ID: 1015240923

View in Genome Browser
Species Human (GRCh38)
Location 6:131022328-131022350
Sequence GTGTCACGTTACCATGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015240923_1015240924 22 Left 1015240923 6:131022328-131022350 CCTGTCACATGGTAACGTGACAC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1015240924 6:131022373-131022395 TTCTACTCCTAGTTATCTATAGG 0: 1
1: 0
2: 2
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015240923 Original CRISPR GTGTCACGTTACCATGTGAC AGG (reversed) Intronic
900870395 1:5298078-5298100 GTGTCATCCTACCATGTGACTGG - Intergenic
906322919 1:44827836-44827858 GTCTTACCTTAGCATGTGACTGG + Exonic
909413747 1:75382073-75382095 GTTTCCAGTTACAATGTGACTGG + Intronic
915401897 1:155628029-155628051 GTTTCCAGTTACAATGTGACTGG - Intergenic
917862165 1:179156761-179156783 GCGTCACCTTTCCAAGTGACCGG - Intronic
917981466 1:180272166-180272188 GTGGCCCTTTACCATGGGACAGG + Intronic
1063791227 10:9450280-9450302 GTTTCACAGTTCCATGTGACTGG - Intergenic
1067285583 10:44905420-44905442 GTTTCAAGTTACCAGGTGTCAGG - Intergenic
1073804393 10:107081262-107081284 GTCTCAGGTTACCACGTCACAGG + Intronic
1074071051 10:110069723-110069745 GTGTCAGATTACAATTTGACTGG + Intronic
1087153059 11:94875964-94875986 TTGTCATGTTATGATGTGACTGG + Exonic
1087724565 11:101703143-101703165 GTTTCCAGTTACAATGTGACTGG + Intronic
1103303922 12:119949327-119949349 GTGTCACGTTTCTATTTCACAGG + Intergenic
1126523643 15:49624808-49624830 GTTTCACGTTAGCATCAGACAGG - Intronic
1132069097 15:98759902-98759924 GTCTCACGGTACCACGGGACAGG - Intronic
1142268084 16:89074080-89074102 GTGACAGGTTCACATGTGACAGG - Intergenic
1151504027 17:74514463-74514485 GTGACAGGTGATCATGTGACAGG + Intergenic
1157345223 18:46823550-46823572 GTTTCATGTTACTAAGTGACAGG - Intronic
1164370449 19:27638980-27639002 GTTTCCAGTTACAATGTGACTGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1167318524 19:48780920-48780942 AAGTCACGTGTCCATGTGACAGG + Intergenic
925478865 2:4248151-4248173 GATTCACGTTTCCATATGACTGG + Intergenic
927971923 2:27311200-27311222 GGCACATGTTACCATGTGACTGG + Intronic
929018805 2:37529581-37529603 GTGTCACTGTAGCATGTGAAAGG + Intergenic
929637517 2:43539642-43539664 ATGTGAGGTTACCATGTGAATGG + Intronic
934924551 2:98372917-98372939 CTGTCAATTTACCATGTGAAGGG - Intronic
940057413 2:149527205-149527227 ATGTCCAGTTACTATGTGACAGG - Intergenic
943448416 2:188018742-188018764 GACTCACGTTTCCATATGACTGG - Intergenic
1174216727 20:48921705-48921727 GCGTCACGTGACCACGTGACTGG - Intergenic
1176187194 20:63787238-63787260 CTGTCACGCCACCAGGTGACAGG - Intronic
1180838549 22:18946467-18946489 GTTTCCAGTTACAATGTGACTGG + Intergenic
1184047232 22:41979020-41979042 GTGGCTTGTTAGCATGTGACTGG + Intronic
949933773 3:9101005-9101027 CTGACAGGTTTCCATGTGACAGG + Intronic
950030481 3:9849041-9849063 GTTTCCAGTTACAATGTGACTGG - Intronic
957318621 3:78600729-78600751 GTCTCACGTGTCCATGTGAACGG - Intronic
960264224 3:115602215-115602237 GTGACCAGTTACCATGAGACAGG + Intergenic
961297490 3:125898380-125898402 GTTTCACGTTACAATGTGACTGG + Intergenic
968541742 4:1171600-1171622 GTGTCACGGTCCGACGTGACTGG - Intronic
969704297 4:8783681-8783703 GTGTCACATTGCCAGCTGACCGG + Intergenic
983215797 4:165001517-165001539 GTTTCCAGTTACAATGTGACTGG + Intergenic
988515215 5:31898621-31898643 GCATCACTTTGCCATGTGACAGG - Intronic
990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG + Intergenic
992260764 5:74967885-74967907 GTGTCACATTACAAAGTCACTGG - Intergenic
996807890 5:127478246-127478268 GTGCCAAGTTATCATGAGACTGG - Intergenic
999951802 5:156659069-156659091 GTTTCCAGTTACAATGTGACTGG - Intronic
1005576495 6:27194680-27194702 AAGTCACGTGTCCATGTGACAGG + Intergenic
1010591554 6:77718300-77718322 GTTTCCAGTTACAATGTGACTGG - Intronic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017540915 6:155401667-155401689 GTGTCAACTTACCATATGATTGG - Intronic
1018709793 6:166490150-166490172 GTATCGTTTTACCATGTGACTGG - Intronic
1019976229 7:4583789-4583811 GTTTCCAGTTACAATGTGACTGG - Intergenic
1019977165 7:4592293-4592315 GTTTCCAGTTACAATGTGACTGG - Intergenic
1035793032 8:2325463-2325485 CTGTGAAGTTACCATGTGAAAGG + Intergenic
1035799772 8:2396242-2396264 CTGTGAAGTTACCATGTGAAAGG - Intergenic
1038167725 8:25101823-25101845 GTAACATGTTACCATGTAACAGG + Intergenic
1043139608 8:76572188-76572210 GAGTCACGGTTCCATGTGGCTGG + Intergenic
1053392469 9:37745717-37745739 GAGGCACCTAACCATGTGACAGG + Exonic
1057405305 9:94764991-94765013 TTCTCACTTTACCATGTGGCAGG + Intronic
1200125594 X:153812738-153812760 GTGGCTCCTTACCATGTGCCTGG - Intronic