ID: 1015244382

View in Genome Browser
Species Human (GRCh38)
Location 6:131061668-131061690
Sequence GTTTCTATGCTGCAGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015244382_1015244386 10 Left 1015244382 6:131061668-131061690 CCTAGCCCCTGCAGCATAGAAAC 0: 1
1: 1
2: 1
3: 7
4: 189
Right 1015244386 6:131061701-131061723 TCCCTCAACTGCTAAGTCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015244382 Original CRISPR GTTTCTATGCTGCAGGGGCT AGG (reversed) Intronic
903773282 1:25777482-25777504 GTTTCTAGGCTGGTGTGGCTGGG + Intronic
905469748 1:38182921-38182943 ATTTCCAGGCTGCATGGGCTGGG - Intergenic
907271140 1:53291910-53291932 GTCTCTGTGCTGCAGGGACAGGG - Intronic
907496875 1:54851297-54851319 GCTGCTCTGCAGCAGGGGCTGGG - Exonic
911532166 1:99056695-99056717 GTTGCTATAATACAGGGGCTTGG + Intergenic
920294488 1:204947476-204947498 GCTTCTATTCTGGAGAGGCTGGG + Intronic
921029920 1:211327590-211327612 GTTCCTGTTCTGCAGGGTCTTGG + Intronic
923918059 1:238530595-238530617 CTTTCAAGGCTGCAGGGGCAGGG + Intergenic
1063203837 10:3811756-3811778 CTTGCTAACCTGCAGGGGCTGGG + Intergenic
1065689929 10:28322681-28322703 GCTTCTATGGTGCAGGATCTGGG - Intronic
1067743905 10:48919000-48919022 GTTTGTATTCTGCAGTTGCTAGG - Intronic
1067826713 10:49579384-49579406 GTTTCTAGCCTGCCGGGGGTGGG + Intergenic
1068068500 10:52165434-52165456 TTGCCAATGCTGCAGGGGCTAGG + Intronic
1069913950 10:71775734-71775756 GTGTGCAGGCTGCAGGGGCTGGG - Intronic
1070818538 10:79340825-79340847 GATTCTCTGCTGAATGGGCTGGG + Intergenic
1071180733 10:82980489-82980511 GTTTCTATGCTGCTTTGGCCTGG + Intronic
1072728697 10:97830242-97830264 GCTTCTCTGCTGCTGAGGCTTGG + Intergenic
1072742414 10:97917457-97917479 GGTAGTATGCTGGAGGGGCTGGG - Intronic
1075659359 10:124182610-124182632 GATTTTATGTTGCAGGGACTGGG - Intergenic
1075840540 10:125498629-125498651 CGTTGCATGCTGCAGGGGCTTGG + Intergenic
1075929457 10:126283274-126283296 GTTCCTAGGCTACAGGGGTTGGG + Intronic
1077643407 11:3902293-3902315 GTTTATATACTGCAGAAGCTTGG + Intronic
1078324507 11:10368820-10368842 ATTTCTATGTTGGAGGGGTTAGG + Intronic
1078512709 11:11997510-11997532 GCTTCTGTGCTGCCAGGGCTGGG + Intronic
1083990276 11:66242409-66242431 GTTTCTGTGCTGCAGGCCGTGGG - Intronic
1085193564 11:74650774-74650796 GTTTCAAGGCAGCAGAGGCTGGG + Intronic
1085353409 11:75815311-75815333 GTTTCTAGGCTGCAGGGGCTTGG + Exonic
1088133998 11:106531598-106531620 GTTTCTATGTTGCCCAGGCTGGG + Intergenic
1089955187 11:122564016-122564038 GGTGCCATGCTGCAGCGGCTTGG - Intergenic
1090363102 11:126186814-126186836 ATTTCTATACAGCAGGGGCCTGG + Intergenic
1090532904 11:127609653-127609675 CTCTCCATGCTGCTGGGGCTTGG - Intergenic
1095661040 12:44736384-44736406 GTTTCTGTGTAGCAGGGCCTTGG - Intronic
1095863295 12:46943095-46943117 GTCTCTTTGCTTCAGGAGCTGGG + Intergenic
1097244835 12:57601911-57601933 GTTTCTATGATATAGGAGCTAGG + Exonic
1097651498 12:62303608-62303630 GTTTCTATGTGGCGGGGGATGGG - Intronic
1100291967 12:93224233-93224255 GTGTGTGTGTTGCAGGGGCTGGG + Intergenic
1101012311 12:100463577-100463599 CTTTGTGTGCTTCAGGGGCTGGG - Intergenic
1101397326 12:104359818-104359840 GTTACCCTGCTGCAGGGGCTGGG - Intergenic
1104013749 12:124949319-124949341 GGGCCTATGGTGCAGGGGCTTGG - Intronic
1104325846 12:127797372-127797394 GTTTCTGTCTTTCAGGGGCTTGG + Intergenic
1104718778 12:131033244-131033266 GTTTTTGTGTGGCAGGGGCTGGG + Intronic
1105270993 13:18875296-18875318 GGTTCTACGCTGCAGCGGCGAGG - Intergenic
1105910550 13:24861781-24861803 GTTTCTATGGTTCAGGGATTAGG + Intronic
1107027568 13:35818502-35818524 GTTTTTCTCCTGCAGGGTCTTGG + Intronic
1107072611 13:36287204-36287226 GTTACTAAGCTGCTGGTGCTAGG + Intronic
1110079899 13:71296609-71296631 GCTTCCATGCTCCAGGGGCTAGG - Intergenic
1112292229 13:98155009-98155031 CTTGCTATGCTGCTGAGGCTGGG - Intronic
1114317957 14:21524849-21524871 CTTTCTCTGCTGGAGGGGTTGGG - Exonic
1114568165 14:23647477-23647499 CTTTCTCTACTGCAGGGCCTGGG - Intergenic
1121336902 14:93083168-93083190 GGTACTGTGCTGCAGTGGCTTGG - Intronic
1124868657 15:33519085-33519107 GTGTGGATGCTGCAGGGCCTGGG - Intronic
1127134861 15:55909626-55909648 CTTTGTAGGCTGAAGGGGCTTGG - Intronic
1129384420 15:75188129-75188151 CACTCTATGCTGAAGGGGCTGGG - Intergenic
1129427060 15:75471406-75471428 GTTTCCATGTTGCCTGGGCTGGG - Intronic
1129751271 15:78066218-78066240 GTTTCTATGCTGCAGAGGAGTGG - Intronic
1133446704 16:5867477-5867499 GTTTCTGTGCTGCTGGGTTTTGG + Intergenic
1133850264 16:9496759-9496781 GTTTCTATTCTTCCGGGGCCAGG + Intergenic
1134000755 16:10781010-10781032 GTTTCTATGTGGCTGGGGTTGGG - Intronic
1134559508 16:15196113-15196135 CATTCTATACTGCAGAGGCTGGG - Intergenic
1134920047 16:18107724-18107746 CATTCTATACTGCAGAGGCTGGG - Intergenic
1135485858 16:22864049-22864071 GTTTACATGCTGCAGGAGCCAGG - Intronic
1135649371 16:24192610-24192632 GGTTCTATGCTGGTGGGGATGGG - Intronic
1140473802 16:75228773-75228795 GTTTCAGAGCTGCAGGGTCTGGG - Intronic
1140660253 16:77182947-77182969 GTTTGTCTAGTGCAGGGGCTAGG - Intergenic
1140953940 16:79845233-79845255 GTTTCTCTGCTTCTGGGGCCTGG - Intergenic
1142214929 16:88825521-88825543 GTTTCTGGGCAGCCGGGGCTGGG + Intronic
1145939509 17:28735225-28735247 GCTTCTATCCTGCAGGTGGTGGG + Exonic
1147017158 17:37501410-37501432 GTATTGATGCTGCTGGGGCTTGG + Intronic
1147469238 17:40642773-40642795 CTTTCTTTTTTGCAGGGGCTGGG + Intronic
1148165707 17:45482812-45482834 GTTTCAATCCTACAGGGCCTTGG - Intronic
1148903112 17:50893534-50893556 GTTGCTTTGTTGCAGGCGCTGGG + Intergenic
1150396934 17:64829536-64829558 GTTTCGATCCTACAGGGCCTTGG - Intergenic
1155202766 18:23531959-23531981 GTTTCTTTCCTGAAGAGGCTGGG + Exonic
1155751028 18:29422514-29422536 GCTGCTATGCTCCAGGGGATGGG - Intergenic
1155821528 18:30383669-30383691 GTTTCTGTGCTGCAGGGCTCAGG - Intergenic
1156349795 18:36294523-36294545 TGTTCTATGCTCCAAGGGCTTGG + Intergenic
1157447276 18:47755025-47755047 GTTGTTAGGCTGCAGAGGCTGGG + Intergenic
1158823683 18:61190172-61190194 GTGTCTATGTTGCAGGGGGATGG + Intergenic
1159896881 18:74005634-74005656 GTTCCTCTGCTCTAGGGGCTTGG - Intergenic
1160287789 18:77561640-77561662 GTTTTTATGCTGAAGGGTCATGG + Intergenic
1164144754 19:22505140-22505162 TCTTGTATGCAGCAGGGGCTTGG + Intronic
1165795317 19:38516008-38516030 GTTTCTATGGAGATGGGGCTGGG + Intronic
1168145968 19:54420389-54420411 GTTCCCAGGCTGCGGGGGCTGGG - Intronic
1168401096 19:56086810-56086832 CTGTCTCTGCTGCAGGGGCCAGG - Intergenic
925188126 2:1863560-1863582 GTTTCTATCCTTCCGGGGGTCGG - Intronic
925604109 2:5640824-5640846 GATACTGTGCAGCAGGGGCTTGG - Intergenic
925744492 2:7032862-7032884 GTTTCTATGCTGCGTGGGGAGGG - Intronic
926911783 2:17858259-17858281 ATTTCCATGCTCCAAGGGCTTGG + Intergenic
929042315 2:37757261-37757283 ATTTCTGTGCTGAAGTGGCTGGG - Intergenic
929540278 2:42814017-42814039 GTTTCTCTCCTGCTGGGGCCTGG - Intergenic
932534272 2:72575651-72575673 GTTTCTTTGCTGCTGGGCCTAGG + Exonic
933152090 2:78927982-78928004 GGTTCTATGCTGCTGGCACTGGG - Intergenic
934507506 2:94905635-94905657 GTTTCTACTATGCAGGGGGTGGG + Intergenic
934952258 2:98584661-98584683 GTTTCTCTCCTCCAGGGTCTGGG + Intronic
938094221 2:128451195-128451217 GTGTCCCTGCTGGAGGGGCTGGG + Intergenic
939151372 2:138477063-138477085 GTTTACATGCTCCAGGAGCTTGG + Intergenic
940102134 2:150053485-150053507 GTATCTATCCTGCAGCGGGTGGG + Intergenic
942975974 2:182018219-182018241 GTTTCTATGCTGGATGTGTTAGG + Intronic
944270347 2:197777230-197777252 GTTTCTATGCTGCACTAGCATGG + Intronic
945907647 2:215613304-215613326 GATACTGTGCTGCAGCGGCTTGG + Intergenic
946173739 2:217910333-217910355 GTTTAGATGGTGCAGGGGGTGGG - Intronic
948919975 2:241060730-241060752 CTCTCTATGCTGCACAGGCTGGG - Intronic
1173381768 20:42551013-42551035 CTCTCTATGCTTCAGGGGCCTGG + Intronic
1174061676 20:47837459-47837481 GTTTTTAATCTGCTGGGGCTGGG - Intergenic
1174069832 20:47891765-47891787 GTTTTTAATCTGCTGGGGCTGGG + Intergenic
1174206929 20:48846987-48847009 GTTCCTACCCTCCAGGGGCTAGG + Intergenic
1175996318 20:62813682-62813704 CTGTCCCTGCTGCAGGGGCTGGG + Exonic
1176856746 21:13980524-13980546 GTTTCTACACTGCAGCGGCGAGG - Intergenic
1176867838 21:14063688-14063710 GGTTCTACGCTGCAGCGGCGAGG + Intergenic
1180057793 21:45367834-45367856 GTTCATCTGCTGCAGGGCCTGGG + Intergenic
1180156957 21:45982531-45982553 GGCTCTGTGCTGCAGGCGCTGGG + Intronic
1182419548 22:30242274-30242296 GGGTCCAGGCTGCAGGGGCTGGG - Exonic
1182556458 22:31131767-31131789 GTTTTGATGCTGCAAGGCCTTGG + Intronic
1183433021 22:37777184-37777206 GTCTCAATGGTGCAGGGGGTGGG + Intergenic
1184606100 22:45575716-45575738 GTTTCTCTGGAGCAGGGCCTGGG + Intronic
949537701 3:5008508-5008530 ATGTGAATGCTGCAGGGGCTAGG - Intergenic
949599300 3:5580962-5580984 CTCTCTAGGCTGCAGGGGCAAGG - Intergenic
950641924 3:14353981-14354003 GCTACAATGCTGGAGGGGCTTGG + Intergenic
953025897 3:39144778-39144800 GTCTATTTGCTGCAGGGGCTGGG - Intronic
954455241 3:50594598-50594620 TTTTCTCTGCTGCAGAGGCCAGG + Intergenic
956318185 3:67963567-67963589 CTTTCCATGCTGCACTGGCTGGG - Intergenic
959700431 3:109293553-109293575 ATTTCTATGTGCCAGGGGCTGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
966674659 3:182572241-182572263 GGTGCTATGCTGCAGCAGCTTGG - Intergenic
967478040 3:189943384-189943406 GTTGCTGTGGTTCAGGGGCTGGG - Intergenic
967906370 3:194504277-194504299 GATTCTTTGCTGTGGGGGCTGGG + Intergenic
968032906 3:195518199-195518221 GTTGCTAGGCTGCAGGGGCTGGG + Intronic
972678819 4:41286174-41286196 GTGTCTGTGCACCAGGGGCTGGG - Intergenic
974599907 4:64064761-64064783 CTATCTATGTTGCTGGGGCTGGG - Intergenic
980126091 4:128775749-128775771 GGTTCTATTCTGCAGGTGCTGGG - Intergenic
983982253 4:174012805-174012827 GTTTCTGTGATGCGGGGGCAGGG - Intergenic
984791460 4:183618653-183618675 GTTTCTGTGCTGCAGGCTCGAGG + Intergenic
985321007 4:188711137-188711159 GATTGTGTGCTGCAGGGACTGGG + Intergenic
987421783 5:17729066-17729088 TTTTCCTGGCTGCAGGGGCTAGG + Intergenic
988796684 5:34657703-34657725 GTCTCAAGGCTGCAGGGGCCTGG + Intronic
990734158 5:58841511-58841533 GGTGCTATGCTGCAGAAGCTTGG + Intronic
992002292 5:72447471-72447493 GTATCTGTGCTCCAGGGGCCTGG - Intronic
992103024 5:73425738-73425760 GTTTCTATGGGTCAGGAGCTGGG + Intergenic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992857679 5:80879730-80879752 GTTTCTAAGCTGAAGGAGTTTGG - Intergenic
1001838133 5:174849614-174849636 GTGTCCATGCTGCAGCTGCTGGG + Intergenic
1002875576 6:1205851-1205873 GTGTCTATGTATCAGGGGCTGGG - Intergenic
1003081300 6:3023893-3023915 GATTGTAGGCTGCAGAGGCTGGG + Intergenic
1004180754 6:13378774-13378796 GTTCCTAGGCTGCAGGAGGTGGG - Intronic
1004319325 6:14620506-14620528 CTTTCTATGCTGCAGTTTCTTGG + Intergenic
1004867187 6:19865519-19865541 ATTCCCATTCTGCAGGGGCTGGG + Intergenic
1005491071 6:26347672-26347694 GTTTTTGTTTTGCAGGGGCTGGG - Intergenic
1005923298 6:30418874-30418896 GTGTCTAGGCTGGTGGGGCTTGG + Intergenic
1006227796 6:32554916-32554938 GTTGCGGTGATGCAGGGGCTGGG + Intronic
1006230466 6:32581783-32581805 GTTGTGGTGCTGCAGGGGCTGGG + Exonic
1006258980 6:32853090-32853112 GCTTCTAGGCTGCCTGGGCTCGG - Exonic
1006574717 6:35036484-35036506 GTTGCTATGCAGCAGAGGTTTGG - Intronic
1007351811 6:41279028-41279050 GATTCTTTGCTGCTGGGGCATGG - Intronic
1008145854 6:47890746-47890768 CTTTCCTTGCTGCAGGGCCTTGG + Intronic
1008406017 6:51119413-51119435 ATTTTTCTGGTGCAGGGGCTAGG + Intergenic
1008875942 6:56327899-56327921 TTTTCTCAGCTGCAGGTGCTGGG - Intronic
1015178259 6:130335026-130335048 GTCTCTGAGCTGCAGGGGATGGG + Intronic
1015244382 6:131061668-131061690 GTTTCTATGCTGCAGGGGCTAGG - Intronic
1015581261 6:134727900-134727922 TTTTCTCTGCTTCAGGGTCTTGG - Intergenic
1016822742 6:148361732-148361754 GTTTCTATGCTGCCATGGCCAGG - Intronic
1017285337 6:152668167-152668189 GTTTTTGTGCTCCACGGGCTTGG + Intergenic
1018435140 6:163752462-163752484 GGTTCTGTGGGGCAGGGGCTTGG + Intergenic
1019970360 7:4535821-4535843 CTTTCTATCCTGCAGAGGCCTGG - Intergenic
1020205443 7:6111416-6111438 GTGTAAATGCTGCTGGGGCTTGG + Intronic
1020971454 7:14946705-14946727 GTTTCTATTCTTCAATGGCTAGG - Intronic
1021782093 7:24116232-24116254 GCTTATATGCTGCAGGGAATGGG + Intergenic
1022872719 7:34496131-34496153 GGTGCCATGCTGCAGGGGTTGGG - Intergenic
1023086351 7:36573362-36573384 GATTCTCTGGTGCAGGGGTTAGG - Intronic
1023480184 7:40625718-40625740 GTGTTAATGTTGCAGGGGCTGGG - Intronic
1028040875 7:86052868-86052890 TTTACTATGCTTCGGGGGCTAGG + Intergenic
1032195951 7:129788672-129788694 GTTTCTCTGCAGCAGAGGCTGGG - Intergenic
1032499976 7:132392932-132392954 GGTCCTCTGCTGCAGGGCCTGGG - Intronic
1032579397 7:133090487-133090509 GTTTCGAAGATGCAGGAGCTGGG - Intergenic
1034219464 7:149432742-149432764 GTTTCCTAGCTGCAGGGGCGGGG + Exonic
1035122300 7:156578870-156578892 GCTTCTGTGCTGAAGGGGCACGG + Intergenic
1035527764 8:327036-327058 GTTTCTGTCCTGCAGTGTCTGGG - Intergenic
1038922109 8:32096097-32096119 GAGTCTATGATGCAAGGGCTAGG + Intronic
1039891496 8:41688656-41688678 GCTCCTATGCTGCAGGGGTGTGG + Intronic
1043695106 8:83208043-83208065 CTTTCAATCCTGCAGGGGCAGGG - Intergenic
1044648259 8:94467671-94467693 GTTTCTATGCTTGGGGGGCCAGG - Intronic
1045052454 8:98339647-98339669 GATTTGATGTTGCAGGGGCTGGG + Intergenic
1052254430 9:26437568-26437590 GTTGCTTTACTGCAGGTGCTTGG - Intergenic
1052982458 9:34458834-34458856 GATTCTATCCTGCAAGGGCACGG + Exonic
1055733930 9:79308127-79308149 GCTTCTAAGCTGCAGGAGATGGG - Intergenic
1056931810 9:90883817-90883839 GTGTGGATGCTGCAGTGGCTGGG - Intronic
1057320011 9:94004069-94004091 ACTCCTATGCTGCAGGTGCTGGG - Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058138152 9:101330049-101330071 GTTTCTCTGGTTCAGGGCCTGGG + Intergenic
1059166649 9:112082920-112082942 GTTTCTATGTTGCCCAGGCTGGG + Intronic
1059856082 9:118398813-118398835 AATTCTATGCTGGATGGGCTTGG + Intergenic
1061730470 9:132610142-132610164 GATTCTAGGCTGCGGGGCCTGGG - Intronic
1187925173 X:24243144-24243166 GTTTCTATGCTGCAGGAATCAGG - Intergenic
1189518741 X:41743522-41743544 GTTTTTGTACTGCTGGGGCTAGG - Intronic
1194884531 X:99296649-99296671 CTGTCTCTGCTGCAGAGGCTGGG + Intergenic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1196779015 X:119365719-119365741 GTTTGTATGCATCAGGGGCCAGG + Intergenic
1197248433 X:124190097-124190119 GTTTCTATACTGAAGTGGTTTGG + Intronic
1199686060 X:150266710-150266732 GTTTCAATACTTTAGGGGCTGGG - Intergenic
1199717212 X:150515349-150515371 GGTTCTAAGCAGCAGTGGCTGGG - Intergenic