ID: 1015239011

View in Genome Browser
Species Human (GRCh38)
Location 6:131003490-131003512
Sequence GTAAGCCCAGTCTTCAATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015239009_1015239011 3 Left 1015239009 6:131003464-131003486 CCAATCAGAGTTGTCTTAGAAAC 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG 0: 1
1: 0
2: 0
3: 6
4: 83
1015239008_1015239011 21 Left 1015239008 6:131003446-131003468 CCTCTTCGAAATACACTGCCAAT 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015239011 Original CRISPR GTAAGCCCAGTCTTCAATTA GGG Intronic
905604067 1:39280948-39280970 GGAAGACCAGCCTTCAAATAAGG + Intronic
907173079 1:52490024-52490046 GCAAGATCAGTCTTCAATTTAGG + Intronic
907199421 1:52713605-52713627 GTAAGCTCAGGCTTCAAACAGGG + Intergenic
912761371 1:112370566-112370588 GCAAGGCCAGGCTTCAGTTACGG - Intergenic
916559574 1:165921941-165921963 GAAAGGACAGTCTTCAATTATGG - Intergenic
918606627 1:186435173-186435195 GTAATCTCAGTTTTCAATTATGG - Intergenic
923323482 1:232859519-232859541 GCAAGCCCAGTCTTAAACTGGGG + Intergenic
1067272166 10:44802007-44802029 GGAAGCACAGTCTTCTATTAGGG + Intergenic
1067835034 10:49633134-49633156 CCAACCCCAGTCTGCAATTAGGG - Intronic
1067895397 10:50174194-50174216 GTAGGCCTAGTTTTAAATTAAGG - Intergenic
1067953586 10:50767784-50767806 GTAGGCCTAGTTTTAAATTAAGG + Intronic
1076430533 10:130398840-130398862 GTAATGCCTGTCTTCACTTAGGG + Intergenic
1080422194 11:32120322-32120344 TTAAGCCCAGTCTCCAACTTTGG - Intergenic
1080870501 11:36232777-36232799 GACAGCCCAGTCTTCATTTGAGG - Intergenic
1087512862 11:99120354-99120376 GGAGGACCAGTCTTCAATAAAGG + Intronic
1091400630 12:178638-178660 GGAACCCCTGTCTTCAATAAAGG + Intergenic
1092572890 12:9744651-9744673 GTAACTCCAGTCTCCAAGTAGGG + Intergenic
1093490294 12:19697649-19697671 GTCAGCCCAGTATTGAATTATGG - Intronic
1094163769 12:27420961-27420983 GTAAGCCCTATCCTCAATTAAGG - Intronic
1099905983 12:88770641-88770663 TTATGCCAAGTCTACAATTAAGG - Intergenic
1101014388 12:100484495-100484517 GTAACCTAAGTCTTCATTTAAGG - Intronic
1101724315 12:107376453-107376475 ATAAGCCCATTGTTCAGTTAAGG - Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1109622946 13:64932846-64932868 GTAATCACAGTCTTCAAATCTGG + Intergenic
1112791077 13:103002670-103002692 CTTACCCCAGTCTTCAATGAAGG + Intergenic
1117019646 14:51556748-51556770 GTGAGCTCACTCTTCAATGATGG - Intronic
1120635278 14:86943675-86943697 GTAACCGCTGTCTTCAATTTGGG + Intergenic
1124422420 15:29534354-29534376 GGAAGCCCAGTTTTCCATTTTGG - Intronic
1131878969 15:96842234-96842256 GGAAGACCAGTCTTCAGTCATGG + Intergenic
1137785114 16:51132138-51132160 TTAAGCCCAGTCTTAAAGTTTGG - Intergenic
1138090807 16:54172883-54172905 GGAACCCCAGTCTCCAATAAGGG - Intergenic
1138370668 16:56524140-56524162 CAAAGCCCAGCCTTCAATAAGGG + Intergenic
1139523592 16:67499476-67499498 GTAACCTCAGTCTTCAGTTGGGG - Intergenic
1140809106 16:78559881-78559903 GTAAGCCAAGTCATAAATTGAGG - Intronic
1143390989 17:6559127-6559149 GTTATCCCTTTCTTCAATTAAGG - Intergenic
1148697424 17:49569637-49569659 GTAATCCCAGTATTCTATTTTGG - Intergenic
1149459226 17:56813423-56813445 GTGATCCCAGACTTCAATCATGG + Intronic
1156914162 18:42446081-42446103 ATAAGCCCAGTCCTCACTTCTGG + Intergenic
1158334116 18:56395849-56395871 GCAAACCAAGTCTTCAATCATGG - Intergenic
1159428157 18:68315871-68315893 GTAAGCCCATACTTCTATCAAGG + Intergenic
927483311 2:23471207-23471229 GTAACCACACTCTCCAATTATGG - Intronic
930188529 2:48434231-48434253 GTTAGCCCAGTAATCAAGTATGG + Intergenic
932442201 2:71744563-71744585 GTAAGGCCAGTCATTAGTTAGGG - Intergenic
932444195 2:71763696-71763718 GTAGGCCCAGGCTGCACTTAAGG + Intergenic
935976056 2:108580125-108580147 TTCAGCCCATTCTTCAATTCTGG - Intronic
939403623 2:141728376-141728398 GTGAGCCCTGACTTCAATCAGGG + Intronic
941744955 2:169077567-169077589 TTTAGCACAATCTTCAATTACGG - Intronic
945187465 2:207154218-207154240 GTAAGCTCAGTCATCAGGTAAGG + Intronic
1168807155 20:678341-678363 GTTGGCCCAGTCTGCAATGATGG - Intergenic
1173115080 20:40233728-40233750 GAAAGCCCAGTCTTCACCCATGG + Intergenic
1173439512 20:43063497-43063519 GTAGGACCAGTCTTCAGTAAAGG + Intronic
1177091191 21:16770760-16770782 GTAAGACCAGTTTTGAATCAAGG - Intergenic
952136104 3:30422484-30422506 GTAAGTCCAGTCTTGACTCAAGG + Intergenic
957932771 3:86903532-86903554 GTTACCCCAGTCTTCATTTTGGG - Intergenic
958106731 3:89083994-89084016 GTAAGCACAGTCCTCAGTGAGGG - Intergenic
958555467 3:95670169-95670191 GAATGCTCAGTCTTCAATAAAGG + Intergenic
958563012 3:95772726-95772748 GTAAGCCCAGACTGCTAATAAGG - Intergenic
965448853 3:168811471-168811493 ATATGCCAAGTTTTCAATTAGGG + Intergenic
966769749 3:183493154-183493176 GTAAGCAGACTCTTCCATTATGG + Intronic
967157321 3:186705435-186705457 GTAAGCCCAGTCGTGAACCATGG + Intergenic
967277863 3:187794364-187794386 TTGAGCCAAGTCTTCAATTGTGG - Intergenic
967597691 3:191346947-191346969 GGAAGCCCAGTCTGCCATTTAGG + Intronic
971846962 4:31931370-31931392 GTAATCACAGTCTGCAATTCTGG - Intergenic
973587095 4:52404317-52404339 GTAAGCACTGTATTCAATAAGGG - Intergenic
980955143 4:139420373-139420395 GAAACACCAGTCTTCAATAAAGG - Intergenic
982348429 4:154387164-154387186 TTAAACTCATTCTTCAATTAAGG - Intronic
984156423 4:176200540-176200562 GGAAGCCCAGTCTTTTATAATGG + Intergenic
993507758 5:88732322-88732344 GTATGCCCTTTCTTCATTTAAGG - Intronic
994477785 5:100291796-100291818 GAAAACACAGTCTTCAATCATGG - Intergenic
994519009 5:100805996-100806018 GTATGCCCAGTTTTTAATTCTGG + Intergenic
996533343 5:124549520-124549542 GAGAACCCAGTCTGCAATTAAGG - Intergenic
998064986 5:139150825-139150847 CAAAGCCAAGCCTTCAATTATGG + Intronic
998165626 5:139841413-139841435 GTAAGCCAAGTGTTCATTGATGG - Intronic
1005382690 6:25253091-25253113 GTAAGCCCTGGCTCCAATGATGG + Intergenic
1011028962 6:82900328-82900350 CTATGCCCAGTCTTACATTAAGG + Intronic
1012230174 6:96751693-96751715 GTAGGCAGAGTCTTCAATTGGGG + Intergenic
1014704902 6:124733947-124733969 CTAACACCAGTCTTCAATAAGGG + Intronic
1015239011 6:131003490-131003512 GTAAGCCCAGTCTTCAATTAGGG + Intronic
1018649213 6:165977524-165977546 TTAAGCACAGACTTCTATTATGG + Intronic
1030161906 7:106517923-106517945 GTAAGCCCAGAAATCAACTAGGG + Intergenic
1030567312 7:111174933-111174955 GTAAGCCTAGTATTCCATCAGGG - Intronic
1041975601 8:63795705-63795727 CTAAGGCCAGTCCACAATTAAGG + Intergenic
1043169977 8:76953833-76953855 AGAAGCCCAGACTTCCATTATGG + Intergenic
1047896618 8:129373540-129373562 GGAAGCACTGTCTTCAGTTAGGG - Intergenic
1050190762 9:3023439-3023461 GGAAGCCCAGTCTTCCTTTTGGG - Intergenic
1051054214 9:12964705-12964727 GTAAGTACAGTCTTTAATTAAGG - Intergenic
1051978474 9:22983499-22983521 CTAAGCTCACTCTTAAATTAAGG + Intergenic
1056265074 9:84888911-84888933 GGAAGCCCAGCCTTCATTTTTGG + Intronic
1061446207 9:130639652-130639674 CAATGCTCAGTCTTCAATTAAGG - Intergenic
1196242216 X:113354940-113354962 GTACACACAATCTTCAATTAAGG + Intergenic