ID: 1015237868

View in Genome Browser
Species Human (GRCh38)
Location 6:130991510-130991532
Sequence CTGTAGGATTAGATTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015237868 Original CRISPR CTGTAGGATTAGATTTATGA GGG (reversed) Intronic
905829168 1:41050480-41050502 CCTTAGAATTAGAATTATGAAGG - Intronic
907684972 1:56601534-56601556 GTATAGGAATAGATATATGAAGG - Intronic
907859606 1:58339226-58339248 GTTTAGGATAAGATTCATGAAGG + Intronic
908003653 1:59706800-59706822 CTGTAGAATTAGATTGACAATGG + Intronic
910758256 1:90712856-90712878 CTGTAGGATTTCATTTGTGAGGG - Intronic
911023241 1:93409287-93409309 CTCTTGGATTAGATTTTTAAAGG + Intergenic
911037162 1:93563113-93563135 CTGTGGAGTTTGATTTATGATGG + Intronic
913667949 1:121067410-121067432 CTGTTGCATGGGATTTATGATGG - Intergenic
914658190 1:149762757-149762779 CTGTTGCATGGGATTTATGATGG - Intergenic
914768190 1:150658477-150658499 CTATAGGAGCAGATTTATTATGG - Intronic
918227033 1:182493439-182493461 CTGGAGGCTGAGATTTGTGAAGG + Intronic
918657330 1:187044638-187044660 CAGAAAGATTAGATTTTTGAAGG + Intergenic
920145096 1:203853485-203853507 CTCAAGGTTTAGATTTGTGAAGG + Exonic
921139539 1:212293598-212293620 CTGAAGGATTTTATTTATGTGGG + Intronic
921820204 1:219608520-219608542 CTCAAGGTTTAGATTTGTGAAGG - Intergenic
922400465 1:225249050-225249072 CTGTAAAATAAGATTTATAATGG + Intronic
923513530 1:234674356-234674378 CTGTAGGTGCTGATTTATGAGGG + Intergenic
1068162801 10:53288161-53288183 CTTTAGGATGAAATTTTTGATGG - Intergenic
1069292628 10:66800750-66800772 ACGTAGGATTAAAGTTATGAAGG - Intronic
1070059906 10:72971872-72971894 CTTTAGGATTAGAGTTTTGCTGG + Intergenic
1071728501 10:88223676-88223698 CTGTAGAGATAGATTTGTGAGGG + Intergenic
1072091110 10:92128135-92128157 CTGTAGGATAAATTTTGTGAAGG - Intronic
1074562520 10:114546637-114546659 CTGTAGAATTAGATTTCTAGTGG + Intronic
1075198488 10:120381497-120381519 TTGTATGATCAGATTTATTAGGG + Intergenic
1081215698 11:40394599-40394621 ATGTGGAACTAGATTTATGATGG - Intronic
1081733453 11:45387395-45387417 CTGTAGAATTAGATTAATCAGGG + Intergenic
1083066152 11:59925675-59925697 CTATAGGATTACTTTTAGGAAGG + Intergenic
1087667077 11:101063132-101063154 CTGTAGCATTAGATTTTGGAAGG - Intronic
1088053181 11:105543760-105543782 CTGCATGAAAAGATTTATGAAGG + Intergenic
1088090801 11:106037425-106037447 CTATATGATTAGGGTTATGATGG + Intergenic
1090642249 11:128739643-128739665 CTGTTGAATTTGATTTATTAGGG + Intronic
1091365703 11:135018550-135018572 TTGTACGATTACATTTATGTGGG + Intergenic
1092910203 12:13139701-13139723 ATGAGGGATTAGATTTAGGACGG - Intronic
1094231127 12:28104551-28104573 CTTTAGCAATAGATTTTTGAAGG - Intergenic
1097083742 12:56452257-56452279 CTGTATGATTACATTTATATGGG - Intronic
1097657199 12:62380605-62380627 CTGTAGGATGATATTTGTGTTGG - Intronic
1097790820 12:63813693-63813715 CTGTTGTTTTATATTTATGAAGG - Intergenic
1098557658 12:71837828-71837850 TTGTAGGATGAAATTTAAGAAGG + Intergenic
1098812470 12:75113507-75113529 ATGTAGGTTTATATTTATAAAGG + Intronic
1099417111 12:82404522-82404544 CAGTAGGGTAAGATTTATGTAGG + Intronic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1099745277 12:86694650-86694672 CAGTAGGATTTGAATTATCAAGG + Intronic
1099810589 12:87577673-87577695 CTGTAAGATCAGCTTCATGAGGG - Intergenic
1100109923 12:91228219-91228241 AGATAGGATTACATTTATGAAGG + Intergenic
1100414541 12:94357713-94357735 CTATAGGATTACTTTTAGGAAGG + Intronic
1102112842 12:110378050-110378072 CTGTAGGGCTAGGTTTAAGATGG + Intronic
1102334465 12:112066195-112066217 CTTTTAGATGAGATTTATGAAGG - Intronic
1104159618 12:126165657-126165679 CTGGAGGATTGGAATTAGGATGG - Intergenic
1105289732 13:19045015-19045037 ATGTAGGTATGGATTTATGAAGG - Intergenic
1105591078 13:21793280-21793302 GTGTAGGATTATATTTATGTGGG + Intergenic
1106899024 13:34335302-34335324 CTGTTGGACTAGATTTAGGAAGG + Intergenic
1109079245 13:57876928-57876950 CTGTATGATTATATTCATGGGGG + Intergenic
1110573723 13:77033400-77033422 CTGTTGGATTTGATTAATAAAGG - Intergenic
1115229553 14:31145219-31145241 CTGTTGCATTAGAGTTATGCTGG - Intronic
1119350828 14:73963900-73963922 CTGTAAGAATAGATTTCTCATGG - Exonic
1122652973 14:103236157-103236179 CAATAGGATTAGTTTTAGGAAGG + Intergenic
1124140413 15:27072502-27072524 CTGTAGGATTCATTTTATTAGGG + Intronic
1127025004 15:54794877-54794899 CTGTAACAATAGAGTTATGATGG + Intergenic
1130435830 15:83898459-83898481 CTGGAGTATAAGATTTTTGAGGG + Intronic
1130702932 15:86204028-86204050 GTGAAGGATGAGACTTATGATGG + Intronic
1130755619 15:86760066-86760088 CAGTGGGATAAAATTTATGATGG - Intronic
1130811960 15:87389211-87389233 CTGTGTGATTCGATTTATGCAGG + Intergenic
1135343871 16:21671240-21671262 CTGTAAAATGAGATTAATGATGG - Intergenic
1136512411 16:30747361-30747383 CTTTGGGATTACAATTATGAGGG - Intergenic
1137924386 16:52526166-52526188 CTTGATGAATAGATTTATGAGGG - Intronic
1139476652 16:67206170-67206192 GTGTATGATCAGATTTATGTCGG - Intergenic
1141039914 16:80664316-80664338 CCGGAGGATTAGATGTGTGAAGG - Intronic
1143239164 17:5429396-5429418 CTGGAGCATTAGGTTCATGAGGG + Intronic
1151138906 17:71973108-71973130 CTGTAGGCTTAGACTTTAGAGGG + Intergenic
1157253669 18:46118512-46118534 TTCCAGGATTAGATTTATGAAGG + Intronic
1158383130 18:56957758-56957780 GTGTACGCTTAGATTTAAGATGG + Intronic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1162833819 19:13303342-13303364 CTGTAGAATTTGCTTGATGAGGG + Intronic
1163085743 19:14978850-14978872 CTGTAAGATTTAATTCATGAAGG - Intronic
1164125195 19:22308223-22308245 CTGTGAGATTATATATATGATGG - Intronic
929768952 2:44875303-44875325 GTGTAGGATTTGTTTTAAGAGGG + Intergenic
933242823 2:79942126-79942148 CTGTAAGATTTGATTAATAATGG - Intronic
935236874 2:101146503-101146525 CTGAAGGATTTGATTTTTCAGGG - Intronic
935771114 2:106422117-106422139 CTATGGGATTAGATTTAAAAAGG + Intronic
937191875 2:120110136-120110158 CTGTGGGATTAGAAATATGCAGG - Intronic
938965365 2:136383419-136383441 CTGAAGGATAAGATCTATTATGG - Intergenic
939411355 2:141829032-141829054 CTGTAGAATAAGATATATAAAGG + Intronic
942653012 2:178188455-178188477 CTGATGGATTGGATTTCTGATGG - Intergenic
944547657 2:200812918-200812940 CTGAACAATTAGGTTTATGACGG + Intronic
944972562 2:205010980-205011002 CTGTATGTTTATATTTAAGAAGG + Intronic
945457461 2:210066088-210066110 GTGTAGGATTTAATTTAGGAGGG - Intronic
1169533868 20:6515514-6515536 ATGGAGGATTACATTAATGAGGG - Intergenic
1169876467 20:10302691-10302713 CTGTAGGACTTTATTTATGATGG - Intronic
1170271643 20:14533492-14533514 CTCTAGGTTTAGGTTTATGGTGG + Intronic
1170527782 20:17258397-17258419 CTATAGCAGTAGATTTTTGAAGG + Intronic
1172921149 20:38483459-38483481 CTGTAGTATTACATATAAGATGG - Intronic
1174081064 20:47971072-47971094 CTGTAGTATTAAATTCATGGTGG + Intergenic
1177912942 21:27054287-27054309 ATTTAGAAATAGATTTATGAGGG + Intergenic
1178544844 21:33484464-33484486 CTGGAGGATCAGAGTTATCATGG + Intergenic
949912053 3:8919447-8919469 CTGTTGGATCATTTTTATGATGG - Intronic
953874024 3:46654499-46654521 CTGTATGATTCTATTAATGACGG + Intergenic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
955566873 3:60256730-60256752 ATGTATGATTAGAATTATGATGG - Intronic
955794074 3:62617582-62617604 ATGTGTGATGAGATTTATGAAGG + Intronic
956349325 3:68317389-68317411 CTTTAGCCTTAGATTTAGGAAGG - Intronic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
958126915 3:89368378-89368400 ATGTAAGAGGAGATTTATGATGG + Intronic
958914572 3:100034664-100034686 CAGTGAGTTTAGATTTATGATGG + Intronic
960190776 3:114702602-114702624 TTTTAGGATTAGATTTCTGAGGG - Intronic
966504327 3:180682198-180682220 CTATATGATTATATTTATGTAGG - Intronic
967157697 3:186708559-186708581 CTGTAGAATTAGAGTCATGAGGG - Intergenic
972080572 4:35143943-35143965 TTATAGGAGTAGATTTATTATGG - Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972193874 4:36629058-36629080 CTGGAAGATTAGATGAATGATGG - Intergenic
975098444 4:70484555-70484577 CTGTAGGGTTATATTTAGAAAGG - Intergenic
975889811 4:79014042-79014064 CTGCACGATTAAATTTTTGATGG + Intergenic
976557484 4:86466118-86466140 TTATAGGAGTAGATTTATTATGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979652653 4:123153593-123153615 CTGTAAAATTATATTTATAAGGG + Intronic
980062545 4:128147483-128147505 CTGGTGGGTTTGATTTATGAAGG + Intronic
981306483 4:143251914-143251936 CTGTAGGATTATCTTTTTCAAGG + Intergenic
981736674 4:147960583-147960605 TTTTAGGATGAGATTTATTATGG + Intronic
982442952 4:155458044-155458066 CAGTAGGATTAGAATAAAGAAGG + Intergenic
983477939 4:168238583-168238605 CTGTGGGATGATATTTTTGAGGG + Intronic
984318152 4:178156324-178156346 CTGCAGAAATAGATTTTTGATGG + Intergenic
986053342 5:4110854-4110876 CTGCAGGATTAGATGTGGGAGGG + Intergenic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
994492820 5:100469883-100469905 CTGTATGATTTCATTTATGTGGG + Intergenic
994691855 5:103029309-103029331 TTGTTAGATTAGAATTATGATGG - Intronic
995711170 5:115037297-115037319 TTGTAGGAGTAGATTTATTATGG + Intergenic
995931175 5:117447162-117447184 TTGTAGGTTGAGATTTATCAAGG + Intergenic
996291684 5:121859462-121859484 CTATAGGATTACTTTTAGGAAGG - Intergenic
996360756 5:122643072-122643094 CTGTAGGCTTTGGTTTATTATGG - Intergenic
997170276 5:131712349-131712371 CTGTAGGATTAGATATATGGAGG - Intronic
998204663 5:140149943-140149965 CTTTAGGATGAGACTGATGAGGG + Intergenic
999371878 5:151060666-151060688 CTGTAGGATTGCATTTTTTAAGG + Intronic
1003267766 6:4581423-4581445 CTGTAGGATTAGGTATACGTGGG - Intergenic
1009565429 6:65306042-65306064 CTCAAGGTTTAGATTTGTGAAGG + Intronic
1009667307 6:66700761-66700783 ATATAAGATTAGATTTATAAAGG + Intergenic
1010158311 6:72821520-72821542 CTGTAGCATTTCATTTGTGATGG - Intronic
1010322661 6:74530684-74530706 ATGATGGATTAGATTTTTGATGG - Intergenic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1013784645 6:113765788-113765810 CTGGAGGATCTGTTTTATGATGG - Intergenic
1014051456 6:116960159-116960181 GTGTAAGATTAGATTTTTCATGG + Intergenic
1014810969 6:125885209-125885231 CCAGAGGATCAGATTTATGAGGG - Exonic
1014921225 6:127215904-127215926 ATGTAGGATGAGGTTTATAATGG - Intergenic
1015207414 6:130655586-130655608 ATTTAGGCTTAGATTTATCATGG + Intergenic
1015237868 6:130991510-130991532 CTGTAGGATTAGATTTATGAGGG - Intronic
1016192306 6:141285677-141285699 CTTTGGTATTAGATTAATGATGG + Intergenic
1016219951 6:141655673-141655695 CTCTAGAAATAGATTTGTGAGGG + Intergenic
1016504388 6:144762342-144762364 ATGAAGGATTATATTTAGGAAGG + Intronic
1018018548 6:159735095-159735117 CTGTAGGAATATTTTTATTAAGG + Intronic
1018222501 6:161595066-161595088 TTGTAGGTTTAGATTTCTCACGG - Intronic
1020648115 7:10840816-10840838 GTGTAGGATTAGAGCTATGGTGG + Intergenic
1024911328 7:54450319-54450341 CTATAGGATTACTTTTAGGAAGG + Intergenic
1025168037 7:56730531-56730553 CAGGTGGATTAGATTTCTGATGG + Intergenic
1030122389 7:106122744-106122766 CTGCAGGGTTAGAATTAGGAGGG - Intergenic
1030862514 7:114653440-114653462 CTATTGAATTAGATTGATGATGG + Intronic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1033729164 7:144157690-144157712 AAGGAGAATTAGATTTATGAGGG - Intergenic
1034942723 7:155242024-155242046 CAATAGGATTAGTTTTAGGAAGG - Intergenic
1038681104 8:29669442-29669464 AGGTAGGATTAGATGGATGATGG - Intergenic
1040384216 8:46902613-46902635 CTATAAGATTAGTTTTATTATGG + Intergenic
1040609081 8:48964433-48964455 CAGTAGGATTACTTTTAGGAAGG + Intergenic
1043616880 8:82136461-82136483 CTGTATTATAAGCTTTATGAGGG + Intergenic
1044756222 8:95464447-95464469 CTGTAGGTGAAGATTTAAGAAGG + Intergenic
1045780638 8:105858909-105858931 TTCTAGGATTATAATTATGATGG - Intergenic
1046610830 8:116423719-116423741 CTGAAGGATTACAATTATGTTGG + Intergenic
1051577833 9:18637452-18637474 CCATAGGAGTAGATTTAAGAGGG + Intronic
1052432563 9:28385934-28385956 CTGTAGTATTTTATTAATGATGG - Intronic
1058103199 9:100938798-100938820 CTGTAGAATTAAATTCAAGATGG - Intergenic
1058382327 9:104390716-104390738 GTGGAGGCTTAAATTTATGAAGG - Intergenic
1187577563 X:20574662-20574684 CTAGAGTATTAGATCTATGAGGG - Intergenic
1188162839 X:26823107-26823129 TTGTAGGATTGAAGTTATGAGGG + Intergenic
1190617850 X:52255600-52255622 CTTTGGTATTAGGTTTATGATGG + Intergenic
1195322746 X:103733363-103733385 CTGTAGGGTTGGATTATTGAAGG - Intergenic
1196472111 X:116040215-116040237 TTATAGGAGTAGATTTATTATGG - Intergenic