ID: 1015234632

View in Genome Browser
Species Human (GRCh38)
Location 6:130956446-130956468
Sequence CTCTGTGTCTGAAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015234632_1015234633 -4 Left 1015234632 6:130956446-130956468 CCTTCTTCACTTCAGACACAGAG 0: 1
1: 0
2: 1
3: 33
4: 332
Right 1015234633 6:130956465-130956487 AGAGCCTACTTCAGTAGTCATGG 0: 1
1: 0
2: 3
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015234632 Original CRISPR CTCTGTGTCTGAAGTGAAGA AGG (reversed) Exonic
900736378 1:4301852-4301874 ATCTGTATCTGTAGTAAAGATGG + Intergenic
901254131 1:7806379-7806401 CTGTGTATGTGAAGTGAAGTAGG - Intronic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
903551709 1:24161676-24161698 CTCTGTTTCTGCAGTGGAGCCGG - Exonic
904414569 1:30350336-30350358 CTCTGTTTCTGGTTTGAAGATGG + Intergenic
906246669 1:44280697-44280719 CTCTCTGGCTGCAGTGTAGAGGG - Intronic
907039504 1:51245805-51245827 CTCTGTACCTGAAGTAAGGAAGG + Intronic
908833755 1:68208292-68208314 CTCTTTATCTGAAGAGAGGAGGG - Intronic
910432126 1:87169259-87169281 CTCTGTGTGTGAATTGAATGGGG + Intergenic
911038015 1:93570496-93570518 ATCTGTATCTGAAGTCAAGCAGG - Intronic
911057362 1:93720438-93720460 CCCTGTATCAGCAGTGAAGAAGG - Intronic
911316470 1:96362148-96362170 CTCTGTGGGGGAAGTGAGGAGGG + Intergenic
912271596 1:108216059-108216081 CTTTGTGTCTGTCATGAAGAGGG - Intergenic
913120762 1:115738381-115738403 CTCTGTTTCCCCAGTGAAGAAGG - Intronic
914860772 1:151384067-151384089 CTATGTGTTTGCTGTGAAGATGG - Intergenic
914951595 1:152120090-152120112 CTCTGTCCCTGAAGTAAGGATGG + Intergenic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
916699645 1:167278135-167278157 CTCAGTGGCTCAAGTGCAGAGGG - Intronic
918100307 1:181366987-181367009 TTCTGTGTCTGTGGTGAAGGAGG + Intergenic
918135237 1:181667516-181667538 ATCTGTGTCTTAAGAAAAGAGGG + Intronic
918335308 1:183504763-183504785 ATCTGTGTCTGAAAGTAAGAGGG - Intronic
918649632 1:186945252-186945274 CCGTGTGGCTGAAGTGAAGTGGG + Intronic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919885191 1:201928499-201928521 CTCTGTGAGTGCTGTGAAGAGGG + Intronic
921562138 1:216671588-216671610 CTCTGTTTCCCAAGTGATGAGGG - Intronic
924942845 1:248824560-248824582 TTGTGTGTCTGAAGTGCTGATGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064204961 10:13315010-13315032 CTCTGTGTCTTGAATGAGGATGG - Intergenic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065280791 10:24135472-24135494 CTCTGTGTCTAAAGTGCTCAGGG + Intronic
1066108824 10:32178714-32178736 CCCTGTGTCTAAAATAAAGAAGG + Intergenic
1066598563 10:37078959-37078981 CTCTGTGTCTACAATGAAAATGG - Intergenic
1067664352 10:48262342-48262364 TGCTTTGTCTGAAGTTAAGATGG - Intronic
1068076188 10:52257609-52257631 CTCTGTGACTAAAGTGAGTAAGG + Intronic
1068426700 10:56875499-56875521 CTCTGTGTCTGATTTGAAGCAGG + Intergenic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1070797991 10:79228355-79228377 CCTTGAGTCTGAAGAGAAGAAGG + Intronic
1074441322 10:113479637-113479659 CTCTGTGTCTTATCTGGAGACGG + Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1076002534 10:126923735-126923757 TTCTGTGTATGAAGTGGGGAGGG - Intronic
1077627978 11:3790317-3790339 TGCTCTGGCTGAAGTGAAGAGGG + Intronic
1078114912 11:8437187-8437209 CACTGTGTATAAAGTGAACATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080730056 11:34941232-34941254 GTGTGTGTGTGAAGTGAAAAGGG + Intronic
1081580922 11:44351194-44351216 CTTTGTGTTTGAAGTGGAAATGG - Intergenic
1081631653 11:44693782-44693804 CTGCGTGGCTTAAGTGAAGAAGG + Intergenic
1081866942 11:46365407-46365429 CTGTATGTCTGAAGTGCTGATGG - Intronic
1082670094 11:56025269-56025291 GTCTGTTTCTAAAGTGAAGGAGG - Intergenic
1084742347 11:71147817-71147839 CTCTGTGTTTGAAGCAGAGAGGG - Intronic
1086028363 11:82322726-82322748 CTTTGTGACTGAAGTGGGGAGGG + Intergenic
1086969724 11:93067262-93067284 CTCTGTGTCTTCAGAGATGAGGG + Intergenic
1087735115 11:101824026-101824048 ATTTGTGTCTGAATTGAATAAGG + Intronic
1088621174 11:111685491-111685513 ATTTCTGTTTGAAGTGAAGAGGG + Intronic
1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG + Intergenic
1090277333 11:125429375-125429397 GTCTGTCTCTGAAGTGCAGGTGG - Intronic
1090913640 11:131143417-131143439 CTCTGTCTCTGAAGTATAAAGGG + Intergenic
1092552270 12:9515661-9515683 CTCTGTGTCTGCAATGAAGAAGG - Intergenic
1092958260 12:13570276-13570298 AACTGTGTCTGAAAGGAAGAAGG + Intronic
1094344754 12:29454909-29454931 TTATTTGTCTGAAGTGAAGCAGG + Exonic
1094519849 12:31174950-31174972 CTCTGTGTCTGCAATAAAGAAGG + Intergenic
1095046309 12:37511006-37511028 CTCTAGGTCTGAAGGGATGAAGG - Intergenic
1099330603 12:81280454-81280476 ATCAGTGGCTGGAGTGAAGATGG - Intronic
1099332252 12:81304280-81304302 CTCTGTGTCTGAGTTGATTAGGG + Intronic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1103360082 12:120348173-120348195 GCCTGTGTCTGAAGAGGAGATGG - Intronic
1104717873 12:131028606-131028628 TTCTGTGTCTGCAGTGCAGTAGG + Intronic
1104823189 12:131690389-131690411 ATCTCTGTCTCCAGTGAAGATGG - Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1105882675 13:24617719-24617741 CTCTGTGCCTGAAGAGTAGGGGG + Intergenic
1106306293 13:28514210-28514232 CACTGTAACAGAAGTGAAGAAGG - Intergenic
1106722319 13:32448109-32448131 CACTGTTTCTGAAATGAGGAGGG - Intronic
1106934345 13:34701879-34701901 CCCTGTGAGTGAAGTGGAGAGGG - Intergenic
1110638998 13:77799814-77799836 CACTCTCTCTGTAGTGAAGACGG - Intergenic
1110894682 13:80734386-80734408 CTCTTTTACTGAAATGAAGAAGG - Intergenic
1110950836 13:81488627-81488649 CTCTGCCTCTTAAATGAAGAAGG - Intergenic
1111237752 13:85431191-85431213 CTCAGTGCCTGAAGTCCAGAGGG - Intergenic
1112433356 13:99372618-99372640 CTCTGAGTCTAAAGGGAAAATGG + Intronic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1114325246 14:21582300-21582322 CTCTGGGACTGACTTGAAGAGGG + Intergenic
1115809010 14:37085076-37085098 AATTGTGTCTGAAGTGGAGAGGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119684554 14:76621169-76621191 CTCTGTGTATGAGGTGAACTTGG - Intergenic
1119746649 14:77049403-77049425 ATGTGTGTCTGCAGTGATGATGG + Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1121308123 14:92919601-92919623 CTCTGTGTCTGAGGTGTGGGTGG - Intergenic
1121413384 14:93762837-93762859 CTATGTGCCTGGAGTGAAGTTGG - Intronic
1123800309 15:23811940-23811962 CTCTGTCTCAAAAATGAAGAAGG + Intergenic
1124497802 15:30196929-30196951 TTCTGTGTCTTTAGTAAAGACGG + Intergenic
1124745783 15:32341756-32341778 TTCTGTGTCTTTAGTAAAGACGG - Intergenic
1126770052 15:52047156-52047178 CTCTCTGTTTGAAATGAAGGTGG + Intronic
1128992935 15:72275429-72275451 TTCTGTTTCAGAAGTGGAGAGGG + Intronic
1129233400 15:74209140-74209162 CTCTGTGCCTGAGCTGGAGATGG - Intronic
1130681943 15:86004749-86004771 CTCTGTAACTGAAGCTAAGATGG + Intergenic
1131021603 15:89103888-89103910 ATCTGTGCCTGAAATGAAAAAGG - Intronic
1131675711 15:94668145-94668167 CTCTCTCTCTGAAGTTAATAAGG - Intergenic
1133580422 16:7139407-7139429 CTTTGTCTCTGAACTCAAGAAGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1135822831 16:25699608-25699630 CTCTGTTTCTTAGGTGATGAAGG + Intronic
1135956275 16:26958993-26959015 CTCTGTCTCTCCAGTGTAGAAGG + Intergenic
1136547761 16:30965253-30965275 CTCTGTGTCAGAGGCCAAGAAGG - Exonic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1138913267 16:61429305-61429327 CTCTGTATCTGAAGTGGAAGAGG - Intergenic
1140188548 16:72795410-72795432 CTCTGTTTTTGAATTGAAGGTGG + Exonic
1140974472 16:80045711-80045733 CTTTGTGTCCCCAGTGAAGAGGG + Intergenic
1141005312 16:80346565-80346587 CTCTGTGTATGAGGTGAGGCAGG - Intergenic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1144363181 17:14516213-14516235 CTCTGTCTCTGATGTGAACAGGG - Intergenic
1146709998 17:35032721-35032743 GTCTGGGTCAGAAGAGAAGAAGG + Intronic
1146787037 17:35729924-35729946 CTCTGTGACTGAACAGGAGAGGG + Intronic
1148246449 17:46034082-46034104 CTCTTGGTCAGAAGAGAAGAGGG + Intronic
1150474627 17:65465535-65465557 TTCTGTCTCTGAAGAGCAGAGGG + Intergenic
1150821473 17:68437647-68437669 GTCTGCGTCTGCAGTCAAGATGG + Intronic
1152326708 17:79645714-79645736 CCCTGTGCCTTAAGTGAAGGAGG - Intergenic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153822000 18:8839989-8840011 CTCTGTCTTTGAAGTGGAGTGGG - Intergenic
1154059127 18:11042369-11042391 CTGTGTGTATGAAGTGCACATGG - Intronic
1154504712 18:15024292-15024314 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
1155045251 18:22097570-22097592 CTCTGTTTCTGAAATGAAAGGGG + Intronic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1155277332 18:24201111-24201133 CTCTCTGTATGAAGAGAAAAAGG - Intronic
1158383884 18:56966956-56966978 GTCTGTGTCAGAAGTCAAAATGG + Intronic
1158608764 18:58919646-58919668 CCCAGTGTCTGCTGTGAAGACGG + Exonic
1159311201 18:66712160-66712182 ATATGTGTCAGAAGTGAAAAGGG + Intergenic
1159898918 18:74023639-74023661 ATCTGCATCTGAAGTGAAGAGGG - Intergenic
1159900180 18:74038243-74038265 CTCTGTCCCTGCACTGAAGAAGG + Intergenic
1159928949 18:74292784-74292806 CTCTGTGTCAGAAGGGAAAGAGG - Intergenic
1162132764 19:8537054-8537076 TTCTGAGGCAGAAGTGAAGACGG + Exonic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164141177 19:22465869-22465891 CTCTGGGTTTGTAGTAAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165591739 19:36974442-36974464 CTGTGCGTCTGAAGTGATGGCGG + Intronic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166423515 19:42656063-42656085 CTCTGAGTCTCAGGTGGAGAAGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
927457023 2:23261680-23261702 ATCTGTGTTTGGAGTGAAGGTGG + Intergenic
928324930 2:30311697-30311719 GTCTGTGTATTAACTGAAGAAGG - Intronic
928712927 2:34027998-34028020 CTCTGTTGCTGAATTGAAGATGG + Intergenic
929262766 2:39884019-39884041 CTATGAGGCTGAAGGGAAGATGG + Intergenic
931520720 2:63094123-63094145 CTCTGTGGCTGAAATGAACAAGG - Intergenic
931717093 2:65037829-65037851 CACTGTGGCTGAAGTGAGGTGGG - Intergenic
932212568 2:69944778-69944800 CTCTGTGCCTATTGTGAAGAAGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933298484 2:80517031-80517053 CTGTTTGTCTGAAATGAAGAAGG + Intronic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
936377482 2:111954304-111954326 ATCTGTGTGTCAAGTGAACAGGG - Intronic
936469227 2:112783767-112783789 CTCTGTTGCAGAAGTCAAGATGG - Exonic
936489505 2:112958115-112958137 CTCTGTGTTTCAAGTGAAATAGG - Intergenic
936820181 2:116510754-116510776 GCCTGTGTGGGAAGTGAAGAGGG + Intergenic
936990860 2:118364583-118364605 CTCTGTCTCTCAATGGAAGAAGG - Intergenic
937038237 2:118800269-118800291 ATATATATCTGAAGTGAAGAGGG + Intergenic
937075666 2:119104541-119104563 CTGTGAGTCTGAGGTGAGGAGGG - Intergenic
937632264 2:124116348-124116370 CTTTCTGTAGGAAGTGAAGAAGG + Intronic
938503902 2:131854500-131854522 ATCTGTGGCTGAAAGGAAGAAGG + Intergenic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
941436544 2:165480148-165480170 CTCTGTGGCTGACGTGAAGTAGG - Intronic
943737659 2:191374534-191374556 GTCTGTCTCTGAACGGAAGAGGG + Intronic
945208041 2:207353050-207353072 CTCTCTGTCTGAAGAACAGATGG - Intergenic
945414898 2:209558952-209558974 CTCTGCCTCTGTAATGAAGAAGG + Intronic
945887050 2:215386759-215386781 CTCTGTGCCTGGAGTGAGGTTGG + Exonic
946061084 2:216942075-216942097 CTCTGTGCCAGGAATGAAGATGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946184781 2:217974312-217974334 CTCTGTGTCAGAAGATAGGAAGG + Intronic
946811644 2:223531447-223531469 ACTGGTGTCTGAAGTGAAGAGGG + Intergenic
947164158 2:227244593-227244615 CTCTGTGTCTGATGAGATGATGG + Intronic
947767839 2:232648860-232648882 CTTTCTGTGTGAAGAGAAGAAGG + Intronic
947872999 2:233450037-233450059 CTCTGAGTCAGAGGAGAAGATGG + Exonic
1169655678 20:7920208-7920230 TCCTGTGTGTGAAGTGAAGGGGG - Intronic
1170447608 20:16445189-16445211 CTCTGTCTCTAAAGGAAAGAAGG + Intronic
1173343192 20:42173277-42173299 CTATGTGTCTGGAGTGAACTGGG + Intronic
1175468747 20:59210648-59210670 CCCTGAGGCTGAAGGGAAGAAGG - Intronic
1176665830 21:9686676-9686698 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
1177375906 21:20270648-20270670 CCCTGTCTCGGAAGAGAAGAAGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178247110 21:30964020-30964042 CTCTGTGTCTCAATTTAATAAGG - Intergenic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1179225610 21:39450487-39450509 CTCTGGGACTCAGGTGAAGAGGG + Intronic
1181164616 22:20976688-20976710 CTCTGTGTCTGTGGTGGAGCTGG + Exonic
1181681236 22:24497149-24497171 CTATGTGTATTAAGTGAAAAAGG + Intronic
1183324242 22:37182918-37182940 CCCTCTCTGTGAAGTGAAGACGG - Intronic
1184347162 22:43920887-43920909 GTCTGTGTCTGATGTGAGCAGGG + Intergenic
1184966530 22:47977054-47977076 TTTTGTGTGTGATGTGAAGAGGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
950287135 3:11753841-11753863 TTGTATGTCTGACGTGAAGAAGG + Intergenic
951022737 3:17798354-17798376 CTCTTTGTGTGAAGTGTAAAAGG - Intronic
952828381 3:37542922-37542944 CTCTGGGTCTGCAGTGATGCTGG + Intronic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955651711 3:61201877-61201899 TTCTGTGTTTGAAGTGGAAAGGG - Intronic
955752039 3:62193138-62193160 TTCTCTTTCTGGAGTGAAGATGG + Intronic
957330332 3:78755146-78755168 CTCTGTGAATGAAATGGAGAGGG + Intronic
959265559 3:104132954-104132976 TTCTGTGTCAGAAGAGAAGAAGG + Intergenic
959504418 3:107142069-107142091 GTCCGTGTCTCAAGTGAAAATGG + Intergenic
959920320 3:111861463-111861485 CTCTGGGTCTCAAGAGATGAAGG - Intronic
962153330 3:132916547-132916569 CACTGTGACAGAAATGAAGAAGG - Intergenic
962171856 3:133109528-133109550 CTCTGTTTCTAAAGAGAATAGGG + Intronic
962375251 3:134853647-134853669 GTCTGTGTCTGAGTTCAAGATGG + Intronic
962444972 3:135456011-135456033 CTCTGTTTCTGAAATGAGGAAGG - Intergenic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962781599 3:138723968-138723990 TTTGGTGTCTGAAGTGATGAAGG - Intronic
963371289 3:144403874-144403896 CTCTGGGTAAGAAGTGAATATGG + Intergenic
964740559 3:159960936-159960958 CTCTGTGTTTGATGTGGGGAGGG + Intergenic
964849735 3:161082115-161082137 CTCAGTGTCTGAAAGGGAGAGGG - Intergenic
965356703 3:167683718-167683740 CTCTGTGTCCAAAGTGATTAAGG + Exonic
968542496 4:1175203-1175225 CTCTGGGTCTGAGGAGAGGAAGG + Intronic
968792214 4:2673660-2673682 CTCTGGGTGTAAAGTGAGGAAGG + Intronic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
969722470 4:8900044-8900066 CTTTCTCTCTGAAGTGAGGAAGG - Intergenic
970057088 4:11987153-11987175 CTTTGTATTTGGAGTGAAGAGGG - Intergenic
970276617 4:14407731-14407753 CTCTCACTCTGAAGAGAAGATGG - Intergenic
971593769 4:28500992-28501014 CTCTGTGCCTGAAAAAAAGATGG + Intergenic
971673902 4:29599150-29599172 TTCTGTCTCTGAAATGTAGAAGG - Intergenic
973639100 4:52885785-52885807 CACAGTCTCTGAAGTGAAAATGG - Exonic
974940824 4:68465658-68465680 TTCTGTGGTTTAAGTGAAGAGGG + Intronic
975657397 4:76655304-76655326 CACTGTGTCTAAAGAGAACATGG - Intronic
976947845 4:90792467-90792489 CCCTGTGTCTGAAATGTACAGGG + Intronic
976987891 4:91325782-91325804 TTCTTTGTCTGTTGTGAAGATGG - Intronic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
977388655 4:96379730-96379752 CTCTGTCTCTTAAATGAAGCTGG - Intergenic
977576959 4:98685064-98685086 CTATGTTGCTGACGTGAAGATGG - Intergenic
977749874 4:100596468-100596490 CTATAGGTCTGTAGTGAAGATGG - Intronic
978008602 4:103651326-103651348 CTCTGCCTTTGAAATGAAGACGG - Intronic
978230944 4:106398117-106398139 GTATGTGTGTGATGTGAAGAGGG + Intergenic
978827262 4:113040562-113040584 CTTTGTGTCTGATGTAAATATGG - Intronic
979971787 4:127144621-127144643 TACTGTGTCTGAAAGGAAGATGG - Intergenic
981487118 4:145298977-145298999 CTTTATGTCTCAAGTGAACAGGG + Intergenic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
982368927 4:154612345-154612367 CTTTGTGTGTGAACTGGAGAGGG - Intronic
982752566 4:159179681-159179703 TTCTGTGTGAGAAGTGAAGGAGG + Intronic
983926912 4:173412520-173412542 CTCTGTCTCTGAGCTGAAGCAGG + Intergenic
985411559 4:189690934-189690956 CTCTGTTTCTGAAGTTTAAAGGG - Intergenic
986813035 5:11380281-11380303 TGCTGTGTCTGAAGCAAAGATGG + Intronic
988126109 5:27039896-27039918 TTCTGTGTTTGAAGTGTAGGAGG + Intronic
988220146 5:28334006-28334028 GCCTGAGTGTGAAGTGAAGAGGG + Intergenic
990267835 5:54097389-54097411 CTTTGTGTTTGAAGTAAAAATGG - Intronic
990738701 5:58890833-58890855 CTCTGTCTCAGATGAGAAGAGGG + Intergenic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991620941 5:68544984-68545006 GTCAGTGTGTGTAGTGAAGATGG - Intergenic
993308939 5:86303944-86303966 CTTTGTGTCTGTCATGAAGAGGG + Intergenic
993493579 5:88582352-88582374 CTCTCTGGCTGAAGTGTAAAAGG + Intergenic
994054771 5:95402778-95402800 CTGTATGTCTGAGGTTAAGAGGG - Intronic
994383031 5:99094327-99094349 AACTGTGTCAGAAGAGAAGAAGG + Intergenic
995850654 5:116542104-116542126 TTCTGTATCTCAAATGAAGAGGG - Intronic
995889934 5:116939773-116939795 TTCTGGGTCTGATGTCAAGAGGG - Intergenic
996839764 5:127835697-127835719 AAGTGTGTGTGAAGTGAAGAGGG + Intergenic
997047463 5:130335644-130335666 GTTTGTGATTGAAGTGAAGAAGG - Intergenic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997654723 5:135546376-135546398 CTTTGCATCTGAAGTGGAGATGG + Intergenic
1000208659 5:159088753-159088775 GTGTTTATCTGAAGTGAAGATGG + Intronic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1002347819 5:178560282-178560304 CTCTATGTCAGACGTGCAGAAGG - Intronic
1002978315 6:2109180-2109202 CACTGGGACTGAAGTGAAGGAGG + Intronic
1003159464 6:3622873-3622895 CTCTGTCTCTGATTTAAAGATGG + Intergenic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1004266797 6:14155248-14155270 CTCTGTCTTTGATGGGAAGAGGG - Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005643897 6:27823556-27823578 CTCTTTGTGTGATGGGAAGATGG + Intergenic
1007187507 6:39984855-39984877 ATATGTGCCTGGAGTGAAGAAGG - Intergenic
1007317549 6:41001573-41001595 CCCTGTGGCTGAAGCAAAGAGGG - Intergenic
1008206124 6:48659518-48659540 CTCTTTGTCTGAACTCAAGGTGG + Intergenic
1008348192 6:50455339-50455361 ATCAATGACTGAAGTGAAGAGGG - Intergenic
1009402368 6:63271969-63271991 TTCAGTGTTTGAAGTGAAAAAGG - Intergenic
1010509418 6:76700113-76700135 CTCCATGTCAGAAATGAAGAAGG - Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1014688438 6:124532394-124532416 CTCTGTGCCTGAAAAGGAGAGGG - Intronic
1014728460 6:125002451-125002473 CTCTAAGTCTCAAGGGAAGATGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1016550089 6:145269838-145269860 CCCTGTATCTGAGGGGAAGAGGG + Intergenic
1018222788 6:161597618-161597640 CTCTCTCTCTGGAGTGGAGAAGG + Intronic
1019017642 6:168891417-168891439 CTTGGTGTCAGAAGAGAAGAGGG + Intergenic
1019029775 6:169000261-169000283 CGCTGTGGGTGAAGAGAAGACGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023085601 7:36567449-36567471 CTCTGTGAATTAAATGAAGATGG + Intronic
1023279154 7:38552262-38552284 CTCTGTTTCTGAAGTGCAGGGGG - Intronic
1023712067 7:43005696-43005718 CTCTGTGATTGATATGAAGATGG - Intergenic
1024906144 7:54382847-54382869 CTCTTTGTCTGAAATGGACATGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025803053 7:64805596-64805618 GGCTGTGTCTCAAGGGAAGATGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029621664 7:101693814-101693836 CTCTGTGTGTGAACTCAACAGGG - Intergenic
1029856173 7:103519188-103519210 CTCTGAGACTGAAATGAAGAAGG - Intronic
1030857390 7:114577691-114577713 TTCTGTATCTGAAGAGGAGATGG - Intronic
1031064055 7:117085130-117085152 CTCTGTGACAGAAGAGAAAAAGG + Intronic
1031301393 7:120065944-120065966 CTCTTTGTCTGAAATGAACAAGG + Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1034009505 7:147513707-147513729 CTATGTCTCTAAAGTGAGGAAGG - Intronic
1035739601 8:1916194-1916216 CTCTGTGTCCTAAGTGCAGACGG + Intronic
1036652780 8:10655645-10655667 CATTTTGTCTGAAATGAAGAAGG - Intronic
1038690732 8:29760735-29760757 CTCTGTGACTGAAGTAAAGTAGG + Intergenic
1038886467 8:31668291-31668313 CTCAGTGGCTGAAATGAAGTGGG + Intronic
1039401949 8:37277476-37277498 CTCTGTGCCGGCAGTGAGGACGG - Intergenic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043817448 8:84819064-84819086 CTCTATGTCTGCAGGGAAAAAGG + Intronic
1044360415 8:91276902-91276924 CTCAGAGTCTGAAGTAAAAATGG + Intronic
1044466933 8:92518115-92518137 CTCTGTCTCTGAATTGCAGCGGG - Intergenic
1044467057 8:92519717-92519739 CTCTGTCTCTGAATTGCAGCGGG - Intergenic
1047192813 8:122693707-122693729 CTCAGTTTCTGAAGTGGACAGGG - Intergenic
1047228649 8:122977393-122977415 CTCTGTATCTGAAAGGAAGAAGG + Intergenic
1047508097 8:125495748-125495770 CTCAGTTTATGAAGTGGAGAGGG + Intergenic
1048034630 8:130665892-130665914 CTCTGAGCCTAATGTGAAGAGGG + Intergenic
1048753279 8:137703860-137703882 CTCTGTGCCTGGAGTCAAGGAGG - Intergenic
1049392215 8:142377736-142377758 CTCTGGGGGTGCAGTGAAGAGGG - Intronic
1049705611 8:144040700-144040722 CTGTGTGTCCGAAGTGTTGAAGG - Exonic
1052512310 9:29437620-29437642 CTCTGTGTGTGTATTGCAGAGGG - Intergenic
1052672378 9:31574511-31574533 CTCAGACTCTGCAGTGAAGAAGG + Intergenic
1053464266 9:38293706-38293728 CTCAGTGTCTGAAGTTCAGCTGG - Intergenic
1054877060 9:70107911-70107933 CTCAGTGTGAGGAGTGAAGAGGG + Intronic
1059007031 9:110414076-110414098 CTCTGTTTTGAAAGTGAAGAAGG + Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1061726964 9:132587315-132587337 CGCTGTGTCCGCAGTGAAGGAGG + Exonic
1203660270 Un_KI270753v1:35085-35107 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1203671037 Un_KI270755v1:12048-12070 CTCTGTTTCTGAAGTTTAAAGGG + Intergenic
1185668362 X:1786521-1786543 CTTTGTGGGTGAAGTGAAGGGGG - Intergenic
1186156934 X:6735289-6735311 ATCTGTGTCCCAAGTGTAGATGG - Intergenic
1186328513 X:8507155-8507177 AGCTGTGTCTGAATTGTAGAAGG + Intergenic
1186824139 X:13321256-13321278 CTCGATGTCTGAAGAGCAGATGG - Intergenic
1186839094 X:13467306-13467328 CCCTGTGTCTGAAGCTAACAAGG + Intergenic
1186931740 X:14398969-14398991 CTCTGTGCCTGATGACAAGACGG - Intergenic
1187217941 X:17295279-17295301 CTCTGTGTATGAAGTGGACAAGG + Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1188343926 X:29040667-29040689 CTCTTTGTTTAAAGTGAAAAGGG - Intronic
1188528813 X:31114762-31114784 CACTGTCTCTGAAGACAAGAGGG + Intronic
1190194880 X:48308317-48308339 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190200786 X:48358758-48358780 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190210977 X:48447634-48447656 CTCTGTGTCTGCAGTGCTGTGGG - Intergenic
1190667606 X:52709199-52709221 CTCTGTGTCTGCAGTGCTGTGGG + Intergenic
1190671812 X:52749209-52749231 CTCTGTGTCTGCAGTGCTGTGGG - Intergenic
1191706333 X:64098155-64098177 CCCTGTCTGTGAAGTGAGGATGG - Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1194376384 X:93138388-93138410 CTCACTGTCTGCTGTGAAGATGG - Intergenic
1198822102 X:140659453-140659475 CTCTGTTTGGGAAGTGAGGAGGG - Intergenic
1199897192 X:152136897-152136919 CACTGTGTCTGTAGAAAAGAGGG + Exonic
1201433791 Y:13933774-13933796 AGCTGTGTCTGAATTGTAGAAGG - Intergenic