ID: 1015239432

View in Genome Browser
Species Human (GRCh38)
Location 6:131007028-131007050
Sequence TTGGGTGCACATCTGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015239432 Original CRISPR TTGGGTGCACATCTGAAGTA AGG (reversed) Intronic
901054982 1:6445080-6445102 GTGCGTGCATATCTGTAGTATGG - Intronic
902360309 1:15938893-15938915 GTGGGTGTACATGTGAAGGAAGG - Intronic
902479376 1:16703523-16703545 GTGTGTGCATATCTGTAGTATGG + Intergenic
902646738 1:17804841-17804863 GTGGGTGATCATCTGAAGTCAGG - Intronic
905314645 1:37074181-37074203 TTGGGTGTAGCTCTGAAGTCAGG + Intergenic
905881534 1:41467317-41467339 TGGGGTGCACTTCTGGAGAAAGG + Intergenic
909784417 1:79593228-79593250 TTGGTTGCACAGCTGGAGAAGGG - Intergenic
914136504 1:144905419-144905441 TGGGGCACACATCTTAAGTAGGG - Intronic
914331823 1:146679231-146679253 TTGGGGGCACATTTTAGGTAAGG + Intergenic
923306973 1:232697341-232697363 GTGTGTCCACAGCTGAAGTACGG + Intergenic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1063446351 10:6120343-6120365 TTGGATACAGATCTGAAGTTTGG - Intergenic
1064273949 10:13890284-13890306 TTTGCTGCACATTTGAAGGACGG + Intronic
1069995188 10:72337404-72337426 GTGGGTGCACATCTTCAGTGGGG - Intronic
1072091354 10:92130746-92130768 CTTGGTGCAGATTTGAAGTAGGG - Intronic
1078433610 11:11306653-11306675 TTGAGTGCTCATCTGTGGTATGG - Intronic
1086412145 11:86553601-86553623 TTGGGTAATCATCTGAAGAAGGG + Intronic
1090437979 11:126702750-126702772 TAGGGTGCACATTTAAAGTGTGG - Intronic
1091022799 11:132116122-132116144 TTGGTTGCACATGTGATGCAAGG + Intronic
1091856154 12:3742054-3742076 TTGAATGCACATCTGAGGTTAGG + Intronic
1094782976 12:33814329-33814351 TTGGGTTCAAAACTGGAGTAAGG + Intergenic
1100310684 12:93392109-93392131 GTGGGTGGACATCTGAGGTCAGG - Intronic
1103821992 12:123706179-123706201 ATGGGTGCACCTCTGGATTAGGG + Intronic
1104141776 12:125994374-125994396 TTAGGTGCACATCTGAGGAAAGG + Intergenic
1120219585 14:81717156-81717178 GTGGCTGCACATCTGAACTGTGG - Intergenic
1122133345 14:99618827-99618849 AGGGGTGCACATCTGGTGTATGG + Intergenic
1126197971 15:45952923-45952945 TTGAGTGTACCTCTGAAGTGAGG + Intergenic
1129760480 15:78126370-78126392 TTGGGTGAACACCTGAGGTCAGG - Intronic
1133759074 16:8783702-8783724 TTGGGTGCAAATATTCAGTATGG + Exonic
1133957409 16:10456702-10456724 TTGGGTGCTCATCTGACATCTGG - Intronic
1135086503 16:19478828-19478850 TTGGGTGCACAGCCCAAGGATGG - Intronic
1140001729 16:71031673-71031695 TTGGGGGCACATTTTAGGTAAGG - Exonic
1146673390 17:34757046-34757068 TTGAGTGCACGTCTGAATTGAGG - Intergenic
1148143705 17:45346322-45346344 TTGGGAGCACATCCAAAGCAAGG + Intergenic
1158753879 18:60299341-60299363 TTGTGTGCAAAGCTGAATTAAGG + Intergenic
1158928950 18:62302093-62302115 TTGAGTTCACATCTGAAATACGG - Intronic
1162997916 19:14348231-14348253 TTGGGTGCACATTTGTGGAATGG - Intergenic
1165044490 19:33093977-33093999 TGGGGTGCACACCTGAACTGGGG - Intronic
1202713415 1_KI270714v1_random:29429-29451 GTGTGTGCATATCTGTAGTATGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929957161 2:46466767-46466789 TTGGGTGAACTTCTCAAGTCAGG + Intronic
930389528 2:50743474-50743496 TTGGGAGAATATCTGAAGAAAGG + Intronic
930480344 2:51941246-51941268 TTGTGTGTACATCAGAGGTAGGG + Intergenic
933477940 2:82816696-82816718 ATGGGTGCAAATGTGAAGGAAGG - Intergenic
936371876 2:111908631-111908653 TTGGTTACACCACTGAAGTAAGG - Intronic
937861001 2:126709120-126709142 TTTGGCACACATCTGAAGTATGG - Intergenic
939392736 2:141589862-141589884 TAGGGTGCACATCTGGAGAAAGG + Intronic
946437841 2:219670084-219670106 GTGGGTGCACATTTGAGTTAGGG + Intergenic
947042938 2:225944699-225944721 TTGGGTGGACATCTGCACCATGG + Intergenic
1175227986 20:57456096-57456118 GTGGGTGCGCATCTGACCTAGGG + Intergenic
1179469306 21:41599996-41600018 TTGGGTGCAATTATGAAGGAAGG - Intergenic
1180597920 22:16991251-16991273 CTGGTTGCACATCAGAATTAAGG - Intronic
1182492853 22:30685063-30685085 TTGGGTTCAGTTCTGAAGCAGGG + Intergenic
1183696459 22:39426455-39426477 TTGGGTGCACACCTCTAGGATGG - Intronic
1184487095 22:44786317-44786339 GTGGGTGCACGGCTGAGGTAGGG + Intronic
949491197 3:4590739-4590761 TTGGGGGTACATGTGAAGCATGG + Intronic
951862837 3:27273027-27273049 CTGGGTTAACATCTGAAGGAAGG + Intronic
954077443 3:48191148-48191170 CTGGGTGCACCTCTGAACTATGG - Intergenic
956465994 3:69521178-69521200 GTGGGTGCACATCTGCTGTGTGG - Intronic
956594968 3:70957617-70957639 GTGGGTGCAGAGCTGAAGTGTGG + Intronic
958690115 3:97454638-97454660 TTGGGGGCACATTTTAGGTAGGG + Intronic
959209500 3:103358874-103358896 TTGGGATCAAAACTGAAGTATGG + Intergenic
961710106 3:128821869-128821891 TTGGGTACACATCTCAAGAGGGG - Intergenic
969695097 4:8729784-8729806 TTTGGGGGACATCTGAAATACGG - Intergenic
972503645 4:39700298-39700320 TTTGATGCTTATCTGAAGTAAGG - Intronic
972834004 4:42846677-42846699 TTGGGTGCTCTTATGAAGTCTGG + Intergenic
973185147 4:47318247-47318269 TGGGGAGCACTTCTTAAGTATGG - Intronic
974411297 4:61544209-61544231 TTGGGTGCAGCTATGAAGAAAGG - Intronic
975208566 4:71672417-71672439 TTGAGTGGAGATCTGAAGAAAGG + Intergenic
978177913 4:105756373-105756395 TTGGGTGGACTTCTGAACAAGGG - Intronic
981903345 4:149891781-149891803 TTCTGGGCAGATCTGAAGTAGGG - Intergenic
982475536 4:155845192-155845214 ATGGCTGCACTTCTGAAATATGG + Intronic
984373975 4:178902942-178902964 TTGGGTGCTCTTAGGAAGTAAGG + Intergenic
984418788 4:179493001-179493023 TTTGCTGCACCTCTGAAGTCAGG - Intergenic
987303729 5:16618585-16618607 TTGGATGCACAGTTTAAGTAAGG - Intergenic
988470328 5:31531854-31531876 TTAGCTGCAGATCTGAAGTGGGG + Intronic
988498430 5:31764234-31764256 TTGTTTTCACATCTGAAGGAAGG - Intronic
989165141 5:38426460-38426482 TTAGGTCCAAATCTGAATTAGGG - Intronic
990328602 5:54703174-54703196 TTGGCAGCACATGTGAAGTCTGG + Intergenic
997031144 5:130130235-130130257 TTGTGTGTACATCTGATGTCAGG - Intronic
1002048436 5:176555247-176555269 TGGGGTCCACATCTGAACTGGGG + Intronic
1002453961 5:179335774-179335796 TTGGGAGCACATGGAAAGTAGGG - Intronic
1003151129 6:3549885-3549907 TTGGCTGCACATGTCAAGAAAGG - Intergenic
1013211463 6:107990647-107990669 TTGGGAGCAAAGCTGAGGTAGGG + Intergenic
1015006177 6:128284499-128284521 TTGAGTGAACATTTGAAGCAGGG - Intronic
1015239432 6:131007028-131007050 TTGGGTGCACATCTGAAGTAAGG - Intronic
1015760105 6:136649456-136649478 ATGGGTGCACATCAGAATCATGG + Intronic
1027348535 7:77287206-77287228 ATGGGAGCACATCAGAAGAATGG + Intronic
1028220407 7:88190075-88190097 TTGGGTGCAGAACTGAACTGAGG + Intronic
1032506623 7:132439953-132439975 ATGTGTGCACATGTGAAATAAGG - Intronic
1032921300 7:136550894-136550916 ATGTGTGGACATCTGAAGCATGG + Intergenic
1035663941 8:1366447-1366469 GTGGGTCCCCATCTGAAGTGGGG + Intergenic
1040472115 8:47742466-47742488 TTGGGTGGCCATCTGGAGAATGG - Intergenic
1045202625 8:100000430-100000452 TTGGCTGCACAACTGAAATCTGG + Intronic
1045240741 8:100398951-100398973 CTTGGTGCATATCTGAAGTCAGG - Intronic
1046528868 8:115418180-115418202 TTGAGTGCACATGTGATTTATGG - Intronic
1046659534 8:116934228-116934250 TTGAGAGGACATCTGAAGTCGGG + Intergenic
1047290040 8:123521835-123521857 TTGGGTGCCCATCTATAGGAAGG + Intronic
1047459877 8:125052915-125052937 TTCTGAGCACATTTGAAGTAGGG - Intronic
1051386766 9:16517890-16517912 TGGTTTACACATCTGAAGTATGG - Intronic
1055450197 9:76424301-76424323 TCGGGTGCACATTTGAACTAGGG + Intronic
1060678066 9:125534876-125534898 CTGGGTGCACATGGGAAGCAGGG - Intronic
1188544114 X:31284171-31284193 TTGTGTGGATACCTGAAGTATGG + Intronic
1192429382 X:71102106-71102128 CTGGCTCCACATCTGAAGCAGGG - Exonic
1197387965 X:125824162-125824184 CTGGGTGAACATCAGAATTAAGG - Intergenic
1199132989 X:144216317-144216339 CTGGGTGAACATCTGAATTAAGG - Intergenic