ID: 1015232892

View in Genome Browser
Species Human (GRCh38)
Location 6:130937059-130937081
Sequence GGTAATTATCCCAATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015232892_1015232902 13 Left 1015232892 6:130937059-130937081 CCTCCCCCATTGGGATAATTACC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1015232902 6:130937095-130937117 GTGGGTACATTTGTTACAACTGG 0: 1
1: 0
2: 3
3: 12
4: 130
1015232892_1015232898 -5 Left 1015232892 6:130937059-130937081 CCTCCCCCATTGGGATAATTACC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1015232898 6:130937077-130937099 TTACCAACATCCCACACAGTGGG 0: 1
1: 1
2: 0
3: 19
4: 174
1015232892_1015232897 -6 Left 1015232892 6:130937059-130937081 CCTCCCCCATTGGGATAATTACC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1015232897 6:130937076-130937098 ATTACCAACATCCCACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015232892 Original CRISPR GGTAATTATCCCAATGGGGG AGG (reversed) Intronic
901295357 1:8156969-8156991 GGTGATTGGCCCAATGGTGGAGG - Intergenic
912480838 1:109981128-109981150 TGTAAATATCCCCATGTGGGTGG - Intergenic
915085800 1:153387956-153387978 AGTAATTATCCCAGAGAGGGTGG + Intergenic
916145787 1:161738095-161738117 GGCAATAAGCCCAATGGGGCTGG - Intergenic
917486434 1:175459174-175459196 GGTGATAATGGCAATGGGGGAGG - Intronic
918254426 1:182736219-182736241 GGTAATTGTACCACTGGTGGAGG - Intergenic
919077588 1:192831701-192831723 GGTAATTGGCACCATGGGGGTGG - Intergenic
919194857 1:194271251-194271273 GGAAATTATCCCATTAGGTGAGG - Intergenic
920001527 1:202803297-202803319 GGAAATTTTTCCAGTGGGGGTGG + Intronic
1084708045 11:70827207-70827229 GGTAATTACCTCGATGGGTGGGG - Intronic
1086149817 11:83596557-83596579 AGAAATTATCCCAATGGCGATGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1109565564 13:64110556-64110578 TGTAATTCTCCCAATAAGGGGGG - Intergenic
1112480804 13:99773598-99773620 GGTAATTATTCCATGGGAGGTGG - Intronic
1129483528 15:75845648-75845670 TGTGGTTATCCCAGTGGGGGTGG + Intronic
1129741421 15:77991443-77991465 GGTTATGATCCCAGTGGGGGAGG + Intronic
1129844242 15:78760964-78760986 GGTTATGATCCCAGTGGGGGAGG - Intronic
1132066159 15:98732874-98732896 GGGAGTTATCCCAGTGGGGAAGG + Intronic
1138481677 16:57307447-57307469 GGTTGTTATCCCAATGGGGAGGG - Intergenic
1143286952 17:5797219-5797241 GGGAATGAGCCCAATGAGGGAGG + Intronic
1147173026 17:38632527-38632549 AGTAATTATCCCTAAGGGAGTGG + Intergenic
1148294446 17:46488751-46488773 GATAATTTTTCCATTGGGGGAGG - Intergenic
1148316629 17:46706464-46706486 GATAATTTTTCCATTGGGGGAGG - Intronic
1160501246 18:79401982-79402004 GGTAGTTATCCCCATGGAGCTGG + Intronic
925937948 2:8785476-8785498 GGTAATCGTGCCAATTGGGGAGG + Intronic
927010615 2:18899951-18899973 GGTAATTATCCAAATGGCTCTGG + Intergenic
928359656 2:30652956-30652978 TGCAAATATCCAAATGGGGGTGG + Intergenic
932486989 2:72090241-72090263 GGGAGTTATCCCAAGGGGCGGGG - Intergenic
935460980 2:103333997-103334019 GTTAAATATGCCAATGTGGGTGG - Intergenic
943969540 2:194385981-194386003 GGTTATTATAAGAATGGGGGGGG + Intergenic
945371988 2:209030239-209030261 GGTAACAATCCCACTGGGGGAGG + Intergenic
947003668 2:225486797-225486819 GATAATTTTCCCAAAGGGGAGGG - Intronic
1172524438 20:35590235-35590257 AGTAGTTATCTCTATGGGGGTGG + Intergenic
1173979276 20:47210716-47210738 GGTTTTTCTCCCAATGGGGTGGG + Exonic
1181515267 22:23407217-23407239 GGTATTCATCCTAATGGGTGTGG - Intergenic
1181601411 22:23953962-23953984 GGTACTGATCCCCATGGGCGCGG - Intergenic
1181607096 22:23987375-23987397 GGTACTGATCCCCATGGGCGCGG + Intergenic
950844779 3:16004246-16004268 GGTAATTAACAAAATGGGGTAGG + Intergenic
950916325 3:16649529-16649551 GGCAATTTTTCCAGTGGGGGAGG - Intronic
963906919 3:150780264-150780286 GGTTCTTACCACAATGGGGGTGG + Intergenic
964731948 3:159876960-159876982 GGTAATAATCCCCAAGGAGGAGG - Intronic
965499668 3:169442506-169442528 GGTAAGTATCCCAATTAGGTGGG + Intronic
966510049 3:180752258-180752280 GGAAACTATTGCAATGGGGGAGG + Intronic
975823454 4:78294791-78294813 GGTAATTTTCCTAATGATGGAGG - Intronic
975909907 4:79255144-79255166 GATAATGATCACACTGGGGGTGG + Intronic
992388682 5:76310631-76310653 GGTAATGGTGCCAATGGAGGTGG + Intronic
996927513 5:128845933-128845955 GTTAATTATCCCTCTGTGGGTGG - Intronic
996945919 5:129067367-129067389 GTTAATTTTCCCAAAGTGGGAGG + Intergenic
1002376368 5:178791975-178791997 GAGAATTATCCAAATGGGGATGG - Intergenic
1003343007 6:5239882-5239904 GGTACTGTTCCCTATGGGGGTGG - Intronic
1007415128 6:41687217-41687239 GGTACTTCTCCCCATGGGGTGGG - Intronic
1011129929 6:84042354-84042376 CTGAATTATCCCAATGGGAGAGG + Intronic
1015232892 6:130937059-130937081 GGTAATTATCCCAATGGGGGAGG - Intronic
1015235503 6:130966325-130966347 AGTTATTATCCCAAGTGGGGCGG - Intronic
1017055246 6:150430459-150430481 AGTAGTTATCCAAATGGGTGGGG - Intergenic
1017236914 6:152126240-152126262 GGTAATTACCCCAAGGGGACAGG - Intronic
1019857921 7:3627850-3627872 TGTAAATAGCCCAATGGGGGTGG - Intronic
1020454993 7:8361750-8361772 TGTAATCATCCCAGTTGGGGGGG - Intergenic
1021387713 7:20052192-20052214 GGTATTTAGCTCAATGTGGGAGG - Intergenic
1022862827 7:34385676-34385698 AGTTATTATCCCAATGAGGCAGG - Intergenic
1023840289 7:44093278-44093300 GCTCATTACCCCAATGGGGAGGG - Intergenic
1024041417 7:45559038-45559060 TGTAATCATCCAAATGGGAGTGG + Intergenic
1027594120 7:80151595-80151617 GGCATTTATTCCACTGGGGGTGG - Intronic
1029361550 7:100091824-100091846 GGCAACTATCCCAAAGGGGAGGG + Exonic
1038117272 8:24571661-24571683 TGTCATCATCCCACTGGGGGTGG - Intergenic
1044962972 8:97548951-97548973 GGTAAGTATCTCAGTGGAGGTGG + Intergenic
1045956187 8:107910689-107910711 GGTAAATATTACAATGAGGGAGG - Intronic
1046837145 8:118814522-118814544 GGTAAGTATGCAAAAGGGGGGGG + Intergenic
1052865165 9:33460402-33460424 CTTGATTATCCCCATGGGGGAGG - Intergenic
1190146561 X:47896676-47896698 GGTATATATCACAATAGGGGTGG - Intronic
1197725564 X:129774084-129774106 GACAATTGTCCCCATGGGGGAGG + Intergenic