ID: 1015227063

View in Genome Browser
Species Human (GRCh38)
Location 6:130869851-130869873
Sequence ATACTCCTGTTCCTCCCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015227061_1015227063 -10 Left 1015227061 6:130869838-130869860 CCACCTCTTCTTCATACTCCTGT 0: 1
1: 0
2: 5
3: 153
4: 1453
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172
1015227060_1015227063 -7 Left 1015227060 6:130869835-130869857 CCTCCACCTCTTCTTCATACTCC 0: 1
1: 0
2: 6
3: 231
4: 2441
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172
1015227052_1015227063 28 Left 1015227052 6:130869800-130869822 CCTCTCTACTACCTTGGCTGCCG 0: 1
1: 0
2: 0
3: 3
4: 105
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172
1015227058_1015227063 17 Left 1015227058 6:130869811-130869833 CCTTGGCTGCCGGGCGGGGTTCT 0: 1
1: 0
2: 2
3: 6
4: 108
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172
1015227051_1015227063 29 Left 1015227051 6:130869799-130869821 CCCTCTCTACTACCTTGGCTGCC 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172
1015227059_1015227063 8 Left 1015227059 6:130869820-130869842 CCGGGCGGGGTTCTTCCTCCACC 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015227063 Original CRISPR ATACTCCTGTTCCTCCCTGA TGG Exonic
901535766 1:9882176-9882198 AAACTCCTGTTCATCCTTCAAGG - Intronic
903019846 1:20386365-20386387 GAACTCCTGTTCCTCCCTCCTGG + Intergenic
908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG + Intronic
908673680 1:66577199-66577221 ATATTTCTATTCCTCCATGAAGG + Intronic
909355749 1:74708017-74708039 AAACTCCTATTCATCCCTGAGGG - Intronic
911297452 1:96134760-96134782 CTGCTCCTGTTCCTTCCTGCAGG + Intergenic
911546908 1:99228090-99228112 GTACTCCTGTTCTTACCTGAGGG - Intergenic
915243690 1:154541655-154541677 CTACTTCTTTTCCTCCCTGCAGG + Intronic
916174896 1:162030114-162030136 AAACTCCTGCTCCTCCTGGAAGG - Intergenic
917964769 1:180171479-180171501 AGACTCCTGGTTCTTCCTGATGG - Intronic
919746702 1:201013465-201013487 ACAGTCCTTTTCCTCCCTGGGGG + Intronic
920116960 1:203628289-203628311 ACACTCCTCCACCTCCCTGAGGG + Intronic
920808908 1:209263675-209263697 ATACTCGTTTTCCTTCCTTAGGG + Intergenic
920998251 1:211015688-211015710 ATACTACTATACCTGCCTGAAGG - Intronic
1062814695 10:490928-490950 ATGCTTCTTTCCCTCCCTGAAGG + Intronic
1064312153 10:14221137-14221159 AAACTCAGGTTCCTCCTTGATGG + Intronic
1067079589 10:43205582-43205604 AAACTCCTCTTCCTCCTTGGAGG + Intronic
1070672361 10:78386985-78387007 ATATTCATGTTCCTCCTTCAAGG - Intergenic
1070742569 10:78912596-78912618 ATACTCGTACTCCTCCTTGAAGG + Intergenic
1071680264 10:87697718-87697740 ATAAACCTGTTCCTTCCTGCAGG + Intronic
1073029400 10:100513326-100513348 ATACTCCTGCTCCACTCTGTAGG - Intronic
1073248313 10:102106932-102106954 AGAGGCCTGTTCCTCCCTGGTGG + Intergenic
1075016123 10:118911025-118911047 ATACCCCAGATCCTCCCGGAGGG + Intergenic
1076192584 10:128493111-128493133 CAACTCCTGTTCTTCCCTGAAGG - Intergenic
1077502494 11:2915780-2915802 TTCCTCCTGTCTCTCCCTGAGGG + Intronic
1078672146 11:13375036-13375058 AAACTCGTGTTCATCCCTCAAGG + Intronic
1078844310 11:15107727-15107749 ATACCCATCTTTCTCCCTGAAGG + Intergenic
1078860301 11:15240479-15240501 TCACTGCTGTTCCTCTCTGATGG - Exonic
1080662325 11:34307222-34307244 ATGCTCCTAGTGCTCCCTGAAGG + Intronic
1084659170 11:70537071-70537093 ATGCTCCTTTTGCTCCCTCAGGG + Intronic
1086780310 11:90895899-90895921 ATTCTCCTGTTCCTACCCAAGGG + Intergenic
1087076116 11:94128697-94128719 ATTCTCCCGTCCCTCCCTGCCGG - Intergenic
1088819969 11:113448582-113448604 TTCCTCCTGTTCCTCTCTCATGG - Intronic
1089496603 11:118911298-118911320 ACACTCCTGATGCTCCCTGCGGG + Intronic
1095393693 12:41739667-41739689 ATTGTCCTGTAGCTCCCTGAGGG + Intergenic
1096165438 12:49419052-49419074 ATACTCCTGTTCCCCTCCCAAGG + Intronic
1096339669 12:50786856-50786878 ATACTCTTGTCCCTCCCCCAGGG - Intronic
1098517172 12:71390813-71390835 ATGCTCCTGTGCCTCACTGTGGG + Intronic
1103873418 12:124107564-124107586 AGATTCCAGTTCCTCCCTGTTGG + Intronic
1110322167 13:74172952-74172974 ATACGCCCGTACCTCTCTGAAGG + Intergenic
1110355403 13:74561465-74561487 CTGCTCCTTTTCCTCCCTGGAGG + Intergenic
1112211960 13:97386895-97386917 ATACTCTTGTTCCACCCAGAGGG + Intronic
1112641435 13:101279892-101279914 ATGCTCCTGTTCAGCCTTGAGGG + Intronic
1112837423 13:103533178-103533200 AGCCTTCTGTTCCTTCCTGAGGG - Intergenic
1113445895 13:110366586-110366608 ATGCACATTTTCCTCCCTGAGGG + Intronic
1116207112 14:41882612-41882634 ATATTCCTGTTACTCAATGAAGG + Intronic
1118349339 14:64962278-64962300 GGACTTCTGTTCTTCCCTGAGGG - Intronic
1118705385 14:68475522-68475544 ATACTAAAGTTCCTTCCTGAAGG - Intronic
1119159130 14:72438609-72438631 AGGCTCCTGGTCCTCTCTGATGG - Intronic
1119718227 14:76873716-76873738 ATACAGCTGTGGCTCCCTGAGGG + Intergenic
1120882313 14:89423119-89423141 ATAGACCTACTCCTCCCTGAGGG - Intronic
1121826365 14:97013020-97013042 AAACCCTTGTTCCTCCCTGAAGG + Intergenic
1121913037 14:97809482-97809504 ATATTCCTGTTTCTTCCTTAAGG + Intergenic
1122968445 14:105142872-105142894 GTCCTCCTCATCCTCCCTGACGG + Exonic
1126447943 15:48771005-48771027 ATACTCCTTTTCCTCCTGGGTGG - Intronic
1128525061 15:68406785-68406807 TTTCTCCTTTTCCTCACTGAGGG - Intronic
1128746961 15:70121408-70121430 ATTTTTCTTTTCCTCCCTGAGGG + Intergenic
1129162581 15:73754804-73754826 TCACTCCTGTTCCTCACTGTTGG - Intergenic
1130170762 15:81510653-81510675 ATCCTCCTAGTCCTCCCTGTTGG + Intergenic
1131780392 15:95850215-95850237 ATAGTCCTGTGTCTTCCTGATGG - Intergenic
1132466814 16:81390-81412 ACACTCCTGTGCCTCCATGGGGG - Intronic
1132828039 16:1914601-1914623 ATCCTCCTCTTCCTGCCTGCTGG + Intronic
1133128011 16:3658712-3658734 AAACCGCTGTTCCACCCTGAAGG + Exonic
1134210132 16:12269189-12269211 TTTCTCCTGTGTCTCCCTGATGG - Intronic
1136178305 16:28533669-28533691 TTCCTTCTCTTCCTCCCTGATGG - Intronic
1137465756 16:48707431-48707453 ACAGTCCTGTTCATCCCTCAGGG + Intergenic
1137465759 16:48707445-48707467 ATATTCCTGATGCACCCTGAGGG - Intergenic
1144061806 17:11589669-11589691 ATCCTCCTGTTCCACCCATATGG - Intergenic
1145042278 17:19585729-19585751 CTAGTCCTGTTCCTCACTGGAGG + Intergenic
1147157068 17:38549302-38549324 CTCCTCCTGGTCCTCCCTGGAGG - Intronic
1147917961 17:43900029-43900051 CCACTCCTGTTCCTTCCTGGAGG - Intronic
1149388831 17:56169784-56169806 CTACTCCTGTTCTGCCCTGTTGG + Intronic
1149972004 17:61228081-61228103 ATACTCCTGCTTCACCCTCAAGG + Intronic
1150206636 17:63413744-63413766 AAACTACTGTTCCTCAGTGATGG + Intronic
1150473861 17:65459757-65459779 TTTCTCCAGCTCCTCCCTGAAGG + Intergenic
1150882642 17:69047924-69047946 ATCCTCCTGTTCCACCCATATGG + Intronic
1154045712 18:10902978-10903000 CTACTTCTGTTGCTCACTGATGG + Intronic
1156584330 18:38415170-38415192 ATCATCCACTTCCTCCCTGATGG + Intergenic
1157289323 18:46398763-46398785 ATACTCGGGCTCCTCCCTCATGG + Intronic
1157692663 18:49696921-49696943 ATATTCCTGCTCCTCCCCCAGGG + Intergenic
1158859872 18:61581821-61581843 ATCTTCCTGTTTCTCCCTGGGGG - Intergenic
1159051027 18:63421708-63421730 ACACTCCTGTGGCTCCCAGATGG - Intronic
1162828722 19:13270706-13270728 GTACTGCTGTTCCTCCCCCAGGG - Intronic
1165065194 19:33224654-33224676 CTTCTCCTGTCCCTCCCTGGAGG + Intronic
1165826686 19:38709692-38709714 ATACGCTTCTTCATCCCTGAAGG - Intronic
1166541301 19:43607773-43607795 TTCCTCCTCTTCCTCCCCGAGGG + Exonic
1166661123 19:44647823-44647845 ATACCCCTCCTCCTCCCTCAGGG - Intronic
1167097452 19:47381959-47381981 CTCCTCCTTTTCCTCCCTTAGGG + Exonic
1167466405 19:49652858-49652880 GTCCTCCTGTTCTTCCCGGAAGG + Exonic
931650890 2:64467809-64467831 ATACTCCTGATGCTCGATGATGG - Intergenic
932135598 2:69226098-69226120 AGAATCCTGTTCCTCAATGAGGG + Intronic
934138788 2:89024127-89024149 ATACTCTTGTGCTTCCCTCATGG + Intergenic
934230459 2:90176430-90176452 ATACTCTTGTGCTTCCCTCATGG - Intergenic
934853335 2:97714641-97714663 GAACTCCTGTTCCTTCCTGTCGG - Intronic
934921033 2:98345849-98345871 AAACTCATTTTCCTCCCAGAAGG - Intronic
935210245 2:100933549-100933571 ATGCTCATGTTCCTCCCTCTGGG + Intronic
935625570 2:105169758-105169780 AGACTGCTTTTCCTCCCTGCAGG + Intergenic
945239207 2:207660869-207660891 ATAGTCCGGCTCCTCCATGACGG + Intergenic
946348440 2:219130348-219130370 ATACTGCTGGTCCTCCCAGGTGG + Intronic
946444722 2:219728453-219728475 ATACTTCTGTCCCTCCCTCTAGG + Intergenic
947252454 2:228122966-228122988 ATTCTCCTGTTCAGCCCTTACGG + Intronic
1168743181 20:212431-212453 TTAATCCTGTTTCTCCCTCATGG + Intergenic
1168970049 20:1924886-1924908 ATTCCCCTCTTCCTCCCTAAGGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1171411939 20:24953389-24953411 ATGATCCTGTTCCTCCGTGGGGG + Intronic
1173458022 20:43219312-43219334 AGTCCCCTGTTCCTCCCTAAAGG - Intergenic
1173918249 20:46725577-46725599 AGCCTCCTCTTCCTCCCTGCTGG + Exonic
1183704558 22:39468907-39468929 AAACTTCTGTGCCTCCTTGAGGG + Intronic
1183950284 22:41348895-41348917 TTACTCCTGTCCCTCCCCCAGGG - Intronic
951605835 3:24434022-24434044 ACCCTCTTGTTCCTCTCTGATGG + Intronic
952153758 3:30620843-30620865 ATACTCTTCTACCTACCTGAGGG + Intronic
952924943 3:38313920-38313942 CTTCTCCTTTTCCTCCCTGAAGG + Exonic
952973351 3:38671377-38671399 ATACTCCTGTTCTTCCCCTCTGG + Intergenic
953808656 3:46093473-46093495 ATACTCATGGTCCTTCCTGCTGG + Intergenic
953966368 3:47310050-47310072 ATACTACTGTTCCTACCTTCAGG - Intronic
957987887 3:87594793-87594815 AAACTCCTGCTCAACCCTGATGG + Intergenic
960302088 3:116015453-116015475 ATAATCCTGTGACTCCCAGAGGG - Intronic
960882865 3:122363655-122363677 ATATTCTCTTTCCTCCCTGAGGG - Intronic
962240965 3:133750563-133750585 ATAATCCTGTCCCTCCCAGCTGG + Intronic
963667217 3:148203454-148203476 TTACTCCTGTTCCCCCCAGCAGG - Intergenic
967084215 3:186079502-186079524 ATAGTCTTGTCCCTCACTGAGGG - Intronic
968062515 3:195736841-195736863 CTACTCCTGTTCCTACCTCCAGG + Intronic
968283498 3:197494587-197494609 ATTTTCCTGTTCCTCCCTCCAGG - Intergenic
969051470 4:4376280-4376302 ATGCTGCTGTCCCTCCCTGGTGG - Intronic
969231556 4:5835309-5835331 AGACAACTGTGCCTCCCTGAAGG - Intronic
969497466 4:7534336-7534358 AGACACCTGTGGCTCCCTGATGG - Intronic
972307077 4:37841325-37841347 CTACACCTCTTCCTACCTGATGG - Intronic
974233640 4:59151236-59151258 ATTCTACTGTTCCTCTGTGAAGG - Intergenic
976035124 4:80809306-80809328 ATTCTCCTGTTCCCACCCGAAGG - Intronic
977535327 4:98250612-98250634 GTACTCCTTTCTCTCCCTGAGGG + Intergenic
981021735 4:140036346-140036368 ATACTCATGTTCCTGCATGCTGG - Intronic
982488574 4:155999662-155999684 AGACTCCTGTTCATGCCTCAGGG + Intergenic
984250829 4:177332455-177332477 AGTTTCCTGTTCCTCCCTCAAGG + Intronic
988599059 5:32622612-32622634 TTACTGCTATTGCTCCCTGAGGG + Intergenic
998521056 5:142800947-142800969 TGACTCCTGTTCCTCCCTGATGG + Intronic
998695242 5:144630972-144630994 ATACTGCTGATGCTCCCTTAAGG - Intergenic
1001629600 5:173164914-173164936 CTCCTTCTGTTCCTCCTTGAGGG - Intergenic
1001706181 5:173742645-173742667 ACACTCCTCCTCCTCCCTCAAGG + Intergenic
1003377477 6:5593188-5593210 ATACGCCTGTTACTCACTCACGG - Intronic
1004070445 6:12292432-12292454 CTGCTCCTGCTCGTCCCTGATGG + Exonic
1005059838 6:21765415-21765437 CTATACCTTTTCCTCCCTGAAGG - Intergenic
1005418529 6:25626415-25626437 GTACTCCTGTTCTGCCCTGCTGG - Intergenic
1008541425 6:52549665-52549687 AAACTCCTCTTGGTCCCTGAGGG + Intronic
1008618359 6:53247435-53247457 CCACTCCTGATCCTCCCTGAGGG - Intergenic
1008711359 6:54230859-54230881 ATTCTCCTGTTCATCACTCAAGG - Exonic
1010029577 6:71259245-71259267 ATACTCCAGTTCCCACCTAATGG + Intergenic
1010711585 6:79181257-79181279 ATATTTCTATTCCTCTCTGAAGG + Intergenic
1011668269 6:89656968-89656990 ACACTCCTGTTTCTGCCTGTAGG - Intronic
1014831155 6:126104393-126104415 ATATTCCTGTTCCTCCAGGTTGG - Intergenic
1015227063 6:130869851-130869873 ATACTCCTGTTCCTCCCTGATGG + Exonic
1016115744 6:140283387-140283409 TTACTTGTGTTCCTCCCTCAGGG - Intergenic
1020286693 7:6687300-6687322 ATCCTCCTGTTTCTTCCTGTTGG + Intergenic
1020882159 7:13775798-13775820 ATAGGCGTGTTCCTCCCTGAAGG + Intergenic
1023689124 7:42768066-42768088 AAATTTCTGTTCCTCCCTTAAGG - Intergenic
1024094602 7:45973915-45973937 AGTCTCCAGTTCCTCCTTGAGGG - Intergenic
1027415364 7:77968325-77968347 ATAATGCTGTTCCTTCCTCAGGG + Intergenic
1029459449 7:100686722-100686744 CTCCTCCTGTTCCTCCCGTAGGG + Exonic
1029745312 7:102512944-102512966 AACCTCCTGTTCCTCCCGCAGGG + Intronic
1029763252 7:102611923-102611945 AACCTCCTGTTCCTCCCGCAGGG + Intronic
1030379414 7:108795246-108795268 ATCCCCCAGTTCCTCCTTGAGGG - Intergenic
1033543815 7:142381618-142381640 AGACTCCTGTTTCTCTCTGGGGG + Intergenic
1040400351 8:47044011-47044033 ACACCTCTATTCCTCCCTGAAGG + Intergenic
1040694714 8:49981742-49981764 ATTTTCCTGTTCCTCCCCAAAGG + Intronic
1041187592 8:55316914-55316936 ATACTTCTGTTATTCCCTTAAGG - Intronic
1042827648 8:72994605-72994627 ATTCTCCTTTGCCTCCCAGAAGG - Intergenic
1043661540 8:82748738-82748760 ATATTTATCTTCCTCCCTGAAGG + Intergenic
1044243381 8:89912772-89912794 AAACTCCTGATCCCTCCTGATGG + Intronic
1048486879 8:134856580-134856602 CTACCTCTGTTCCTCCTTGAGGG + Intergenic
1050565218 9:6875152-6875174 ATATTCCTGCTCCTCCAAGATGG - Intronic
1052881590 9:33604009-33604031 AGAATCCTGTTTCTCCCTGCAGG + Intergenic
1053494728 9:38541828-38541850 AGAATCCTGTTTCTCCCTGTAGG - Intronic
1054788747 9:69235262-69235284 AAACTACTCTTCCTGCCTGATGG - Intronic
1056062312 9:82896495-82896517 ATCAGCCTGTTGCTCCCTGAGGG - Intergenic
1059423996 9:114209554-114209576 CTCCTCCTCTTCCTCCCTGGTGG - Intronic
1060223308 9:121775594-121775616 ACATCCCTGCTCCTCCCTGATGG + Intronic
1060301989 9:122379499-122379521 ATACTCCAGTTCCTGCCACATGG + Intronic
1061712632 9:132498557-132498579 CCACTCCTGTGCCACCCTGAAGG + Intronic
1062285352 9:135770291-135770313 AGACTCCTGTCCCTCCCTGTGGG - Exonic
1186793924 X:13025492-13025514 ATCCTCCTGTTCTCCCCTGGAGG - Intergenic
1189563451 X:42214823-42214845 ATCCTGCTGTTGCTCCCTTATGG + Intergenic
1194091846 X:89587019-89587041 ATCCTCCTGTTCCACCCTATTGG - Intergenic
1195224997 X:102784022-102784044 TTACTTCTGATCCTCCCTTAAGG + Intergenic
1199004425 X:142678257-142678279 TGATTCCTCTTCCTCCCTGATGG - Intergenic
1200444486 Y:3243081-3243103 ATCCTCCTGTTCCACCCTATTGG - Intergenic