ID: 1015249131

View in Genome Browser
Species Human (GRCh38)
Location 6:131108241-131108263
Sequence CTCTTTCTGTTCCCAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2525
Summary {0: 5, 1: 83, 2: 160, 3: 868, 4: 1409}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015249131_1015249136 11 Left 1015249131 6:131108241-131108263 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 1015249136 6:131108275-131108297 CTTACAGTTCCACATGACTGGGG 0: 100
1: 2177
2: 6229
3: 7255
4: 7382
1015249131_1015249135 10 Left 1015249131 6:131108241-131108263 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 1015249135 6:131108274-131108296 ACTTACAGTTCCACATGACTGGG 0: 102
1: 2350
2: 6340
3: 7233
4: 7449
1015249131_1015249134 9 Left 1015249131 6:131108241-131108263 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 1015249134 6:131108273-131108295 GACTTACAGTTCCACATGACTGG 0: 105
1: 2218
2: 5943
3: 7034
4: 7262
1015249131_1015249137 14 Left 1015249131 6:131108241-131108263 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 1015249137 6:131108278-131108300 ACAGTTCCACATGACTGGGGAGG 0: 227
1: 4437
2: 6989
3: 7750
4: 6141
1015249131_1015249139 28 Left 1015249131 6:131108241-131108263 CCTGAAACTGGGAACAGAAAGAG 0: 5
1: 83
2: 160
3: 868
4: 1409
Right 1015249139 6:131108292-131108314 CTGGGGAGGCCTCAGAATCACGG 0: 927
1: 5460
2: 6455
3: 4087
4: 2288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015249131 Original CRISPR CTCTTTCTGTTCCCAGTTTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr