ID: 1015240924

View in Genome Browser
Species Human (GRCh38)
Location 6:131022373-131022395
Sequence TTCTACTCCTAGTTATCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015240923_1015240924 22 Left 1015240923 6:131022328-131022350 CCTGTCACATGGTAACGTGACAC 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1015240924 6:131022373-131022395 TTCTACTCCTAGTTATCTATAGG 0: 1
1: 0
2: 2
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015240924 Original CRISPR TTCTACTCCTAGTTATCTAT AGG Intronic
901210587 1:7523417-7523439 TTCTCTTCCGATTTATCTATAGG - Intronic
906274668 1:44507069-44507091 TTCTGCTCCAAGATAGCTATGGG - Intronic
907933173 1:59018900-59018922 CTCAAATCCTATTTATCTATTGG - Intergenic
909151344 1:72009898-72009920 TTCTACTGCTAGTTAAATCTGGG + Intronic
910079514 1:83324995-83325017 TTCTACTCCTTGTTTACTCTGGG + Intergenic
911483444 1:98474700-98474722 ATGTACTCCTATGTATCTATGGG + Intergenic
912059598 1:105650213-105650235 TTCTACTCCTTGTTACATTTTGG - Intergenic
919147016 1:193648684-193648706 TTCTACTCCCAGTTTTCTGAGGG + Intergenic
922052001 1:222000185-222000207 TTCTATTCTTAGTTTTCTAAAGG + Intergenic
1065310240 10:24408689-24408711 TTCTTCTCCTAGATGTCTGTGGG + Intronic
1065671595 10:28124929-28124951 TTATCCTCTTAGTTATCTACTGG + Intronic
1068406192 10:56592615-56592637 TTCTACTTTTAGTTTTTTATGGG + Intergenic
1070073642 10:73114173-73114195 TTCTACCCCTAAGTAGCTATGGG - Intronic
1074916869 10:117965142-117965164 TTTGATTCCTAATTATCTATAGG - Intergenic
1075092758 10:119452758-119452780 TTCTACTCCAAGTTCTCCACGGG + Exonic
1083569803 11:63753247-63753269 CTCTACTCCCAGGTCTCTATGGG - Intronic
1084368842 11:68724355-68724377 TTCTATTCCTAGTTTCCTAAGGG - Intronic
1085590953 11:77760064-77760086 TTCTACTCCTAGTTATATACAGG + Intronic
1086101558 11:83105408-83105430 TTCTACTCCTAGGAATGTACTGG - Intergenic
1086844014 11:91725693-91725715 TTTTACTTTTAGTTATTTATAGG - Intergenic
1087696951 11:101390179-101390201 TTCTGCTCATTGTTATCTGTTGG + Intergenic
1093390191 12:18609428-18609450 TTCTTCTACTTGTTATTTATTGG + Intronic
1094744251 12:33326425-33326447 TCCCACTCCTAGGTATTTATTGG + Intergenic
1095679892 12:44961458-44961480 TTCTGCTTCAAGTAATCTATTGG - Intergenic
1097769351 12:63563423-63563445 TTCTACTCCTAGTTTGCTGAGGG + Intronic
1098954814 12:76678508-76678530 TTATACTCCTACTTCTCTAGAGG - Intergenic
1099589586 12:84570333-84570355 TTCTCTTCCTATTTATCTATTGG + Intergenic
1099686937 12:85902028-85902050 ATCTACCCCTAGATATATATAGG + Intergenic
1101021006 12:100553774-100553796 TTCTCCTCCTGGTCATCTAATGG + Intronic
1108152108 13:47546905-47546927 TTCTAGTTCTAGTTTTCTTTTGG - Intergenic
1108875076 13:55037046-55037068 TTCAACTCCTATATATATATAGG - Intergenic
1109850102 13:68051878-68051900 TTCTACTTCCAGTTATCTTTTGG - Intergenic
1110974497 13:81812624-81812646 TTCTACTCCTAGTTTTTTGAAGG - Intergenic
1111787762 13:92812156-92812178 TACTACTCAAAGTGATCTATAGG - Intronic
1114126580 14:19733968-19733990 TTCTACTTCTTCTTATCTTTGGG - Intronic
1114471046 14:22962293-22962315 TTCTACTCAAAGATTTCTATTGG - Intronic
1114831218 14:26144243-26144265 TTCTACTCCAAGTTCACTTTTGG - Intergenic
1116259791 14:42610013-42610035 TTCTAGGCCTATTTATTTATAGG + Intergenic
1117195463 14:53335908-53335930 GTCTCCTCATAGTTATCAATGGG - Intergenic
1117593746 14:57305179-57305201 TTCAACAAATAGTTATCTATAGG - Intergenic
1118050922 14:62026780-62026802 TTCTCCTTCTAGTAATGTATTGG + Intronic
1120729124 14:87981803-87981825 TTCTAATTCTTGTTTTCTATTGG - Intronic
1121174354 14:91879588-91879610 TTCTATTCCTGGTTCTCTCTGGG - Intronic
1122674335 14:103398510-103398532 TTCTAATCCTAGTTTGCTATAGG + Intronic
1124697352 15:31875663-31875685 TTCTTGTCCTATTTTTCTATAGG + Intergenic
1125666989 15:41438910-41438932 TTGTACTGCTAGTTACCTAGTGG + Intronic
1126260303 15:46681786-46681808 TTCTATTCCTAGTTTTCTGGAGG - Intergenic
1127169895 15:56290392-56290414 TTTTGCTCCTAGTGATCTCTTGG + Intronic
1127653762 15:61036068-61036090 TTCTGTTCCTAGTTATCTTTCGG - Intronic
1128205851 15:65851539-65851561 TTCTACCCCAAATTATCTAAAGG + Intronic
1129129388 15:73479238-73479260 TTCTATTCCTAGTTTGCTAAGGG + Intronic
1132422075 15:101678456-101678478 TTCAATTCCAATTTATCTATAGG + Intronic
1138841441 16:60512952-60512974 TTCTATTCCTAGGTATTTATTGG - Intergenic
1139288256 16:65834404-65834426 TTTTACTACTATTTATCTTTGGG - Intergenic
1140561687 16:75989817-75989839 TTCTACCCCTAGTTAAATATAGG + Intergenic
1146307539 17:31742238-31742260 TTCAACTCCTGGTTATATGTGGG - Intergenic
1155487660 18:26363827-26363849 TTCTACTCCCACTTCTCTCTGGG - Intronic
1157224544 18:45850436-45850458 CTCAACTCCTAGGTGTCTATGGG - Exonic
1157318369 18:46613723-46613745 TTTTATTTCTAGTTTTCTATGGG + Intronic
1159484215 18:69032677-69032699 TTCTACTGCAAGTGATCTCTGGG + Intronic
1163191425 19:15679638-15679660 TTCTCCTCCTTGTCATCTCTTGG + Intronic
1164143805 19:22497537-22497559 TTCTACTCATTGTATTCTATGGG - Intronic
1167887537 19:52514382-52514404 TTCTAGTCTTTGTTATTTATTGG + Intergenic
1167940014 19:52938964-52938986 TTCTACTCTTTATTATTTATTGG - Intronic
925683870 2:6451777-6451799 TTCTACTCTTTGTTAGCTGTGGG + Intergenic
930759058 2:55012054-55012076 TTCTAATGCTCGTTATTTATTGG - Intronic
930850985 2:55959990-55960012 TTTAACTCCTAGTTAGCTAGTGG + Intergenic
931335157 2:61333817-61333839 TTCTAATTATAGTTATCTAAAGG - Intronic
931870482 2:66453193-66453215 TTGTTCTCCTATTTTTCTATTGG - Intronic
932116940 2:69059831-69059853 TTTAACTCCTGGTTATCTACAGG - Intronic
933239533 2:79904351-79904373 TTATACTCTCAGTTATCTATTGG + Intronic
936906975 2:117548120-117548142 TTCCACTCTTAATGATCTATTGG + Intergenic
938837053 2:135115648-135115670 TTCTACTCCTTGTCCTCTATTGG + Intronic
940455112 2:153887435-153887457 TTTAACTCCTATTTATTTATTGG - Intronic
940754262 2:157663716-157663738 TTCAAATCCTATTTACCTATTGG + Intergenic
941214717 2:162691984-162692006 TTCTACTGCTGCTGATCTATTGG + Intronic
943582203 2:189698263-189698285 TTCTACTCATAGTTATTTATTGG + Intronic
944423576 2:199556757-199556779 TTCTACTCCCAGTGATCTGCGGG + Intergenic
946335643 2:219034175-219034197 TTCTCCTCATATTCATCTATAGG + Intronic
1173496766 20:43525062-43525084 TCCAACTCCTAGTTATCTCTTGG - Intronic
1174906415 20:54556945-54556967 TTCTTCTCTTAGGTATGTATAGG - Intronic
1177958015 21:27625041-27625063 TTCCTCTCCTAGTTTTCCATTGG - Intergenic
1177961232 21:27669388-27669410 TTCCAGTCCTCATTATCTATTGG - Intergenic
1178388422 21:32177270-32177292 TTCTATTCCTAGTTTGCTAAAGG - Intergenic
1178895795 21:36555781-36555803 TTCTACTCCCGATTTTCTATAGG + Intronic
1182160238 22:28114288-28114310 TTCTAACCCTAGATATCTTTAGG + Intronic
1184888272 22:47361560-47361582 TTCTTCTCAATGTTATCTATAGG - Intergenic
950271740 3:11621668-11621690 TTCTACTCCTAGGTACATACTGG - Intronic
950495443 3:13331373-13331395 ATTTGCTCCTAGTCATCTATAGG - Intronic
951807677 3:26664384-26664406 TACTACCCCTAGTTTTCTAGGGG + Intronic
951870786 3:27359491-27359513 TTGTACTTCTAGTTAGTTATGGG - Intronic
956462914 3:69489719-69489741 TTCTATTCCTAGGTATCCACTGG + Intronic
957847858 3:85762120-85762142 TTCTACACTTAGTTATGTAAAGG - Intronic
960013385 3:112857970-112857992 TTCTATTCCTATTTTTCTGTGGG - Intergenic
961053745 3:123768723-123768745 TTCTATTTCTATTTGTCTATGGG + Intronic
964872010 3:161323571-161323593 TTTTACTGTTAGTTATGTATTGG + Intergenic
965382277 3:168004723-168004745 TCCTACTCCTTTTTATGTATTGG + Intergenic
965908751 3:173744581-173744603 TTTAACTCCTACTTATCTCTCGG - Intronic
966089226 3:176111102-176111124 TTCTACTCTTAAGTATATATGGG + Intergenic
966319176 3:178681634-178681656 TCCTACTGCTAGTTATCCAAAGG + Intronic
966579896 3:181549205-181549227 TTCTATTCCTAGTTTTCTGAGGG + Intergenic
969085777 4:4655371-4655393 ATCAACTCCTAATTATCCATAGG - Intergenic
970294763 4:14616938-14616960 CTCTACTCCCAGCTAACTATGGG - Intergenic
970669324 4:18377919-18377941 TTCTACTCCTTGTAATCTCAGGG - Intergenic
974011416 4:56611039-56611061 TTCTACTTTTAGTTTTCTAAGGG - Intergenic
975020337 4:69479145-69479167 TTCTACTTTTAGTTATTTAAGGG - Intergenic
975692129 4:76975844-76975866 TCCTTCTCCAAGTTATCTGTAGG - Intronic
977588805 4:98804070-98804092 TTCTATGCCTATTTATCTGTTGG - Intergenic
980020492 4:127703778-127703800 TTCTACTTCTAGAAATCTACAGG - Intronic
983757197 4:171354436-171354458 TTCTACTTCTAATTATGGATGGG - Intergenic
985180917 4:187261457-187261479 TTCTGCTCCTAGGTATGTATTGG - Intergenic
992669726 5:79047027-79047049 TTTTACCCATAGATATCTATGGG + Intronic
995908092 5:117150686-117150708 TTCTATTTCTGGTTATCTCTGGG - Intergenic
997101838 5:130978409-130978431 TTTTACTCCTAGTAATGTAATGG + Intergenic
997833037 5:137168840-137168862 TTCTACTTCTAGGTATATAAAGG + Intronic
1000492717 5:161934711-161934733 TTCTACTTCTAGTTTTCTTGCGG - Intergenic
1002410009 5:179066718-179066740 TTCTTATCCTTGTTCTCTATAGG + Intronic
1010627782 6:78159633-78159655 TTCTACTCCTAGTAATTTCTGGG - Intergenic
1015240924 6:131022373-131022395 TTCTACTCCTAGTTATCTATAGG + Intronic
1022367558 7:29739358-29739380 TTCTACTCCTAGTTTGCTGAGGG - Intergenic
1022928627 7:35084511-35084533 TTCTACTCCTAGTTTGCTGAGGG + Intergenic
1024092352 7:45954444-45954466 CTCTATTACTAGGTATCTATTGG - Intergenic
1024092407 7:45955399-45955421 CTCTATTACTAGGTATCTATTGG - Intergenic
1027297274 7:76790283-76790305 TTCTACTCCTTGTTTACTCTGGG + Intergenic
1029824740 7:103178189-103178211 TTCTACTCCTAGTTTGCTGAGGG + Intergenic
1030446185 7:109648820-109648842 TTGTACTAATAGTTATCTTTTGG + Intergenic
1030885084 7:114926930-114926952 TTCTAATCCTGGTTCTCTACTGG + Intronic
1032761164 7:134943695-134943717 TGTTACTGCTAGTTATCTTTGGG - Intronic
1034636290 7:152569845-152569867 TTCGACTCGTAGCTATCTGTGGG - Intergenic
1037374631 8:18214181-18214203 TTCTACTCTTTGTTCTGTATTGG + Intronic
1039101661 8:33948033-33948055 ATTTAATCCTAGTTATTTATTGG - Intergenic
1039201860 8:35103989-35104011 TTTTACACCCAGTTATCTACAGG + Intergenic
1039563595 8:38532600-38532622 TTCTACTGCTCATTATCTGTGGG - Intergenic
1043668554 8:82850003-82850025 ATCTGCTCCTATTTATCTATAGG + Intergenic
1044194400 8:89356977-89356999 TTCTACTTCAAATTATGTATGGG + Intergenic
1044424025 8:92030750-92030772 TCCTTCTCCTAGCTATCTCTAGG + Intronic
1044811303 8:96065473-96065495 TTCTTCCACTAGTTACCTATTGG + Intergenic
1047100702 8:121672745-121672767 AGCAACTCCTAGTTATCTTTAGG + Intergenic
1048912535 8:139149769-139149791 TTCTACCCTTAGTTATCTGGAGG - Intergenic
1049121029 8:140737951-140737973 TCCTTTACCTAGTTATCTATGGG + Intronic
1050222131 9:3404454-3404476 TTCCACTGGTACTTATCTATGGG + Intronic
1050634018 9:7591046-7591068 TTCTACTCCTATTTATTCAATGG + Intergenic
1051865959 9:21683087-21683109 TTCTACTTCTAATTACCTAAGGG - Intergenic
1055383945 9:75740910-75740932 TTCTAATCCCAGTTGTCTGTGGG - Intergenic
1056046045 9:82717399-82717421 TTCTATTCCTAGATATTTACAGG - Intergenic
1056407543 9:86289662-86289684 TTCATTACCTAGTTATCTATTGG - Intronic
1187352139 X:18529721-18529743 TTCTTATCCTTGTTCTCTATAGG + Intronic
1187774560 X:22741276-22741298 TTCTACTTCTAGTGATTTAATGG + Intergenic
1189591410 X:42516409-42516431 TGCTATTCTTAGATATCTATTGG + Intergenic
1189966801 X:46382019-46382041 TTCAACTCCTAGCTCTTTATAGG + Intergenic
1190254000 X:48748782-48748804 TTCTAGGCCTAGTTCTCCATTGG - Intergenic
1190568609 X:51758871-51758893 TTCTACTCCTTGTTCTTTATAGG - Intergenic
1192496848 X:71621970-71621992 TTGTACTCCTACTAAGCTATGGG - Intergenic
1198324323 X:135552871-135552893 TTCTACTTCTATTAATATATAGG + Intronic
1200382261 X:155850855-155850877 TTCTCCTCATATTGATCTATAGG + Intergenic
1200919895 Y:8603913-8603935 TTTTACTCCTATTTTTCTCTGGG - Intergenic
1201897764 Y:19011551-19011573 TTCTAGTCCTAGTTTTCTGAGGG - Intergenic