348751-145348773 CTGCCGAGGAAAAGGGACAAAGG + Intergenic
1199800078 X:151241718-151241740 CTCAATAGAAATGTGGACAAAGG + Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201541747 Y:15112315-15112337 CAGAACATGAAAGTGGACAAGGG + Intergenic
1201584325 Y:15544399-15544421 ATGAACTGGACAATGGACAATGG + Intergenic