ID: 1015239511

View in Genome Browser
Species Human (GRCh38)
Location 6:131007621-131007643
Sequence CAAAATGCTGATAGTAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 9, 1: 53, 2: 87, 3: 87, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015239506_1015239511 7 Left 1015239506 6:131007591-131007613 CCTCCTAGAGACTTGTTGAATGG 0: 131
1: 141
2: 110
3: 60
4: 101
Right 1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG 0: 9
1: 53
2: 87
3: 87
4: 351
1015239508_1015239511 4 Left 1015239508 6:131007594-131007616 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG 0: 9
1: 53
2: 87
3: 87
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015239511 Original CRISPR CAAAATGCTGATAGTAATAT GGG Intronic
904777935 1:32923152-32923174 CATAATGCTGCTATAAATATTGG - Intergenic
904796368 1:33059285-33059307 CAAAACCTTGATAGGAATATGGG + Intronic
904928641 1:34068464-34068486 CAACATGCTAATAATAACATGGG - Intronic
906630599 1:47364063-47364085 CAAAATGCTGCAGGTACTATGGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909241986 1:73224742-73224764 CAAAATGCAGATACCAATAGCGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
910006664 1:82405426-82405448 CAGAAAGGTGATAGGAATATGGG - Intergenic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912080553 1:105931362-105931384 CAAAATGCTAATAGCCAAATGGG + Intergenic
912089478 1:106053594-106053616 AAAAAGGCTGATTGTCATATGGG - Intergenic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912990040 1:114476856-114476878 CAAAATCCAGATAGTTATACAGG + Intronic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
915555905 1:156660700-156660722 GCAAAGGCTGATAGTAATACGGG + Intergenic
916223886 1:162470766-162470788 CATAATGCTGCTATTAACATGGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916626697 1:166565755-166565777 CAACAAGCAGATAGTAGTATTGG + Intergenic
917890428 1:179432373-179432395 CAAAGTGCTGATTGTAAACTTGG + Intronic
917990746 1:180375996-180376018 CAAAAACCTGATAGAAAAATGGG + Intronic
918484541 1:185015465-185015487 CAAAATGCTAGTACTAATAAGGG - Intergenic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
919290915 1:195629236-195629258 GAATCTGCTGATAGTCATATAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920790863 1:209089900-209089922 CAAAATGCTTAAAGAAATAATGG + Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
924785305 1:247191407-247191429 CAAAGTGCTGAAAGGAATAGTGG + Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065401167 10:25303089-25303111 GTAAATGCTGATAGTAATTTAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066679984 10:37928962-37928984 AATAATGCTGCTAGTAACATTGG + Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298859 10:55112675-55112697 TAACATGCTGATCGTCATATGGG - Intronic
1070465493 10:76718854-76718876 CAAAATGCTGGCAGGAATAGGGG - Intergenic
1070818304 10:79339239-79339261 CAAAGTGCTGAGATTAATTTGGG + Intergenic
1071324921 10:84504187-84504209 CTAAATGCTCATATTTATATGGG - Intronic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072312119 10:94166644-94166666 CAAAATGCTGAGTGTAACAGAGG + Intronic
1072374924 10:94804463-94804485 CAAGATGCTGCTTTTAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074409003 10:113208050-113208072 AAATATGCTGATAGTATTATGGG - Intergenic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078885811 11:15498708-15498730 ATAAAAGCTGATAATAATATTGG - Intergenic
1079137506 11:17784208-17784230 CAAAAAGCCGTTAGGAATATGGG + Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080292490 11:30686692-30686714 CAAAATGCTGGTTGTAACAACGG - Intergenic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1080729275 11:34932234-34932256 CAAAATCCAGATTATAATATGGG + Intronic
1080737312 11:35029090-35029112 CAAGATTCTGAGAGTAAGATTGG + Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1081395617 11:42582833-42582855 CAAGATGCTATAAGTAATATGGG + Intergenic
1081823296 11:46021810-46021832 CAAAGTGCTGAGATTATTATAGG + Intronic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1085969631 11:81571665-81571687 CAACAGGCTGATAGTAGAATGGG + Intergenic
1086827358 11:91516001-91516023 CAAAATGGGGGTCGTAATATCGG + Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087392399 11:97554258-97554280 CAAAATATTGTTAGTATTATTGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088800717 11:113304836-113304858 CAAAATGTTAATAGTACTGTTGG + Intergenic
1088826460 11:113498672-113498694 CCAAAACCTGATAGAAATATTGG + Intergenic
1089239879 11:117068383-117068405 TGAATTGCTGACAGTAATATGGG - Intronic
1089780266 11:120868844-120868866 CAAAGTGCTGAGATTATTATAGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093451252 12:19317502-19317524 AAAAATGCTCATAGGACTATAGG - Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095067589 12:37798791-37798813 CAAACTGCTGAAAGAAATAAAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095374395 12:41508688-41508710 CAAAATGGTAAAAGTAATACAGG - Intronic
1095379923 12:41578396-41578418 CAAAGTGCTGATATTACTTTGGG + Intergenic
1095484119 12:42666550-42666572 AAACATGCTCATAGTAAAATGGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1098517333 12:71392515-71392537 CCAAATTCTGTAAGTAATATAGG - Intronic
1098608074 12:72419189-72419211 CTAAATTCTGATAGTATAATTGG + Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099065137 12:77967200-77967222 CAATAGGCTGATATTAATAAAGG - Intronic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100733547 12:97500662-97500684 CAAAATGCATATCATAATATCGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101479162 12:105080585-105080607 CAAAATGGTCATAATAATCTAGG + Intronic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101852121 12:108411751-108411773 CAAAATGAAGATAATAATAGTGG + Intergenic
1102941301 12:116944708-116944730 CAAAATGCTAATAGTTAAAATGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104204656 12:126627005-126627027 AAAAATGCTGCTATGAATATGGG - Intergenic
1104659351 12:130599065-130599087 AAAAATGGTGATGGAAATATTGG + Intronic
1105283085 13:18980972-18980994 GAAAATGCTAAGAGTAATAATGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1107410694 13:40155936-40155958 TAAAATACTGAAAGTAATTTGGG - Intergenic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109421616 13:62119738-62119760 CGAAATGCTGAAAAGAATATCGG + Intergenic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1109978603 13:69874579-69874601 TAAAATGATGACATTAATATAGG - Intronic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110822759 13:79935673-79935695 GAAAATGCTGATAATCATAATGG - Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111694036 13:91600971-91600993 CAAAATGCTGTAATTATTATAGG - Intronic
1112170303 13:96966341-96966363 GTAAATGCTAATAGTATTATAGG + Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1112983170 13:105412506-105412528 GAATATGCTGCTAGGAATATTGG + Intergenic
1113344520 13:109463120-109463142 AAATATGCTGATACTTATATTGG + Intergenic
1113845928 13:113391528-113391550 TAAAATCCTGATTGTAATAAAGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114507520 14:23229328-23229350 AATAATGCTGGTAGGAATATTGG + Intronic
1114797321 14:25731153-25731175 CAAATTGCTGATGATAATGTTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115932719 14:38515256-38515278 CAAAAAGCTTATGGTAATGTAGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116544475 14:46147046-46147068 CAAAGTGCTGATAGCAAAAATGG - Intergenic
1116627067 14:47278794-47278816 CAAAAAGCTAATAATAATGTAGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117003027 14:51390934-51390956 AAAAATGCTGCTATGAATATGGG - Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117311516 14:54528882-54528904 CTAAATACTGAGAGTAAAATTGG + Intronic
1118014797 14:61649065-61649087 GAAATTGCTGATTGTAAGATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1121394608 14:93609135-93609157 CCAATTGCTGAGAGGAATATTGG + Intronic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1124144313 15:27109015-27109037 ACAAATGCTCATAATAATATAGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126787395 15:52188599-52188621 CAAAATGCTCATCGAAACATTGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1129165916 15:73777399-73777421 CAAAATGGAGATAGCAATAGGGG - Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138320093 16:56104428-56104450 CAAAAGGCTGATAGTACCAAGGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139081941 16:63532463-63532485 CAAAATGCTTATAGTACAAAGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1140629623 16:76835590-76835612 TGAAATGCTGATGTTAATATTGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1142942853 17:3397408-3397430 TAAAATATTGATATTAATATTGG - Exonic
1143701186 17:8661378-8661400 GAAGATGATGATAGAAATATAGG - Intergenic
1143973443 17:10812732-10812754 GAAAATGGTGACAGAAATATCGG - Intergenic
1144141862 17:12357148-12357170 GAAAATGGTGAGAATAATATTGG + Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149129095 17:53274175-53274197 CCAAATGCTCATAGAAAAATCGG + Intergenic
1149337161 17:55647547-55647569 AAAAATGCTCATAATAATAAAGG + Intergenic
1149546823 17:57510151-57510173 CAAAAGGCTGAAAGTCCTATGGG - Intronic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153461207 18:5335226-5335248 ATAAATGCTTATGGTAATATTGG + Intergenic
1154077365 18:11216915-11216937 CAATAACCTGGTAGTAATATGGG + Intergenic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1154468073 18:14669146-14669168 CAAATAGCTGAGACTAATATAGG + Intergenic
1154958430 18:21282967-21282989 AAAAATGCTCATAGAAAAATAGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156307900 18:35896292-35896314 TAATATGCTGCTAGCAATATGGG + Intergenic
1156578395 18:38346746-38346768 AAAAATGCTGCAAGTAATCTGGG - Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1158405651 18:57157090-57157112 CCAAATCCTAATAGTAGTATTGG - Intergenic
1160010266 18:75101965-75101987 TGAAATGTTGATAGAAATATGGG - Intergenic
1160304846 18:77722750-77722772 AAAAATGCTGAAAGTATTCTAGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924984719 2:260084-260106 CAAAATGCAGACAGTAGTATTGG - Intronic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926255102 2:11186923-11186945 TAAAATGCTGTTTATAATATAGG - Intronic
926399096 2:12477280-12477302 CCAAATGCTAATAGTCTTATAGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930646706 2:53916668-53916690 TAAAATGCTTATTTTAATATAGG - Intronic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
932382195 2:71294823-71294845 CAAATTGCTGAAAGAAATAAAGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933360230 2:81272283-81272305 CAAAAGGGTGACAGTAATACAGG + Intergenic
935093815 2:99924401-99924423 AAAGATGCTAATCGTAATATGGG - Intronic
935107379 2:100057538-100057560 AATAACACTGATAGTAATATTGG - Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937015416 2:118601052-118601074 CACACTGCTGATAGCAATACTGG + Intergenic
937569897 2:123343952-123343974 AATAATGCTGATATGAATATGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
939052473 2:137324548-137324570 CAAAATGCTTATAGTTAAAGGGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
939727587 2:145742226-145742248 AATAATGCAGATATTAATATTGG - Intergenic
940270756 2:151887504-151887526 CAAAATGCAGATAGTAACACTGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942346678 2:175010139-175010161 CTAAATTATAATAGTAATATTGG + Intergenic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
943322458 2:186462386-186462408 CAAAATGCTGGTGGTAGTACAGG + Intergenic
943531590 2:189088473-189088495 CAAAGTGCTGACATTAATAAAGG - Intronic
944705296 2:202282950-202282972 CAAAATGCTGGGATTATTATAGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946468973 2:219938951-219938973 CAGAATGCTCATAGAAACATGGG + Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1169951754 20:11052364-11052386 AAAAATGGTGATAATAATAAGGG - Intergenic
1170199241 20:13724762-13724784 TAACATGCTGAAAGTCATATGGG + Intronic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171197245 20:23209412-23209434 CAGAATGTTGATATAAATATGGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1175526452 20:59637944-59637966 CAAAATGGGGATAATAATAATGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176704231 21:10099171-10099193 TAAAATGATAATACTAATATTGG - Intergenic
1176806442 21:13488504-13488526 CAAATAGCTGAGACTAATATAGG - Intergenic
1177330943 21:19661657-19661679 AAAACTGCTGATGGTATTATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177475914 21:21622436-21622458 GAAAATGCTGCTATGAATATTGG + Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177946790 21:27480396-27480418 CTAAATTTTGATAGAAATATGGG - Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182458284 22:30466709-30466731 CAAAATGGGGATAGCAATGTAGG - Intronic
1184447989 22:44563161-44563183 CAAAGTGTGGATATTAATATTGG + Intergenic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
950990403 3:17431687-17431709 AAATATGCTGATAGTTACATTGG + Intronic
951118760 3:18897924-18897946 CTAAATGCAGATATTAAAATAGG - Intergenic
953158766 3:40398958-40398980 CAAAATGCTGCTGGTATTACAGG - Intronic
953485448 3:43290134-43290156 CAAAGAGCTGACAGTATTATGGG - Intronic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
956838868 3:73118420-73118442 CAAAAAGATAATAGTAATAATGG - Intergenic
957009477 3:74987018-74987040 CAAAATGAAGACATTAATATTGG - Intergenic
957816596 3:85307881-85307903 CAAAATGAAGATATTAAAATAGG + Intronic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
958138129 3:89523341-89523363 CAGAATGCTGCAAGTAATTTGGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964597325 3:158449582-158449604 CAATATGCTGTGAGTAATACTGG + Intronic
964730666 3:159861184-159861206 CACAATGCTGCTAGTAAGGTGGG + Intronic
964828999 3:160862188-160862210 CAAAATACTAAAAGTAATTTTGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965690734 3:171354249-171354271 CAAATTGCTGATTGTAAAAAGGG + Intronic
965788435 3:172361571-172361593 CAAAGCGCTGATGGAAATATGGG - Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966250712 3:177862204-177862226 AAGACTGCTGATAGTCATATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967599933 3:191374592-191374614 CAATATTCTGATAGTTTTATTGG + Intronic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969545164 4:7821333-7821355 CAAAATGCTGACAGTAATGACGG - Intronic
970058516 4:12002438-12002460 CAAAATGGTGATTCTAATAATGG + Intergenic
970337728 4:15068188-15068210 CAAAGTGTTGATCTTAATATTGG + Exonic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974625859 4:64428543-64428565 CAAAATGCTAATCATAATACAGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975099764 4:70499457-70499479 CATAATACTGATATTAAAATTGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
976385898 4:84457945-84457967 CAAAATCCAGAAAGTAACATTGG + Intergenic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979776868 4:124600280-124600302 CAAAATGAAGAAAGTAGTATTGG + Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980569400 4:134594166-134594188 CAATATGATGAGAGTAAAATTGG + Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981249838 4:142586507-142586529 CAAAATGCTGTTGGGAATAATGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981440938 4:144780904-144780926 GATAATGCAGATATTAATATTGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982262835 4:153510117-153510139 CCAAAGGCTGATACTAATTTGGG - Intronic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983695701 4:170527267-170527289 GATAATGCTGATAGTTTTATGGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
984033757 4:174639052-174639074 CAAAAGACAGCTAGTAATATTGG - Exonic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987938404 5:24500233-24500255 TAAAGTGCTGATTTTAATATTGG - Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988262111 5:28900971-28900993 CAAAATGGTGCTGGTAAAATGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989265900 5:39473541-39473563 AAAACTGCTGATAGTACCATGGG - Intergenic
989408162 5:41085633-41085655 GACAATGCTGAAAGAAATATTGG - Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990080465 5:51906651-51906673 GAAAATTTTCATAGTAATATGGG + Intergenic
990454622 5:55973048-55973070 CATAATGTTCATTGTAATATCGG - Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991144996 5:63290940-63290962 CAAAAATCTGATAGAAAAATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992277810 5:75139018-75139040 CCAAATGCTGATTGTTATAAAGG + Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993169035 5:84392924-84392946 CATAATGCTAATATTAAAATTGG + Intergenic
993269542 5:85776473-85776495 AAAAATGGTGATAATAATGTTGG + Intergenic
993574217 5:89581251-89581273 CAAAATGCTTACATTAATTTAGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
994056557 5:95423114-95423136 CAAAATGCTCATTGGAATAGAGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994342016 5:98641379-98641401 CCATATGCTGTTACTAATATTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996185493 5:120468680-120468702 TTAAATGCTGGTATTAATATGGG + Intronic
996662459 5:126020569-126020591 CAAAATGCTGAGATTACAATAGG - Intergenic
997305997 5:132836945-132836967 CAAAATGCTACTAGGATTATAGG - Intergenic
998629109 5:143878659-143878681 CAAAATGCACAAAGTAATAAAGG - Intergenic
998836107 5:146203954-146203976 CACAATGGTGATAGTACTACAGG - Intronic
999324084 5:150632275-150632297 CAAAATGCAGATTGTAATTCAGG - Intronic
999364920 5:151016582-151016604 CAAAATGGGGATAATAATGTTGG + Intergenic
999762615 5:154714084-154714106 CAAAATGGGGATTGTAATCTGGG + Intronic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000934925 5:167296012-167296034 CATAATGCTGATAGTACCTTTGG - Intronic
1000988268 5:167884697-167884719 AATAATGCTGCTAGGAATATTGG + Intronic
1003391272 6:5715129-5715151 TAACATGAGGATAGTAATATGGG - Intronic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006948846 6:37804824-37804846 CAAAATTCTAAGAGGAATATTGG + Intergenic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1007466782 6:42057962-42057984 CTAAATGTTCATAGTAATTTTGG + Intronic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008379812 6:50828257-50828279 CAAATTGCTCTTACTAATATTGG + Intronic
1009215653 6:60917023-60917045 CAAAATGGGTATAATAATATTGG - Intergenic
1009485016 6:64210498-64210520 CAAAATGATGCTATTAGTATGGG - Intronic
1009603142 6:65829464-65829486 CAAAATGAAGAAAGTAACATTGG - Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009638849 6:66303880-66303902 AAAATTGCTGATAATATTATAGG + Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010226484 6:73494251-73494273 GAAAATACTGAGAATAATATTGG + Intronic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012632593 6:101490809-101490831 CAAAATCCTCAGATTAATATAGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014137023 6:117902198-117902220 CATAGTGCTGAAAGGAATATAGG - Intergenic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016600986 6:145860002-145860024 CAAAATGATGTTAGCAGTATAGG - Intergenic
1018040535 6:159917983-159918005 GACAATGCTGATAGTATTTTTGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020472109 7:8549599-8549621 CAAAAAGCAGAGATTAATATTGG - Intronic
1020518001 7:9149433-9149455 AAAAACTCTGATAGTAATACTGG - Intergenic
1020579420 7:9976190-9976212 CAATATGCTAACATTAATATTGG - Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022295317 7:29045731-29045753 CAAAATGTTGATGGTAATCATGG - Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023456717 7:40347499-40347521 CTGAATGCTTATAGTAAAATGGG + Intronic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027172226 7:75880640-75880662 CAAAGAACTGATGGTAATATTGG - Intronic
1027443283 7:78243304-78243326 CAAAATGTTAATAGCAATGTGGG + Intronic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1028228806 7:88281357-88281379 CAAAATGCAGATGGTAATGAAGG - Intronic
1028300015 7:89187047-89187069 TAAAATGCTGAGAGTAAATTTGG - Intronic
1028428961 7:90724270-90724292 CCCATTCCTGATAGTAATATTGG + Intronic
1028676226 7:93465055-93465077 CTGAAAGCTGATAGAAATATAGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1030044056 7:105479020-105479042 AAAAATGCTAATTGTATTATGGG - Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031331237 7:120467189-120467211 CAATATGATGAGAATAATATAGG + Intronic
1032281626 7:130507656-130507678 CAATATACTGATAGCAAAATGGG + Intronic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1032905077 7:136355386-136355408 CAAAAAGCTGTTGGTAATACTGG + Intergenic
1033416368 7:141165106-141165128 CAAAATGCAGAAATTAACATTGG + Intronic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038661439 8:29500788-29500810 AAAAATGCTATTATTAATATTGG - Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040662040 8:49584823-49584845 CAAAATACTAAAAGTAACATGGG + Intergenic
1040692161 8:49952316-49952338 CAAAATCCTGATGAGAATATGGG + Intronic
1041149407 8:54915709-54915731 CACAATGCTGACAGTTATTTTGG - Intergenic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1042896436 8:73674642-73674664 AATCATGCTGTTAGTAATATTGG + Intronic
1043370255 8:79583243-79583265 CAAGACACTGATAGTTATATGGG + Intergenic
1043390640 8:79788091-79788113 CAAAAAGTTGATAGCAACATGGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1043741688 8:83821676-83821698 GACATTGCTGATAGTAACATAGG + Intergenic
1043755247 8:83995254-83995276 CACAATGCTGCTATGAATATGGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044759388 8:95501821-95501843 CAAAGAACTGATAATAATATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045097142 8:98809780-98809802 CATAATGCTGCTATGAATATAGG + Intronic
1045518607 8:102883400-102883422 AATAATGCTGGTAGTAATGTAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045874389 8:106962097-106962119 CAAAATTCAGATGGTAACATAGG - Intergenic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050104769 9:2154142-2154164 CAAAATGCAGAGAGTAAGAGTGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050802197 9:9629473-9629495 CAGGATGCTGATTGTAATTTGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051809858 9:21036681-21036703 CAATATGTTGATAGTAACCTAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052264847 9:26560319-26560341 CAAAAAGCTGATTATAAGATAGG - Intergenic
1052531036 9:29684143-29684165 CAAAATAGGGATAGTCATATGGG + Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053311163 9:37021037-37021059 GAAAATGCTAATAATAGTATGGG - Intronic
1053369888 9:37551855-37551877 CTAACTGCTTATAGTAAAATGGG - Intronic
1053641494 9:40086194-40086216 TAAAATGATAATACTAATATTGG - Intergenic
1053764642 9:41379280-41379302 TAAAATGATAATACTAATATTGG + Intergenic
1054056513 9:45204367-45204389 CAACTTGCAGATAGTAATAAAGG - Intergenic
1054322373 9:63683445-63683467 TAAAATGATAATACTAATATTGG - Intergenic
1054543257 9:66290437-66290459 TAAAATGATAATACTAATATTGG + Intergenic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1056652475 9:88479099-88479121 CAAAAAAATGAAAGTAATATAGG + Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057438149 9:95061438-95061460 CAAAATGCAGAAAGTAAGTTTGG + Intronic
1057584724 9:96319065-96319087 AACAATGCTGCTATTAATATGGG - Intergenic
1058219265 9:102276265-102276287 CAAAAGGCTGCTTGTACTATAGG + Intergenic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058419679 9:104821710-104821732 AAAAATGCTCATACTAAAATTGG - Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058779687 9:108320420-108320442 CAAAATGAAGATAGCTATATTGG + Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1202789267 9_KI270719v1_random:69272-69294 TAAAATGATAATACTAATATTGG - Intergenic
1203420010 Un_KI270382v1:3224-3246 CAACTTGCAGATAGTAATAAAGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1185820193 X:3195796-3195818 CAATATGCTGAAATTATTATTGG + Intergenic
1186323518 X:8454582-8454604 CAAAATGAAGATATTAACATTGG - Intergenic
1187000667 X:15173547-15173569 CAAAATGCAGTGAGTAATGTGGG + Intergenic
1187615487 X:20989451-20989473 CAAGTTGCTGAGAGTACTATTGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189350004 X:40269082-40269104 CAAAATGCTTTTGGTTATATTGG - Intergenic
1189454202 X:41169763-41169785 CAAGATACTGAAAGTAATACAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1190890890 X:54566747-54566769 AAAAATGCTGTTATGAATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192223052 X:69210413-69210435 CAAAATGGGGATGATAATATTGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1195027945 X:100897071-100897093 CTTAATGTTAATAGTAATATTGG + Intergenic
1195230773 X:102844747-102844769 CTAAATGATGATATTATTATAGG + Intergenic
1195525000 X:105877422-105877444 CAAAATGAAGAAATTAATATTGG - Intronic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197204157 X:123775236-123775258 CTAAATGTTGATATGAATATAGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198929246 X:141836195-141836217 CAAAATGTCAATAGTAATAAAGG - Intergenic
1199264195 X:145811122-145811144 CAAAATGCTGATGATTATTTTGG - Intergenic
1199309507 X:146306828-146306850 AAAACTGCTGATGGCAATATAGG + Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199556943 X:149119843-149119865 CAGAAGTCTGAAAGTAATATAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic
1201518862 Y:14850137-14850159 CAAAATTATGCTATTAATATAGG + Intergenic
1201747298 Y:17391546-17391568 CAAAATGCTGATTTTATTGTGGG + Intergenic
1202190458 Y:22238085-22238107 CAAAAGACTTATAGTAAAATGGG - Intergenic